assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 1

assistant: {'Thoughts': 'The user has selected option 1, which is Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task). This mode will provide structured guidance on a predefined task related to CRISPR technology.', 'Choice': '1'}

assistant: Please select the general gene editing scenarios to continue.
1. Generating a Knockout Using CRISPR.
2. CRISPR Base Editing Without Double-Strand Breaks.
3. Generating Small Insertion/deletion/base editing through Prime Editing.
4. Activation or Repression of Target Genes Using CRISPR.


user: 4

assistant: {'Thoughts': 'The user has selected the option to activate or repress target genes using CRISPR. This involves using a modified version of the CRISPR system, such as CRISPRa (CRISPR activation) or CRISPRi (CRISPR interference), to regulate gene expression without introducing double-strand breaks in the DNA.', 'Choice': '4'}

assistant: 
CRISPR-Cas9 system can also be used to modulate gene expression, turning genes on (activation) or off (repression). This involves using a deactivated or 'dead' form of the Cas protein, dCas, which can still bind to DNA but no longer cuts it. The dCas9 can be fused with transactivators or repressors to upregulate or downregulate gene expression, respectively.

Now let’s start with designing your CRISPRa/i gene-editing experiment, we will go through a step by step process as listed below:
1. Selecting an CRISPR activation or repression system.
2. Selecting a delivery approach for CRISPRa/i system.
3. Designing guideRNA for CRISPRa/i.
4. Collecting appropriate experimantal protocols and validating the editing outcomes.


assistant: 
Step 1. Selecting an CRISPR activation or repression system.

We support two types of CRISPR/Cas system for CRISPR activation/repression, SpCas9, enCas12a, representing distinct variants with unique properties and applications.

1. SpCas9  (Jinek et al.,Science,2012;Cong et al.,Science,2013;Mali et al.,Science,2013;Jinek et al.,eLife,2013)
- Pros: Highly effective, well-studied, proven applications in many cell types/scenarios.  
- Cons: Large, potential off-target effects.  
- Uses: Genetic research, gene therapy, genetically modified models/organisms (GMMs/GMOs).

2. enCas12a  (Kleinstiver et al.,Nat Biotechnol.,2019;DeWeirdt et al.,Nat Biotechnol.,2020)
- Pros: Smaller, precise, low off-target rate, multi-target editing capability using a single guideRNA array.  
- Cons: May be less efficient than SpCas9 when using a single guideRNA (mitigated if using multi-guide array), limited target sites vs. SpCas9 due to more restrictive PAM.  
- Uses: High-precision and multiplexed genome editing (for genetic interaction, target redundant genes/pathways).

*Please cite the corresponding papers if you decide to use the system.


assistant: 
Please select the CRISPR-Cas system you would like to use. Or please briefly describe your need (exp: I want to edit mouse liver/I want low off-target rate/I want to do multiplexed editing) and we could recommend the CRSIPR-Cas system to you.

user: I hope to activate CEACAM1 in A375 cell line and hope to maximize activation efficiency.

assistant: {'Thoughts': 'The user aims to activate CEACAM1 in the A375 cell line and wants to maximize activation efficiency. Given the need for high activation efficiency, SpCas9 is highly effective and well-studied, making it the most reliable choice for maximum efficiency. Although enCas12a is precise and has a low off-target rate, it may be less efficient than SpCas9 when using a single guideRNA, which is a potential limitation for maximizing activation.', 'Answer': 'SpCas9'} Final Result SpCas9

assistant: 
Then, we will help you select the effector protein.

Do you want to activate or repress a gene of interest?


user: activate

assistant: {'Thoughts': 'The user has expressed a desire to activate a gene of interest. In CRISPR technology, gene activation typically involves using CRISPR activation (CRISPRa) systems, which can increase the expression of the target gene. Effector proteins commonly used for gene activation include dCas9-VP64, dCas9-p300, and dCas9-SunTag systems. These proteins are engineered to enhance transcriptional activation without causing DNA double-strand breaks.', 'Choice': 'activate'}

assistant: We support 4 types of activation systems are available, representing distinct variants with unique properties and applications.

1. VP64: (Qi et al.,Cell,2013)

An early method, combining deactivated Cas with the activation domain VP64 to recruit transcriptional machinery to specific DNA sequences. It allows for modest gene activation and can be targeted to either initiate or elongate transcription. 

Performance: Provides around 2-fold gene activation, considered modest compared to newer methods.

2. Synergistic Activation Mediator (SAM): (Konermann et al.,Nature,2015)

An advanced technique that uses a dCas9/VP64 fusion, engineered with aptamers binding to MS2 proteins, which recruit additional activation domains. 

Performance: Offers the highest levels of gene activation for single targets, with effectiveness on par with other methods for multiple targets.

3. SunTag: (Gilbert et al.,Cell,2014)

Utilizes a repeating peptide array fused with multiple VP64 activations to recruit more transcriptional machinery per targeted gene.

Performance: Outperforms first-generation activators but has lower activation levels than SAM and involves more complex construction.

4. VPR: (Chavez et al.,Nat Method.,2015)

A tripartite complex fusing VP64, p65, and Rta activators with dCas9 to enhance transcription, working in tandem to recruit more transcription factors.

Performance: Shows higher activation levels than dCas9-VP64 but lower than SAM, with advantages in simplicity and delivery due to its single-component nature compared to SAM and SunTag.


Please select the activation system you would like to use. Or please briefly describe your need (exp: I want to a compact system/I want to maximize the efficiency) and we could recommend the activation system to you.


user: I hope to maximize activation efficiency. 

assistant: {'Thoughts': 'The user wants to maximize activation efficiency. Among the listed options, SAM offers the highest levels of gene activation for single targets. Although other methods like VPR and SunTag are also effective, they do not reach the same activation levels as SAM. Therefore, SAM is the most relevant activation system for maximizing activation efficiency.', 'Answer': 'SAM'}

assistant: 
Step 2. Selecting a delivery approach for CRISPR/Cas system

Different biological systems are amenable to different delivery methods for genome-editing tools. We currently support the following delivery method:

a. Plasmid transfection
b. Lentivirus/Retrovirus delivery
c. RNP/mRNA Electroporation
d. RNP/mRNA Microinjection
e. mRNA LNP
f. AAV (Adeno-Associated Virus)


Please select one from above or please briefly describe your application cases below (exp. I hope to edit A549 cell lines/ I hope to edit mouse liver).

*Please note we currently only support mammalian cells/tissues.


user: I hope to edit A375 cell line.

assistant: Please find the recommended delivery approach below:

Top choice: 
### b. Lentivirus/Retrovirus

**Introduction**: Lentivirus and retrovirus vectors are tools for delivering genetic material into cells, allowing stable integration of the transferred genes into the host genome, leading to long-term expression.

- **Pros**:
  - **Stable Expression**: Allows for permanent gene expression modifications in the host cell.
  - **Broad Host Range**: Capable of infecting both dividing and non-dividing cells.
  - **High Efficiency**: Especially effective in hard-to-transfect cell types.

- **Cons**:
  - **Safety Concerns**: Though lentiviral vectors are designed to be safe, there remains a theoretical risk of insertional mutagenesis.
  - **Complex Production**: Virus production and purification can be technically challenging and time-consuming.
  - **Regulatory and Biosafety Considerations**: Use of viral vectors requires strict adherence to biosafety guidelines.

- **Applications**: Ideal for studies requiring stable gene expression, gene therapy research, and cell line generation.


The relevant papers we found on Google Scholar: 
- The biological effect and mechanism of the Wnt/β‑catenin signaling pathway on malignant melanoma A375 cells: https://www.spandidos-publications.com/10.3892/etm.2018.6413?text=abstract
- RNAi-mediated IARS2 knockdown inhibits proliferation and promotes apoptosis in human melanoma A375 cells: https://www.spandidos-publications.com/10.3892/ol.2020.11688
- Reprogramming A375 cells to induced‑resembled neuronal cells by structured overexpression of specific transcription genes: https://www.spandidos-publications.com/mmr/14/4/3134
- Role of inhibitor of growth 4 in the suppression of human melanoma cells through the Fas/FasL-mediated apoptosis pathway: https://www.spandidos-publications.com/10.3892/ijmm.2017.3274
- microRNA‐216b inhibits cell proliferation and migration in human melanoma by targeting FOXM1 in vitro and in vivo: https://onlinelibrary.wiley.com/doi/abs/10.1002/cbin.10754
- Downregulation of Bmi-1 suppresses epithelial‑mesenchymal transition in melanoma: https://www.spandidos-publications.com/or/37/1/139
- Overexpression of c-MYC Promoter Binding Protein-1 Enhances Proliferation and Glucose Metabolism of Melanoma Cells Lines: https://ar.iiarjournals.org/content/43/6/2527.abstract
- Targeting hypoxia-inducible factor-1α with Tf–PEI–shRNA complex via transferrin receptor–mediated endocytosis inhibits melanoma growth: https://www.cell.com/molecular-therapy-family/molecular-therapy/fulltext/S1525-0016(16)31503-9
- Effect of Fam114A1 protein on the biological function of melanocytes: a preliminary study: https://pesquisa.bvsalud.org/portal/resource/pt/wpr-870343
- Both HDAC5 and HDAC6 are required for the proliferation and metastasis of melanoma cells: https://link.springer.com/article/10.1186/s12967-015-0753-0

Second choice: 
 ### a. Plasmid Transfection

**Introduction**: Plasmid transfection is a technique used to introduce foreign DNA into a host cell, typically using chemical, physical, or biological methods. This process enables the study of gene function and protein expression in a cellular environment.

- **Pros**:
  - **Simple and Cost-Effective**: Compared to other methods, plasmid transfection is relatively easy to perform and inexpensive.
  - **High Efficiency in Some Cell Types**: Works particularly well in certain easily transfectable cell lines.
  - **Non-Viral**: Reduces the risks associated with viral vectors, such as immune responses or insertional mutagenesis.

- **Cons**:
  - **Transient Expression**: Generally results in temporary gene expression, requiring repeated transfection for sustained effects.
  - **Variable Efficiency**: Efficiency can vary widely between different cell types, especially hard-to-transfect cells like primary cells.
  - **Size Limitation**: There's a limit to the size of the DNA plasmid that can be effectively transfected.

- **Applications**: Widely used in research for gene expression studies, protein production, and genetic engineering.


The relevant papers we found on Google Scholar: 
- The biological effect and mechanism of the Wnt/β‑catenin signaling pathway on malignant melanoma A375 cells: https://www.spandidos-publications.com/10.3892/etm.2018.6413?text=abstract
- CADM1/TSLC1 inhibits melanoma cell line A375 invasion through the suppression of matrix metalloproteinases: https://www.spandidos-publications.com/mmr/10/5/2621
- MicroRNA‐330 inhibits growth and migration of melanoma A375 cells: in vitro study: https://onlinelibrary.wiley.com/doi/abs/10.1002/jcb.29211
- c-FLIPp43 induces activation of the nuclear factor‑κB signaling pathway in a dose-dependent manner in the A375 melanoma cell line: https://www.spandidos-publications.com/10.3892/mmr.2014.2364
- CDK5RAP1 targeting NF-κB signaling pathway in human malignant melanoma A375 cell apoptosis: https://www.spandidos-publications.com/10.3892/ol.2018.7920?text=fulltext
- Downregulation of BRCA1 in A375 melanoma cell line increases radio-sensitivity and modifies metastatic and angiogenic gene expression: https://www.sciencedirect.com/science/article/pii/S0022202X15306813
- Apoptosis induced by synthetic retinoic acid CD437 on human melanoma A375 cells involves RIG-I pathway: https://link.springer.com/article/10.1007/s00403-008-0902-x
- RLIP76 silencing inhibits cell proliferation and invasion in melanoma cell line A375.: http://www.europeanreview.org/wp/wp-content/uploads/2054-2060-RLIP76-silencing-inhibits-cell-proliferation.pdf
- Apoptotic effect and mechanisms of AHPN on human skin malignant melanoma cell A375: https://www.sciencedirect.com/science/article/pii/S1007437608600040
- Downregulation of discoidin domain receptor 2 in A375 human melanoma cells reduces its experimental liver metastasis ability: https://www.spandidos-publications.com/10.3892/or.2011.1356



assistant: Which delivery method would you like to use?


user: I would like to use lentivirus.

assistant: {'Thoughts': "The user has indicated that they would like to use lentivirus as their method for gene delivery. Lentivirus offers stable expression, can infect a broad range of cell types, and is highly efficient, particularly in hard-to-transfect cells. However, it also comes with safety concerns, complex production processes, and regulatory considerations. These factors must be weighed based on the user's specific needs and applications.", 'Choice': 'b'}

assistant: 
Step 3. Designing guideRNA for gene activation or repression

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; I hope to design a guide RNA for CRISPRa that locates within 108146000 to 108146262.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


user: Could you help me design 3 sgRNAs targeting human CEACAM1?

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; I hope to design a guide RNA for CRISPRa that locates within 108146000 to 108146262.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


assistant: https://crispr-gpt.s3.amazonaws.com/91599c0d-00c4-4586-b89b-1276cb558800?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=NVlvRSPhmVuUN2oDmkMeZrjMEww%3D&Expires=1725806640

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence       | PAM Sequence   | Target Domain   |   TSS Position |   sgRNA 'Cut' Position |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:---------------------|:---------------|:----------------|---------------:|-----------------------:|---------------------------:|------------------:|----------------:|
| CEACAM1              | CRISPRa            | CCATAGCCAGGACACAATAG | AGG            | [TSS-300,TSS+0] |       42528478 |               42528707 |                     0.6135 |                 1 |               1 |
| CEACAM1              | CRISPRa            | TTGTCTGATCATGTGTGCTG | GGG            | [TSS-300,TSS+0] |       42528478 |               42528525 |                     0.8276 |                 8 |               2 |
| CEACAM1              | CRISPRa            | GAGACCTCTGTCCCCATCAG | GGG            | [TSS-300,TSS+0] |       42528478 |               42528668 |                     0.8476 |                12 |               3 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


user: yes

assistant: To identify potential off-target sites for your genome editing guides, we recommend you using CRISPRitz (Cancellieri et al.,Bioinformatics,2020), a rapid, high-throughput and variant-aware in silico off-target site identification package.

Please find the github page below:
https://github.com/pinellolab/CRISPRitz

*Please cite the corresponding papers if you decide to use the tool.

Our CRISPR-GPT can run CRISPRitz on our server for you, if you'd like CRISPR-GPT to help you run this step please type “Yes”, otherwise, type “No” if you prefer to run CRISPRitz locally, and we will give you a set of instructions. Would you like CRISPR-GPT to run off-target analysis for you? (Yes/No)


user: yes

assistant: Are you hoping to perform (1). Mismatches-Only search or (2). Mismatches + Bulges search?

user: 1

assistant: 
Please provide the species (human or mouse)
1. human
2. mouse


user: 1

assistant: 
Please provide the CAS system (SpCas9 or AsCas12a)
1. SpCas9
2. AsCas12a


user: 1

assistant: 
Please provide the sequence entering guide+PAM for SpCas9 (e.g. TCACCCAGGCTGGAATACAGNNN) or PAM+guide for AsCas12a (e.g. NNNNTCACCCAGGCTGGAATACAG).


user: CCATAGCCAGGACACAATAGNNN

assistant: Running CRISPRItz mismatch_only with species: human, CAS: SpCas9, sequence: CCATAGCCAGGACACAATAGNNN. We will send you an email once the result files are ready to be downloaded.

assistant: Step 4. Collecting appropriate experimantal protocols and validating the editing outcomes.

Based on information from the previous step 2, we are showing you related protocols using Lentivirus/Retrovirus delivery


assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: 1

assistant: {'ChatResponse': {'Thoughts': "The user has entered '1', indicating that they want to start with the first step of the process.", 'Choice': '1'}}

assistant: Please find the protocols below:
[BP1.docx](https://crispr-gpt.s3.amazonaws.com/BP1.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=vN65VzhhgPTP0E6yKgM%2B8Spc4xI%3D&Expires=1725807414)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP1

assistant: Please find the protocols below:
[SP1.docx](https://crispr-gpt.s3.amazonaws.com/SP1.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=9Bjx4UTplIBuCBNpsrOYZmtBtJo%3D&Expires=1725807418)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP2

assistant: Please find the protocols below:
[SP2.docx](https://crispr-gpt.s3.amazonaws.com/SP2.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=Eh6eAWlB0jmJe8oT75lRNv3jLmI%3D&Expires=1725807421)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP3

assistant: Please find the protocols below:
[SP3.docx](https://crispr-gpt.s3.amazonaws.com/SP3.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=hCPnQYe4hWn81ii2V96AgEVd8%2Bw%3D&Expires=1725807424)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: no

assistant: Please find the protocols below:


assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: 2

assistant: {'ChatResponse': {'Thoughts': 'The user has chosen step 2, which involves delivering the product (synthesized or cloned the Cas and sgRNA system) into the desired cells. This step is crucial for ensuring that the CRISPR components are properly introduced into the target cells for subsequent genome editing.', 'Choice': '2'}}

assistant: Please find the protocols below:
[BP2.docx](https://crispr-gpt.s3.amazonaws.com/BP2.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=fxdkt5hWH0U5o65KxRS%2Fs6b%2Fcjc%3D&Expires=1725807433)



[BP4.docx](https://crispr-gpt.s3.amazonaws.com/BP4.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=93HDJRhK94rtiHCK5WYHSWemm0g%3D&Expires=1725807433)



assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: end

assistant: {'ChatResponse': {'Thoughts': "The user has indicated they want to finish the process by typing 'end'.", 'Choice': 'end'}}

assistant: In this protocol, you can validate the activation/repression through the following ways, including: 

1. protein: Staining of target protein by antibody, and measuring level of activation/repression using flow cytometry or western blot.
2. qPCR: Measure RNA expression by qPCR (design primer using webtool or external tool Primer3) 
3. RNA-seq: Measure RNA expression by next-generation sequencing (NGS).

Which one would you like to use?


user: 1

assistant: Here are several methods you can use to measure and validate protein-level activation/repression:

1. Western Blotting:
    - Western blotting is a widely used technique for detecting and quantifying specific proteins in a sample. After treating cells with CRISPR, lysates from these cells can be run on SDS-PAGE gels, transferred to membranes, and probed with antibodies specific to the target protein. A significant reduction or absence of the target protein in the CRISPR-treated sample as compared to the control indicates a successful knockout.
    - Ensure you also probe for a housekeeping protein (like GAPDH or β-actin) to serve as a loading control, ensuring that any observed changes in protein level are not due to variations in protein loading or transfer.
    - Example protocols:
    (i) https://www.addgene.org/protocols/western-blot/

2. Immunofluorescence:
    - Immunofluorescence allows for the visualization of the presence and localization of proteins within cells. Cells edited by CRISPR and controls are fixed, permeabilized, and incubated with an antibody against the target protein, followed by a fluorescently labeled secondary antibody. Fluorescence microscopy is then used to detect the presence of the target protein. A successful knockout is indicated by a marked reduction or absence of fluorescence in the edited cells compared to control cells.
    - This method can provide information not just on the presence of a protein but also on its localization, which can be valuable in functional studies.
    - Example protocols:
    (i) https://www.addgene.org/protocols/immunocytochemistry

3. Enzyme-Linked Immunosorbent Assay (ELISA):
    - ELISA is a plate-based assay technique designed for detecting and quantifying soluble substances such as peptides, proteins, antibodies, and hormones. In the context of CRISPR validation, an ELISA can be used to quantify the target protein in lysates from CRISPR-treated and control cells. A successful knockout would show a significant reduction in the target protein level in the CRISPR-treated samples compared to controls.
    - ELISA is sensitive and can be more quantitative than Western blotting but requires specific antibodies and standards for quantification.
    - Example protocols:
    (i) https://www.sigmaaldrich.com/US/en/technical-documents/protocol/protein-biology/elisa/elisa-protocols

4. Flow Cytometry:
    - If the target protein is expressed on the cell surface, flow cytometry can be used to assess the knockout efficiency. Cells are labeled with a fluorescent antibody against the target protein, and the fluorescence intensity is measured. A decrease in fluorescence intensity in the CRISPR-treated cells compared to control cells indicates a successful knockout.
    - This method provides the advantage of analyzing individual cells in a population, giving insights into the efficiency of knockout across the cell population.
	- Example protocols:
    (i) https://www.abcam.com/protocols/flow-cytometry-for-intracellular-and-extracellular-targets

