# Trim bases and adapters using skewer
skewer -t 12 -Q 20 -q 3 sample1.read1.fastq.gz sample1.read.2.fastq.qz -o sample1
# Parameters used:
# -- 3' end adapter sequence (-x):        AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
# -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
# -- maximum error ratio allowed (-r):    0.100
# -- maximum indel error ratio allowed (-d):      0.030
# -- mean quality threshold (-Q):         20
# -- end quality threshold (-q):          3
# -- minimum read length allowed after trimming (-l):     18

# Align to genome using HiSAT2
hisat2-build --verbose genome.name genome.name
hisat2 -x genome.name -p threads -1 sample1.trimmed_R1 -2  sample1.trimmed_R2 -S sample1.sam
samtools view -bS sample1.sam samtools sort -o sample1.bam
system index sample1.bam samtools

# Run Opposum to clean alignment from hiSat
python ./Opossum-master/Opossum.py --BamFile=sample1.bam --OutFile=sample1.opossum.bam 

# Call SNPs and FST
samtools mpileup -f 002099425_GCF.1_phaCin_unsw_v4.1_genomic.fna -u -g -b ALL.sample.IDs.txt > combined.rawcalls.bcf
# sample.IDs.txt is a file containing a list of all bam file names to process.
bcftools call -vm combined.rawcalls.bcf > combined.rawcalls.vcf
vcftools --vcf combined.rawcalls.vcf --max-missing 0.5 --maf 0.2 --minQ 30 --recode --recode-INFO-all --out combined.filteredcalls
# rename combined.filteredcalls.recode.vcf as combined.filteredcalls.vcf
vcftools --vcf combined.filteredcalls.vcf --weir-fst-pop QLD.sample.IDs.txt --weir-fst-pop SA.sample.IDs.txt --out combined.filteredcalls
# QLD.sample.IDs.txt = list of sample names from Queensland
# SA.sample.IDs.txt = list of sample names from South Australia