assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 1

assistant: {'Thoughts': 'The user has chosen Meta-Mode, which means they are looking for step-by-step guidance on a pre-defined meta-task related to CRISPR technology.', 'Choice': '1'}

assistant: Please select the general gene editing scenarios to continue.
1. Generating a Knockout Using CRISPR.
2. CRISPR Base Editing Without Double-Strand Breaks.
3. Generating Small Insertion/deletion/base editing through Prime Editing.
4. Activation or Repression of Target Genes Using CRISPR.


user: I'm trying to inactivate human PCSK9

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: {'Thoughts': 'The user wants to inactivate the human PCSK9 gene. Inactivation of a gene typically involves generating a knockout, which can be most effectively achieved using CRISPR to induce a double-strand break and subsequent repair by non-homologous end joining, leading to loss-of-function mutations.', 'Choice': '1'}

assistant: Now, let's start designing and planning your knockout experiment using CRISPR system, we will go through a step by step process as listed below:
1. Selecting a CRISPR/Cas system.
2. Selecting a delivery approach for CRISPR/Cas system.
3. Designing guideRNA for gene knockout.
4. Collecting appropriate experimantal protocols and validating the editing outcomes.


assistant: 
Step 1. Selecting a CRISPR/Cas system 

We support four types of CRISPR/Cas system for CRISPR knockout, SpCas9, enCas12a, SaCas9, and SpRYCas9, representing distinct variants with unique properties and applications.

1. SpCas9  (Jinek et al.,Science,2012;Cong et al.,Science,2013;Mali et al.,Science,2013;Jinek et al.,eLife,2013)
- Pros: Highly effective, well-studied, proven applications in many cell types/scenarios.  
- Cons: Large, potential off-target effects.  
- Uses: Genetic research, gene therapy, genetically modified models/organisms (GMMs/GMOs).

2. enCas12a  (Kleinstiver et al.,Nat Biotechnol.,2019;DeWeirdt et al.,Nat Biotechnol.,2020)
- Pros: Smaller, precise, low off-target rate, multi-target editing capability using a single guideRNA array.  
- Cons: May be less efficient than SpCas9 when using a single guideRNA (mitigated if using multi-guide array), limited target sites vs. SpCas9 due to more restrictive PAM.  
- Uses: High-precision and multiplexed genome editing (for genetic interaction, target redundant genes/pathways).

3. SaCas9  (Ran et al.,Nature,2015)
- Pros: Compact, suitable for AAV vectors (knockout genes in primary cells or in vivo).  
- Cons: limited target sites vs. SpCas9 due to more restrictive PAM.  
- Uses: In vivo gene therapy and some primary cells when using AAV delivery.

4. SpRYCas9  (Walton et al.,Science,2020)
- Pros: Wide PAM range, targets more genomic regions vs. typical SpCas9.  
- Cons: Higher off-target risks.  
- Uses: editing a specific target site where canonical PAMs for SpCas9/SaCas9/enCas12a are not available, and where specificity/off-target concerns are less critical.

*Please cite the corresponding papers if you decide to use the system.


assistant: 
Please select the CRISPR-Cas system you would like to use. Or please briefly describe your need (exp: I want to edit mouse liver/I want low off-target rate/I want to do multiplexed editing) and we could recommend the CRSIPR-Cas system to you.


user: I'm trying to inactivate human PCSK9



assistant: {'Thoughts': "To inactivate the human PCSK9 gene, we need to consider the efficiency, delivery method, and specificity of the Cas system. High efficiency is important for successful gene inactivation. Delivery methods need to be considered based on the system's size. Specificity is crucial to avoid off-target effects. Given these considerations, SpCas9 is highly efficient and well-documented for gene inactivation. While it has potential off-target effects, its high efficiency and broad usage in genetic research make it a strong candidate for this application.", 'Answer': 'SpCas9'} Final Result SpCas9

assistant: 
Step 2. Selecting a delivery approach for CRISPR/Cas system

Different biological systems are amenable to different delivery methods for genome-editing tools. We currently support the following delivery method:

a. Plasmid transfection
b. Lentivirus/Retrovirus delivery
c. RNP/mRNA Electroporation
d. RNP/mRNA Microinjection
e. mRNA LNP
f. AAV (Adeno-Associated Virus)


Please select one from above or please briefly describe your application cases below (exp. I hope to edit A549 cell lines/ I hope to edit mouse liver).

*Please note we currently only support mammalian cells/tissues.


user: I'm trying to inactivate human PCSK9 in hepG2 cells.

assistant: Please find the recommended delivery approach below:

Top choice: 
 ### a. Plasmid Transfection

**Introduction**: Plasmid transfection is a technique used to introduce foreign DNA into a host cell, typically using chemical, physical, or biological methods. This process enables the study of gene function and protein expression in a cellular environment.

- **Pros**:
  - **Simple and Cost-Effective**: Compared to other methods, plasmid transfection is relatively easy to perform and inexpensive.
  - **High Efficiency in Some Cell Types**: Works particularly well in certain easily transfectable cell lines.
  - **Non-Viral**: Reduces the risks associated with viral vectors, such as immune responses or insertional mutagenesis.

- **Cons**:
  - **Transient Expression**: Generally results in temporary gene expression, requiring repeated transfection for sustained effects.
  - **Variable Efficiency**: Efficiency can vary widely between different cell types, especially hard-to-transfect cells like primary cells.
  - **Size Limitation**: There's a limit to the size of the DNA plasmid that can be effectively transfected.

- **Applications**: Widely used in research for gene expression studies, protein production, and genetic engineering.


The relevant papers we found on Google Scholar: 
- Transfection of HepG2 cells with infectious hepatitis C virus genome.: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1858015/
- HCV cDNA transfection to HepG2 cells: https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-2893.1997.tb00162.x
- Targeted photoporation and transfection in human HepG2 cells by a fiber femtosecond laser at 1554 nm: https://opg.optica.org/abstract.cfm?uri=ol-33-24-2961
- Transfection of HepG2 cells with hGSTA4 provides protection against 4-hydroxynonenal-mediated oxidative injury: https://www.sciencedirect.com/science/article/pii/S0887233307001452
- Synthesis of lactobionic acid-grafted-pegylated-chitosan with enhanced HepG2 cells transfection: https://www.sciencedirect.com/science/article/pii/S0144861710007186
- Intracellular trafficking is the important process that determines the optimal charge ratio on transfection by galactosylated lipoplex in HEPG2 cells: https://www.jstage.jst.go.jp/article/bpb/29/9/29_9_1986/_article/-char/ja/
- Impact of co-transfection with livin and survivin shRNA expression vectors on biological behavior of HepG2 cells: http://109.199.100.160/article_28142_e84fc35ba7b91f2a741abc9a85418645.pdf
- MicroRNA-122 mimic transfection contributes to apoptosis in HepG2 cells: https://www.spandidos-publications.com/mmr/12/5/6918
- PLGA-based gene delivering nanoparticle enhance suppression effect of miRNA in HePG2 cells: https://link.springer.com/article/10.1186/1556-276X-6-447
- Biotinylated disulfide containing PEI/avidin bioconjugate shows specific enhanced transfection efficiency in HepG2 cells: https://pubs.rsc.org/en/content/articlehtml/2009/ob/b910831a

Second choice: 
### b. Lentivirus/Retrovirus

**Introduction**: Lentivirus and retrovirus vectors are tools for delivering genetic material into cells, allowing stable integration of the transferred genes into the host genome, leading to long-term expression.

- **Pros**:
  - **Stable Expression**: Allows for permanent gene expression modifications in the host cell.
  - **Broad Host Range**: Capable of infecting both dividing and non-dividing cells.
  - **High Efficiency**: Especially effective in hard-to-transfect cell types.

- **Cons**:
  - **Safety Concerns**: Though lentiviral vectors are designed to be safe, there remains a theoretical risk of insertional mutagenesis.
  - **Complex Production**: Virus production and purification can be technically challenging and time-consuming.
  - **Regulatory and Biosafety Considerations**: Use of viral vectors requires strict adherence to biosafety guidelines.

- **Applications**: Ideal for studies requiring stable gene expression, gene therapy research, and cell line generation.


The relevant papers we found on Google Scholar: 
- HepG2-1A2 C2 and C7: Lentivirus vector-mediated stable and functional overexpression of cytochrome P450 1A2 in human hepatoblastoma cells: https://www.sciencedirect.com/science/article/pii/S0378427419303583
- Knockdown of apolipoprotein B, an atherogenic apolipoprotein, in HepG2 cells by lentivirus-mediated siRNA: https://www.sciencedirect.com/science/article/pii/S0006291X0600725X
- Critical factors for lentivirus‑mediated PRDX4 gene transfer in the HepG2 cell line: https://www.spandidos-publications.com/10.3892/ol.2018.8650
- Lentivirus mediated shRNA interference targeting MAT2B induces growth-inhibition and apoptosis in hepatocellular carcinoma: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2738787/
- Lentivirus-mediated silencing of rhomboid domain containing 1 suppresses tumor growth and induces apoptosis in hepatoma HepG2 cells: https://koreascience.kr/journal/view.jsp?kj=POCPA9&py=2013&vnc=v14n1&sp=5
- Lentivirus-mediated overexpression of microRNA-199a inhibits cell proliferation of human hepatocellular carcinoma: https://link.springer.com/article/10.1007/s12013-011-9263-8
- Effect and mechanism of lentivirus‐mediated silencing of TPX2 gene on proliferation and apoptosis of human hepatoma cells: https://onlinelibrary.wiley.com/doi/abs/10.1002/jcb.28119
- Production, purification and titration of a lentivirus-based vector for gene delivery purposes: https://link.springer.com/article/10.1007/s10616-013-9652-5
- Overexpression of salusin‑β downregulates adipoR1 expression to prevent fatty acid oxidation in HepG2 cells: https://www.spandidos-publications.com/10.3892/mmr.2023.13141
- Involvement of endoplasmic reticulum stress and p53 in lncRNA MEG3-induced human hepatoma HepG2 cell apoptosis: https://www.spandidos-publications.com/or/36/3/1649



assistant: Which delivery method would you like to use?


user: a

user: a

assistant: {'Thoughts': "The user has chosen option 'a', which is Plasmid Transfection. This method is suitable for their needs if they prioritize simplicity, cost-effectiveness, and non-viral delivery. Although it offers transient expression and may have variable efficiency in different cell types, it remains a popular choice for gene expression studies and genetic engineering in research settings.", 'Choice': 'a'}

assistant: 
Step 3. Designing guideRNA for gene knockout

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


user: human, PCSK9

assistant: Sugessted exon/exons: {'Exon/exons': 'Exon 1', 'Reason': {'PCSK9 is a gene with well-documented roles in cholesterol metabolism. Targeting exon 1 can be effective because it often contains the start codon and crucial regulatory sequences necessary for gene expression. Disrupting this exon could result in complete loss-of-function, providing a clear phenotype for downstream studies.'}}

assistant: 
Based on the information you provided, it may be beneficial to design sgRNAs targeting specific exons within the genes.

Would you like to continue sgRNA design with the exon/exons we suggested?


user: yes

assistant: https://crispr-gpt.s3.amazonaws.com/6835796c-321a-4f46-a0a6-00ec20cdee0a?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=eda4bnnPwcIIm%2Bgi7Y%2BR0wHTYeU%3D&Expires=1725803790

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence       | PAM Sequence   |   Exon Number |   sgRNA Cut Position (1-based) |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:---------------------|:---------------|--------------:|-------------------------------:|---------------------------:|------------------:|----------------:|
| PCSK9                | CRISPRko           | CTGGCCGAAGCACCCGAGCA | CGG            |             1 |                       55040008 |                     0.4863 |                 8 |              28 |
| PCSK9                | CRISPRko           | CCCGCACCTTGGCGCAGCGG | TGG            |             1 |                       55040035 |                     0.7977 |                93 |              30 |
| PCSK9                | CRISPRko           | GCTAGCCTTGCGTTCCGAGG | AGG            |             1 |                       55039980 |                     0.3916 |                88 |              84 |
| PCSK9                | CRISPRko           | GCCTTGCGTTCCGAGGAGGA | CGG            |             1 |                       55039984 |                     0.2738 |                70 |              88 |
| PCSK9                | CRISPRko           | TCCACCGCTGCGCCAAGGTG | CGG            |             1 |                       55040045 |                     0.48   |               125 |              90 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


user: yes

assistant: To identify potential off-target sites for your genome editing guides, we recommend you using CRISPRitz (Cancellieri et al.,Bioinformatics,2020), a rapid, high-throughput and variant-aware in silico off-target site identification package.

Please find the github page below:
https://github.com/pinellolab/CRISPRitz

*Please cite the corresponding papers if you decide to use the tool.

Our CRISPR-GPT can run CRISPRitz on our server for you, if you'd like CRISPR-GPT to help you run this step please type “Yes”, otherwise, type “No” if you prefer to run CRISPRitz locally, and we will give you a set of instructions. Would you like CRISPR-GPT to run off-target analysis for you? (Yes/No)


user: yes

assistant: Are you hoping to perform (1). Mismatches-Only search or (2). Mismatches + Bulges search?

user: 1

assistant: 
Please provide the species (human or mouse)
1. human
2. mouse


user: 1

assistant: 
Please provide the CAS system (SpCas9 or AsCas12a)
1. SpCas9
2. AsCas12a


user: 1

assistant: 
Please provide the sequence entering guide+PAM for SpCas9 (e.g. TCACCCAGGCTGGAATACAGNNN) or PAM+guide for AsCas12a (e.g. NNNNTCACCCAGGCTGGAATACAG).


user: CTGGCCGAAGCACCCGAGCANNN

assistant: Running CRISPRItz mismatch_only with species: human, CAS: SpCas9, sequence: CTGGCCGAAGCACCCGAGCANNN. We will send you an email once the result files are ready to be downloaded.

assistant: Step 4. Collecting appropriate experimantal protocols and validating the editing outcomes.

Based on information from the previous step 2, we are showing you related protocols using Plasmid Transfection delivery


assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: 1

assistant: {'ChatResponse': {'Thoughts': 'The user input corresponds to the first step, which is to synthesize or clone the Cas and sgRNA system.', 'Choice': '1'}}

assistant: [BP1.docx](https://crispr-gpt.s3.amazonaws.com/BP1.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=im95DjLkOox%2FaYN4Jl9unEuFIl4%3D&Expires=1725803835)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: yes

assistant: {'ChatResponse': {'Thoughts': 'The user indicated that they want to access one of the support protocols. I need to verify which specific protocol number they are referring to.', 'Choice': 'Please specify the protocol number: SP1, SP2, or SP3.'}}

assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP1

assistant: {'ChatResponse': {'Thoughts': 'The user has chosen to access SP1 support protocol. This indicates they want to proceed with protocol number 1.', 'Choice': 'SP1'}}[SP1.docx](https://crispr-gpt.s3.amazonaws.com/SP1.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=aUnzsd1KzmWrHLsgfHf%2FNJNnUsg%3D&Expires=1725803850)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP2

assistant: {'ChatResponse': {'Thoughts': 'The user has indicated that they want to access support protocol SP2. I will confirm their choice by translating their input into the corresponding protocol number.', 'Choice': 'SP2'}}[SP2.docx](https://crispr-gpt.s3.amazonaws.com/SP2.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=FRblEwT9uUHDiFfk6EMrYRrpOBk%3D&Expires=1725803853)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: SP3

assistant: {'ChatResponse': {'Thoughts': 'The user has provided input indicating that they want to access SP3. The appropriate choice is to translate this input into the protocol number.', 'Choice': 'SP3'}}[SP3.docx](https://crispr-gpt.s3.amazonaws.com/SP3.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=fuo4%2BX0VeWCYbCuhGLjKWePxihk%3D&Expires=1725803856)



assistant: There are 3 support protocols associated with this step: 

- SP1: ISOLATION OF PLASMID DNA
- SP2: PREPARATION OF COMPETENT STBL3 E. COLI FOR gRNA CLONING
- SP3: OBTAINING GUIDE RNA OLIGONUCLEOTIDES
 
Do you want to access them? If yes, type in the protocal number; otherwise, type 'no' to return.


user: no

assistant: {'ChatResponse': {'Thoughts': 'The user has chosen not to access any of the support protocols associated with this step.', 'Choice': 'no'}}

assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: 3

assistant: {'ChatResponse': {'Thoughts': 'The user has chosen to start with step 3, which is the isolation of single cell clones. This step typically follows the successful synthesis or cloning of the Cas and sgRNA system and its delivery into the desired cells.', 'Choice': '3'}}

assistant: In this protocol, single cell clones can be derived through several ways, including:

1. Limited dilution.
2. FACS sorting.

Which one would you like to use?


user: 1

assistant: [BP6.docx](https://crispr-gpt.s3.amazonaws.com/BP6.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=Vwq1%2BnW%2B8xKKd%2F3lWqq79QoOa9s%3D&Expires=1725803866)

{'ChatResponse': {'Thoughts': "The user has selected option '1', which corresponds to 'Limited dilution' as the method to derive single cell clones.", 'Choice': '1'}}

assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: end

assistant: {'ChatResponse': {'Thoughts': 'The user has chosen to end the process, likely indicating they do not wish to proceed with any of the steps at this time.', 'Choice': 'end'}}

assistant: In this protocol, you can validate the knockout through the following ways, including: 

1. Staining of target protein by antibody, and measure level of knockout using flow cytometry or western blot.
2. Mutation sequencing by Sanger Sequencing
3. Mutation sequencing by Next-generation Sequencing (NGS)

Which one would you like to use?


user: 3

assistant: [SP4.docx](https://crispr-gpt.s3.amazonaws.com/SP4.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=pKSKpZSnorm11VnZNUojowknMN8%3D&Expires=1725803895)

[BP8_NGS.docx](https://crispr-gpt.s3.amazonaws.com/BP8_NGS.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=dGIRJ44BRhClYU1lKsBd%2FREnOM8%3D&Expires=1725803895)

 
 
 (add amplicon for NGS and add Crispresso website)

assistant: We could help you design the related PCR primers using Primer3 (Untergasser et al.,Nucleic Acids Res.,2012) through following options:

1. Primer3 - command-line script to design primers - we run the script for you.
2. Primer-blast (Web tool, Manual design one by one)
3. Primer3 - command-line script to design primers - you run the code yourself

*Please cite the corresponding papers if you decide to use the tool.

Which one do you prefer?



user: 1

assistant: {'ChatResponse': {'Thoughts': 'The user has indicated a preference for using a command-line script to design primers and would like us to run the script for them.', 'Choice': '1'}}

assistant: To help you design the PCR primers for mutation sequencing by NGS, we would need the following information:

- Species: For example: human, mouse.
- Sequence of your target site: Please include 200bp upstream and 200bp downstream of the gRNA.

Please type in the two answers in two lines sequentially. (Press Shift+Enter to type in a new line)


user: human, atgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcgga

assistant: Error occured. Error Message: not enough values to unpack (expected 2, got 1) Let's try again.

user: human, atgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcggaatgctctgttttatctacgtctcaccaacagcccatcagaacaaggatgagtggcgaagcgga

assistant: Error occured. Error Message: not enough values to unpack (expected 2, got 1) Let's try again.