assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 1

assistant: {'Thoughts': 'Great! You have selected Meta-Mode. In this mode, I will provide step-by-step guidance on pre-defined tasks related to CRISPR technology.', 'Choice': '1'}

assistant: Please select the general gene editing scenarios to continue.
1. Generating a Knockout Using CRISPR.
2. CRISPR Base Editing Without Double-Strand Breaks.
3. Generating Small Insertion/deletion/base editing through Prime Editing.
4. Activation or Repression of Target Genes Using CRISPR.


user: 1

assistant: {'Thoughts': 'Generating a knockout using CRISPR involves disrupting or deleting a specific gene of interest. This can be achieved by introducing a double-strand break in the target gene and relying on the cellular repair machinery to introduce errors during the repair process, leading to frameshift mutations and gene knockout. Alternatively, a non-homologous end joining (NHEJ) repair pathway can be exploited to introduce a small deletion or insertion in the target gene, resulting in a knockout. CRISPR knockout is widely used for functional studies of genes and understanding their role in various biological processes.', 'Choice': '1'}

assistant: Now, let's start designing and planning your knockout experiment using CRISPR system, we will go through a step by step process as listed below:
1. Selecting a CRISPR/Cas system.
2. Selecting a delivery approach for CRISPR/Cas system.
3. Designing guideRNA for gene knockout.
4. Collecting appropriate experimantal protocols and validating the editing outcomes.


assistant: 
Step 1. Selecting a CRISPR/Cas system 

We support four types of CRISPR/Cas system for CRISPR knockout, SpCas9, enCas12a, SaCas9, and SpRYCas9, representing distinct variants with unique properties and applications.

1. SpCas9  (Jinek et al.,Science,2012;Cong et al.,Science,2013;Mali et al.,Science,2013;Jinek et al.,eLife,2013)
- Pros: Highly effective, well-studied, proven applications in many cell types/scenarios.  
- Cons: Large, potential off-target effects.  
- Uses: Genetic research, gene therapy, genetically modified models/organisms (GMMs/GMOs).

2. enCas12a  (Kleinstiver et al.,Nat Biotechnol.,2019;DeWeirdt et al.,Nat Biotechnol.,2020)
- Pros: Smaller, precise, low off-target rate, multi-target editing capability using a single guideRNA array.  
- Cons: May be less efficient than SpCas9 when using a single guideRNA (mitigated if using multi-guide array), limited target sites vs. SpCas9 due to more restrictive PAM.  
- Uses: High-precision and multiplexed genome editing (for genetic interaction, target redundant genes/pathways).

3. SaCas9  (Ran et al.,Nature,2015)
- Pros: Compact, suitable for AAV vectors (knockout genes in primary cells or in vivo).  
- Cons: limited target sites vs. SpCas9 due to more restrictive PAM.  
- Uses: In vivo gene therapy and some primary cells when using AAV delivery.

4. SpRYCas9  (Walton et al.,Science,2020)
- Pros: Wide PAM range, targets more genomic regions vs. typical SpCas9.  
- Cons: Higher off-target risks.  
- Uses: editing a specific target site where canonical PAMs for SpCas9/SaCas9/enCas12a are not available, and where specificity/off-target concerns are less critical.

*Please cite the corresponding papers if you decide to use the system.


assistant: 
Please select the CRISPR-Cas system you would like to use. Or please briefly describe your need (exp: I want to edit mouse liver/I want low off-target rate/I want to do multiplexed editing) and we could recommend the CRSIPR-Cas system to you.


user: I would like to do multiplexed editing.

assistant: {'Thoughts': "The user input indicates a need for multiplexed editing. Among the listed Cas systems, enCas12a is noted for its unique ability to simultaneously cut multiple sites, making it particularly suitable for applications requiring efficient targeting and editing of several genomic locations in a single experiment. This makes enCas12a the most relevant choice for the user's requirement.", 'Answer': 'enCas12a'} Final Result enCas12a

assistant: 
Step 2. Selecting a delivery approach for CRISPR/Cas system

Different biological systems are amenable to different delivery methods for genome-editing tools. We currently support the following delivery method:

a. Plasmid transfection
b. Lentivirus/Retrovirus delivery
c. RNP/mRNA Electroporation
d. RNP/mRNA Microinjection
e. mRNA LNP
f. AAV (Adeno-Associated Virus)


Please select one from above or please briefly describe your application cases below (exp. I hope to edit A549 cell lines/ I hope to edit mouse liver).

*Please note we currently only support mammalian cells/tissues.


user: I hope to edit A375 cell line.

assistant: Please find the recommended delivery approach below:

Top choice: 
### b. Lentivirus/Retrovirus

**Introduction**: Lentivirus and retrovirus vectors are tools for delivering genetic material into cells, allowing stable integration of the transferred genes into the host genome, leading to long-term expression.

- **Pros**:
  - **Stable Expression**: Allows for permanent gene expression modifications in the host cell.
  - **Broad Host Range**: Capable of infecting both dividing and non-dividing cells.
  - **High Efficiency**: Especially effective in hard-to-transfect cell types.

- **Cons**:
  - **Safety Concerns**: Though lentiviral vectors are designed to be safe, there remains a theoretical risk of insertional mutagenesis.
  - **Complex Production**: Virus production and purification can be technically challenging and time-consuming.
  - **Regulatory and Biosafety Considerations**: Use of viral vectors requires strict adherence to biosafety guidelines.

- **Applications**: Ideal for studies requiring stable gene expression, gene therapy research, and cell line generation.


The relevant papers we found on Google Scholar: 
- The biological effect and mechanism of the Wnt/β‑catenin signaling pathway on malignant melanoma A375 cells: https://www.spandidos-publications.com/10.3892/etm.2018.6413?text=abstract
- RNAi-mediated IARS2 knockdown inhibits proliferation and promotes apoptosis in human melanoma A375 cells: https://www.spandidos-publications.com/10.3892/ol.2020.11688
- Reprogramming A375 cells to induced‑resembled neuronal cells by structured overexpression of specific transcription genes: https://www.spandidos-publications.com/mmr/14/4/3134
- Role of inhibitor of growth 4 in the suppression of human melanoma cells through the Fas/FasL-mediated apoptosis pathway: https://www.spandidos-publications.com/10.3892/ijmm.2017.3274
- microRNA‐216b inhibits cell proliferation and migration in human melanoma by targeting FOXM1 in vitro and in vivo: https://onlinelibrary.wiley.com/doi/abs/10.1002/cbin.10754
- Downregulation of Bmi-1 suppresses epithelial‑mesenchymal transition in melanoma: https://www.spandidos-publications.com/or/37/1/139
- Overexpression of c-MYC Promoter Binding Protein-1 Enhances Proliferation and Glucose Metabolism of Melanoma Cells Lines: https://ar.iiarjournals.org/content/43/6/2527.abstract
- Targeting hypoxia-inducible factor-1α with Tf–PEI–shRNA complex via transferrin receptor–mediated endocytosis inhibits melanoma growth: https://www.cell.com/molecular-therapy-family/molecular-therapy/fulltext/S1525-0016(16)31503-9
- Effect of Fam114A1 protein on the biological function of melanocytes: a preliminary study: https://pesquisa.bvsalud.org/portal/resource/pt/wpr-870343
- Both HDAC5 and HDAC6 are required for the proliferation and metastasis of melanoma cells: https://link.springer.com/article/10.1186/s12967-015-0753-0

Second choice: 
 ### a. Plasmid Transfection

**Introduction**: Plasmid transfection is a technique used to introduce foreign DNA into a host cell, typically using chemical, physical, or biological methods. This process enables the study of gene function and protein expression in a cellular environment.

- **Pros**:
  - **Simple and Cost-Effective**: Compared to other methods, plasmid transfection is relatively easy to perform and inexpensive.
  - **High Efficiency in Some Cell Types**: Works particularly well in certain easily transfectable cell lines.
  - **Non-Viral**: Reduces the risks associated with viral vectors, such as immune responses or insertional mutagenesis.

- **Cons**:
  - **Transient Expression**: Generally results in temporary gene expression, requiring repeated transfection for sustained effects.
  - **Variable Efficiency**: Efficiency can vary widely between different cell types, especially hard-to-transfect cells like primary cells.
  - **Size Limitation**: There's a limit to the size of the DNA plasmid that can be effectively transfected.

- **Applications**: Widely used in research for gene expression studies, protein production, and genetic engineering.


The relevant papers we found on Google Scholar: 
- The biological effect and mechanism of the Wnt/β‑catenin signaling pathway on malignant melanoma A375 cells: https://www.spandidos-publications.com/10.3892/etm.2018.6413?text=abstract
- CADM1/TSLC1 inhibits melanoma cell line A375 invasion through the suppression of matrix metalloproteinases: https://www.spandidos-publications.com/mmr/10/5/2621
- MicroRNA‐330 inhibits growth and migration of melanoma A375 cells: in vitro study: https://onlinelibrary.wiley.com/doi/abs/10.1002/jcb.29211
- c-FLIPp43 induces activation of the nuclear factor‑κB signaling pathway in a dose-dependent manner in the A375 melanoma cell line: https://www.spandidos-publications.com/10.3892/mmr.2014.2364
- CDK5RAP1 targeting NF-κB signaling pathway in human malignant melanoma A375 cell apoptosis: https://www.spandidos-publications.com/10.3892/ol.2018.7920?text=fulltext
- Downregulation of BRCA1 in A375 melanoma cell line increases radio-sensitivity and modifies metastatic and angiogenic gene expression: https://www.sciencedirect.com/science/article/pii/S0022202X15306813
- Apoptosis induced by synthetic retinoic acid CD437 on human melanoma A375 cells involves RIG-I pathway: https://link.springer.com/article/10.1007/s00403-008-0902-x
- RLIP76 silencing inhibits cell proliferation and invasion in melanoma cell line A375.: http://www.europeanreview.org/wp/wp-content/uploads/2054-2060-RLIP76-silencing-inhibits-cell-proliferation.pdf
- Apoptotic effect and mechanisms of AHPN on human skin malignant melanoma cell A375: https://www.sciencedirect.com/science/article/pii/S1007437608600040
- Downregulation of discoidin domain receptor 2 in A375 human melanoma cells reduces its experimental liver metastasis ability: https://www.spandidos-publications.com/10.3892/or.2011.1356



assistant: Which delivery method would you like to use?


user: I would like to use lentivirus.

assistant: {'Thoughts': 'The user wants to use lentivirus for delivery. Lentivirus vectors are known for their stable gene expression and broad host range. They are particularly effective in hard-to-transfect cell types. Lentivirus is commonly used in gene therapy research and cell line generation. However, it is important to consider the safety concerns, complex production process, and regulatory considerations associated with lentiviral vectors.', 'Choice': 'b'}

assistant: 
Step 3. Designing guideRNA for gene knockout

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


user: I hope to design 4 sgRNAs targeting human NECTIN1 gene.

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


assistant: Sugessted exon/exons: {'Exon/exons': 'Exon 3, Exon 5, Exon 7, Exon 9', 'Reason': {"Since the user has not specified any particular exons, it is advisable to target exons that are critical for the gene's function and are conserved. Exons 3, 5, 7, and 9 are typically important in many genes due to their roles in coding essential domains. Targeting multiple exons can also ensure a more effective gene knockout."}}

assistant: 
Based on the information you provided, it may be beneficial to design sgRNAs targeting specific exons within the genes.

Would you like to continue sgRNA design with the exon/exons we suggested?


user: no

assistant: https://crispr-gpt.s3.amazonaws.com/3b0eeb1e-2442-47a4-9b97-1e5bd6190738?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=pwPmZJ97SIKnkIjsYLVeSicz4Xg%3D&Expires=1725296156

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence          | PAM Sequence   |   Exon Number |   sgRNA Cut Position (1-based) |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:------------------------|:---------------|--------------:|-------------------------------:|---------------------------:|------------------:|----------------:|
| NECTIN1              | CRISPRko           | ATCGGCACAGACGTGGTTCTGCA | CTTC           |             2 |                      119678698 |                     0.7867 |                14 |               1 |
| NECTIN1              | CRISPRko           | TCGATTGCCCGTAGGGAAGGTAG | TTTC           |             2 |                      119678464 |                     0.81   |                26 |               2 |
| NECTIN1              | CRISPRko           | CACACGCTCGCGGTAGGGAGCCA | ATTC           |             2 |                      119678575 |                     0.7123 |                21 |               3 |
| NECTIN1              | CRISPRko           | TCAGAACGACGGGTCTTTCATTT | TTTC           |             6 |                      119664772 |                     0.8713 |               108 |               4 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


user: no

assistant: Step 4. Collecting appropriate experimantal protocols and validating the editing outcomes.

Based on information from the previous step 2, we are showing you related protocols using Lentivirus/Retrovirus delivery


assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: 1

assistant: {'ChatResponse': {'Thoughts': 'The user wants to start with the first step.', 'Choice': '1'}}

assistant: [BP1.docx](https://crispr-gpt.s3.amazonaws.com/BP1.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=ikcdTeMJii91or1xiYg0Ub%2Bz6Zs%3D&Expires=1725296192)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP1

assistant: {'ChatResponse': {'Thoughts': "The user wants to access a support protocol. They typed in 'SP1'.", 'Choice': 'SP1'}}[SP1.docx](https://crispr-gpt.s3.amazonaws.com/SP1.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=2u1%2B%2BGfGXhsPBZO%2BsqbwlqakxcU%3D&Expires=1725296196)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP2

assistant: {'ChatResponse': {'Thoughts': "The user wants to access a support protocol. They typed in 'SP2'.", 'Choice': 'SP2'}}[SP2.docx](https://crispr-gpt.s3.amazonaws.com/SP2.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=%2FVm%2BEl7q5h%2B%2BTZBJ5Tn%2BMjoJEqI%3D&Expires=1725296200)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP3

assistant: {'ChatResponse': {'Thoughts': 'The user wants to access a support protocol. They have chosen SP3.', 'Choice': 'SP3'}}[SP3.docx](https://crispr-gpt.s3.amazonaws.com/SP3.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=sQ9Lqf6WOV8tAXfzVb8haA0aoOc%3D&Expires=1725296203)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: no

assistant: {'ChatResponse': {'Thoughts': 'The user does not want to access the support protocols.', 'Choice': 'no'}}

assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: 2

assistant: {'ChatResponse': {'Thoughts': 'The user is interested in step 2 of the protocol.', 'Choice': '2'}}

assistant: [BP2.docx](https://crispr-gpt.s3.amazonaws.com/BP2.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=SP6hd42FHs796OnKDEx2NzaE%2B6w%3D&Expires=1725296222)



[BP4.docx](https://crispr-gpt.s3.amazonaws.com/BP4.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=dPHURH4hAeRWT%2FN4f4eNvB6eCZQ%3D&Expires=1725296222)



assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: end

assistant: {'ChatResponse': {'Thoughts': 'The user wants to end the process.', 'Choice': 'end'}}

assistant: In this protocol, you can validate the knockout through the following ways, including: 

1. Staining of target protein by antibody, and measure level of knockout using flow cytometry or western blot.
2. Mutation sequencing by Sanger Sequencing
3. Mutation sequencing by Next-generation Sequencing (NGS)

Which one would you like to use?


user: 1

assistant: Here are several methods you can use to measure and validate protein-level knockouts:

1. Western Blotting:
    - Western blotting is a widely used technique for detecting and quantifying specific proteins in a sample. After treating cells with CRISPR, lysates from these cells can be run on SDS-PAGE gels, transferred to membranes, and probed with antibodies specific to the target protein. A significant reduction or absence of the target protein in the CRISPR-treated sample as compared to the control indicates a successful knockout.
    - Ensure you also probe for a housekeeping protein (like GAPDH or β-actin) to serve as a loading control, ensuring that any observed changes in protein level are not due to variations in protein loading or transfer.
    - Example protocols:
    (i) https://www.addgene.org/protocols/western-blot/

2. Immunofluorescence:
    - Immunofluorescence allows for the visualization of the presence and localization of proteins within cells. Cells edited by CRISPR and controls are fixed, permeabilized, and incubated with an antibody against the target protein, followed by a fluorescently labeled secondary antibody. Fluorescence microscopy is then used to detect the presence of the target protein. A successful knockout is indicated by a marked reduction or absence of fluorescence in the edited cells compared to control cells.
    - This method can provide information not just on the presence of a protein but also on its localization, which can be valuable in functional studies.
    - Example protocols:
    (i) https://www.addgene.org/protocols/immunocytochemistry

3. Enzyme-Linked Immunosorbent Assay (ELISA):
    - ELISA is a plate-based assay technique designed for detecting and quantifying soluble substances such as peptides, proteins, antibodies, and hormones. In the context of CRISPR validation, an ELISA can be used to quantify the target protein in lysates from CRISPR-treated and control cells. A successful knockout would show a significant reduction in the target protein level in the CRISPR-treated samples compared to controls.
    - ELISA is sensitive and can be more quantitative than Western blotting but requires specific antibodies and standards for quantification.
    - Example protocols:
    (i) https://www.sigmaaldrich.com/US/en/technical-documents/protocol/protein-biology/elisa/elisa-protocols

4. Flow Cytometry:
    - If the target protein is expressed on the cell surface, flow cytometry can be used to assess the knockout efficiency. Cells are labeled with a fluorescent antibody against the target protein, and the fluorescence intensity is measured. A decrease in fluorescence intensity in the CRISPR-treated cells compared to control cells indicates a successful knockout.
    - This method provides the advantage of analyzing individual cells in a population, giving insights into the efficiency of knockout across the cell population.
	- Example protocols:
    (i) https://www.abcam.com/protocols/flow-cytometry-for-intracellular-and-extracellular-targets
