assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 1

assistant: {'Thoughts': 'The user has selected Meta-Mode, which provides step-by-step guidance on a pre-defined meta-task related to CRISPR technology. I will now present the available meta-tasks for the user to choose from.', 'Choice': '1'}

assistant: Please select the general gene editing scenarios to continue.
1. Generating a Knockout Using CRISPR.
2. CRISPR Base Editing Without Double-Strand Breaks.
3. Generating Small Insertion/deletion/base editing through Prime Editing.
4. Activation or Repression of Target Genes Using CRISPR.


user: 3

assistant: {'Thoughts': 'The user has selected option 3, which involves generating small insertion/deletion/base editing through prime editing. This approach allows precise modifications in the genome without causing double-strand breaks, making it a versatile and efficient method for gene editing.', 'Choice': '3'}

assistant: 
Prime editing is a 'search-and-replace' genome editing technology in molecular biology by which the genome of living organisms may be modified. The technology directly writes new genetic information into a targeted DNA site. It uses a fusion protein, consisting of a catalytically impaired Cas9 endonuclease fused to an engineered reverse transcriptase enzyme, and a prime editing guide RNA (pegRNA), capable of identifying the target site and providing the new genetic information to replace the target DNA nucleotides. It mediates targeted insertions, deletions, and base-to-base conversions without the need for double strand breaks (DSBs) or donor DNA templates

Now, let’s start designing and planning your prime-editing experiment using CRISPR system, we will go through a step by step process as listed below:
1. Selecting a Prime Editing system.
2. Selecting a delivery approach for Prime Editing system.
3. Designing pegRNA for Prime Editing.
4. Collecting appropriate experimantal protocols and validating the editing outcomes.


assistant: 
Prime Editing system selection

We support four types of Prime Editing systems, PE2, PE3, PE4, PE5, representing distinct variants with unique properties and applications.


1. PE2: Cas9(H840A)–Engineered RT (Anzalone et al.,Nature,2019)

- Pros:Lower risk of inducing indels compared to PE3 and PE5 due to the absence of additional nicks.Simpler and faster for applications not requiring optimized levels of editing.
Effective in cases where high editing efficiency is naturally achieved.
- Cons: Yields lower editing efficiency than PE3-PE5 systems.
- Application Considerations: Preferred for creating cell lines, or when application specifics negate the need for the highest possible efficiency or when avoiding potential complications from secondary mechanisms like MMR evasion.

2. PE3/PE3b: PE2 + Additional Nicking sgRNA (Anzalone et al.,Nature,2019)

- Pros:Offers high editing efficiency without suppressing cellular mismatch repair (MMR). PE3b variant may yield even higher efficiencies with fewer indel byproducts.
- Cons: Needs screening of several sgRNAs for optimal efficiency and safety. 
- Application Considerations: Ideal when seeking the highest editing efficiency without substantial indels, with the variation dependent on cell type and specific experimental design.

3. PE4: PE2 + MLH1dn (Chen et al.,Cell,2021)

- Pros:Improves editing relative to PE2. Useful in minimizing indels at the target site.
- Cons: Long-term MLH1dn expression impacts have not been assessed; could interfere with downstream applications.
- Application Considerations: Suited for experiments where indels must be minimized or when nicking sgRNAs are not an option. Consider cellular impacts of MLH1dn.

4. PE5/PE5b: PE2 + Additional Nicking sgRNA + MLH1dn (Chen et al.,Cell,2021)

- Pros: For many cell types, it provides the highest editing efficiency among all PE systems. Substantially reduces indels compared to PE3.
- Cons: As with PE4, long-term effects of MLH1dn expression are unknown and could affect subsequent experiments.
- Application Considerations: Especially beneficial when the highest possible editing efficiency is required. The choice between PE5 and PE3 may depend on the MMR status of the cell type in use.

*Please cite the corresponding papers if you decide to use the system.


assistant: 
Please select the Prime Editing system you would like to use. Or please briefly describe your need (exp: I want low off-target rate/I am using a cell line with High MMR activity) and we could recommend the Prime Editing system to you.


user: i'd like to introduce a clinvar mutation in neuron culture



assistant: {'Thoughts': 'The user intends to introduce a ClinVar mutation into neuron culture. This task requires high precision and efficiency to ensure that the mutation is correctly introduced into the genome. Given this, we need a system that balances high editing efficiency with minimal indels, as neuronal cells are sensitive and difficult to regenerate. Comparing the systems, PE2 provides simplicity but lower efficiency. PE3 and PE3b enhance efficiency but require careful sgRNA screening. PE4 and PE5 systems include MLH1dn to suppress indels, with PE5 offering the highest efficiency. Considering the sensitivity of neuronal cultures and the need for high efficiency with minimal disruption, PE5 seems the best fit as it offers the highest efficiency while minimizing indels, crucial for maintaining neuron viability and functionality.', 'Answer': 'PE5'}

assistant: 
Step 2. Selecting a delivery approach for CRISPR/Cas system

Different biological systems are amenable to different delivery methods for genome-editing tools. We currently support the following delivery method:

a. Plasmid transfection
b. Lentivirus/Retrovirus delivery
c. RNP/mRNA Electroporation
d. RNP/mRNA Microinjection
e. mRNA LNP
f. AAV (Adeno-Associated Virus)


Please select one from above or please briefly describe your application cases below (exp. I hope to edit A549 cell lines/ I hope to edit mouse liver).

*Please note we currently only support mammalian cells/tissues.


user: I'm doing PE in neuron and may ultimately test them in vivo.

assistant: Please find the recommended delivery approach below:

Top choice: 
### f. AAV (Adeno-Associated Virus)

**Introduction**: AAV vectors are small, non-pathogenic viruses used to deliver therapeutic genes. They do not integrate into the host genome, reducing the risk of insertional mutagenesis.

- **Pros**:
  - **Low Immunogenicity**: AAVs typically induce a mild immune response, making them suitable for in vivo applications.
  - **Stable Expression**: Can provide long-term gene expression in non-dividing cells.
  - **Broad Range of Serotypes**: Different AAV serotypes can target specific tissues, enhancing tissue-specific delivery.

- **Cons**:
  - **Limited Payload Capacity**: Can carry only small genes or gene fragments, limiting its versatility.
  - **Variable Transduction Efficiency**: Efficiency can vary widely among different tissues or cell types.
  - **Cost and Production**: High costs and complex production processes can be limiting factors.

- **Applications**: Primarily used in gene therapy for treating genetic disorders, with several AAV-based therapies already in clinical use.


The relevant papers we found on Google Scholar: 
- Novel tool to quantify with single-cell resolution the number of incoming AAV genomes co-expressed in the mouse nervous system: https://www.nature.com/articles/s41434-021-00272-8
- Dual Transgene Expression in Murine Cerebellar Purkinje Neurons by Viral Transduction In Vivo: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0104062
- A method for high fidelity optogenetic control of individual pyramidal neurons in vivo: https://www.jove.com/t/50291/a-method-for-high-fidelity-optogenetic-control-individual-pyramidal
- Rapid and sparse labeling of neurons based on the mutant virus-like particle of semliki forest virus: https://link.springer.com/article/10.1007/s12264-019-00362-z
- Monosynaptic circuit tracing in vivo through Cre-dependent targeting and complementation of modified rabies virus: https://www.pnas.org/doi/abs/10.1073/pnas.1011756107
- Driving axon regeneration by orchestrating neuronal and non-neuronal innate immune responses via the IFNγ-cGAS-STING axis: https://www.cell.com/neuron/fulltext/S0896-6273(22)00961-8
- Genetically modified NT2N human neuronal cells mediate long-term gene expression as CNS grafts in vivo and improve functional cognitive outcome following …: https://academic.oup.com/jnen/article-abstract/62/4/368/2916443
- Repressing PTBP1 is incapable to convert reactive astrocytes to dopaminergic neurons in a mouse model of Parkinson's disease: https://www.biorxiv.org/content/10.1101/2021.11.12.468309.abstract
- Novel gene therapies technology for spinal cord injury (SCI) therapy: Efficient direct lineage reprogramming: https://www.medtextpublications.com/open-access/novel-gene-therapies-technology-for-spinal-cord-injury-sci-therapy-1182.pdf
- The activity-dependent transcription factor NPAS4 regulates domain-specific inhibition: https://www.nature.com/articles/nature12743

Second choice: 
### e. mRNA LNP

**Introduction**: Lipid nanoparticles (LNPs) are used as delivery vehicles for mRNA, protecting it from degradation and enhancing cellular uptake and endosomal escape.

- **Pros**:
  - **High Delivery Efficiency**: Offers efficient delivery of mRNA to a variety of cell types, including hard-to-transfect cells.
  - **Reduced Immunogenicity**: The use of LNPs can mitigate the innate immune response compared to naked mRNA.
  - **Versatile Application**: Suitable for vaccine development, therapeutic protein production, and gene editing.

- **Cons**:
  - **Formulation Complexity**: The development of effective LNP formulations requires significant expertise and optimization.
  - **Potential for Off-Target Effects**: While rare, there's a possibility of unintended interactions with non-target cells.
  - **Storage and Stability Issues**: mRNA-LNP formulations may require stringent storage conditions to maintain stability.

- **Applications**: COVID-19 vaccines, cancer immunotherapies, genetic diseases, and protein replacement therapies.


The relevant papers we found on Google Scholar: 
- A Statistical Model for In Vivo Neuronal Dynamics: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0142435
- Towards a functional understanding of short-term plasticity and the development of a statistical model of in vivo neuronal dynamics: https://simsurace.github.io/assets/phd-thesis-surace.pdf
- A Statistical Model for: https://intranet.physio.unibe.ch/Publikationen/Dokumente/Surace2015PLoSONE_1.pdf
- Neurons alter endoplasmic reticulum exit sites to accommodate dendritic arbor size: https://search.proquest.com/openview/c5c02370ac260076402a0c9fb4ee8b7e/1?pq-origsite=gscholar&cbl=18750&diss=y



assistant: Which delivery method would you like to use?


user: AAV

assistant: {'Thoughts': "The user has indicated a preference for AAV (Adeno-Associated Virus) as the delivery method. The user likely values the low immunogenicity and stable expression that AAV vectors provide, despite their limited payload capacity and variable transduction efficiency. AAV vectors are well-suited for applications in gene therapy, particularly for treating genetic disorders, which aligns with the user's choice.", 'Choice': 'f'}

assistant: STEP 3. Designing pegRNA for Prime Editing.

Next, we would like to guide you through the design of pegRNA for your target gene. When considering the pegRNA design, epegRNAs should be used over unmodified pegRNAs whenever possible due to their increased efficiency. A standard epegRNA has five components: the spacer, scaffold, RTT, PBS and tevopreQ1 motif. The scaffold and tevopreQ1 portions are constant, but the spacer, PBS and RTT should be optimized for each new edit.



assistant: Are you trying to correct or introduce clinical variants via Prime Editing? Please choose from (Correct, Introduce, No).

user: introduce

assistant: {'Thoughts': 'The user has chosen to introduce clinical variants using Prime Editing technology.', 'Choice': 'Introduce'}

assistant: From (Morris et al.,iScience,2021), we could help you design pegRNA to correct or introduce clinical variants via Prime Editing.

Please type the ClinVar ID of the mutation.



user: 53660

assistant: Here is what we get in our database: 

sgRNA Sequence, PBS Sequence, RTT Sequence, Extension 3Prime, PE3 sgRNA Sequence
CTCACAGCAACTCAAACAAC, CAGCAACTCAAAC, AACTGGAATCTGAATA, TATTCAGATTCCAGTTGTTTGAGTTGCTG, GAATCTCAAATAGCTCTTAT
TCACAGCAACTCAAACAACT, AGCAACTCAAACA, ACTGGAATCTGAATAT, ATATTCAGATTCCAGTTGTTTGAGTTGCT, GAATCTCAAATAGCTCTTAT
CAACTCAAACAACTGGAATC, TCAAACAACTGGA, ATCTGAATATGACAGT, ACTGTCATATTCAGATTCCAGTTGTTTGA, GAATCTCAAATAGCTCTTAT
CTCAAACAACTGGAATCTGA, AACAACTGGAATC, TGAATATGACAGTGAA, TTCACTGTCATATTCAGATTCCAGTTGTT, GAATCTCAAATAGCTCTTAT
TCAAACAACTGGAATCTGAA, ACAACTGGAATCT, GAATATGACAGTGAAT, ATTCACTGTCATATTCAGATTCCAGTTGT, GAATCTCAAATAGCTCTTAT
GATGAGTATCGCACATTCAC, AATGTGCGATACT, TCTGAATATGACAGTG, TCTGAATATGACAGTGAATGTGCGATACT, CCCTACATCTTTGTTGCAAC

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


user: no

assistant: Step 4. Collecting appropriate experimantal protocols and validating the editing outcomes

Based on information from the previous step 2, we are showing you related protocols using AAV delivery


assistant: Here are several reference papers we found on Google Scholar: 
- Dual-AAV delivering split prime editor system for in vivo genome editing: https://www.cell.com/molecular-therapy-family/molecular-therapy/fulltext/S1525-0016(21)00365-8
- A truncated reverse transcriptase enhances prime editing by split AAV vectors: https://www.cell.com/molecular-therapy-family/molecular-therapy/fulltext/S1525-0016(22)00422-1
- Dual-AAV split prime editor corrects the mutation and phenotype in mice with inherited retinal degeneration: https://www.nature.com/articles/s41392-022-01234-1
- Efficient prime editing in mouse brain, liver and heart with dual AAVs: https://www.nature.com/articles/s41587-023-01758-z
- A flexible split prime editor using truncated reverse transcriptase improves dual-AAV delivery in mouse liver: https://www.cell.com/molecular-therapy-family/molecular-therapy/fulltext/S1525-0016(22)00005-3

assistant: In this protocol, you can validate the Prime Editing through the following ways, including: 

1. (Not common) Staining of target protein by antibody, and measure level of knockout using flow cytometry or western blot.
2. Mutation sequencing by Sanger Sequencing
3. Mutation sequencing by Next-generation Sequencing (NGS)

Which one would you like to use?


user: 3

assistant: Please find the protocols below:
[SP4.docx](https://crispr-gpt.s3.amazonaws.com/SP4.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=VqFNCB7n%2FXL6YP2mZPwjHRmeF7c%3D&Expires=1725853409)

[BP8_NGS.docx](https://crispr-gpt.s3.amazonaws.com/BP8_NGS.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=96N1gH6BfiNtLBuR7ZjvSjLQZhM%3D&Expires=1725853409)

 
 
 (add amplicon for NGS and add Crispresso website)

assistant: We could help you design the related PCR primers using Primer3 (Untergasser et al.,Nucleic Acids Res.,2012) through following options:

1. Primer3 - command-line script to design primers - we run the script for you.
2. Primer-blast (Web tool, Manual design one by one)
3. Primer3 - command-line script to design primers - you run the code yourself

*Please cite the corresponding papers if you decide to use the tool.

Which one do you prefer?



user: 3

assistant: {'ChatResponse': {'Thoughts': 'The user has chosen to design the primers themselves using the Primer3 command-line script.', 'Choice': '3'}}

assistant: 
We recommend using Primer3 (Untergasser et al.,Nucleic Acids Res.,2012) to design your primer. Please find the manual here: 
https://primer3.org/manual.html

Here are the suggested parameters for you:

```
SEQUENCE_TEMPLATE= input sequence (*Please include 200bp upstream and 200bp downstream of the gRNA*)
PRIMER_TASK=generic
PRIMER_PICK_LEFT_PRIMER=1
PRIMER_PICK_INTERNAL_OLIGO=0
PRIMER_PICK_RIGHT_PRIMER=1
PRIMER_OPT_SIZE=20
PRIMER_MIN_SIZE=18
PRIMER_MAX_SIZE=22
PRIMER_PRODUCT_SIZE_RANGE=100-200
PRIMER_EXPLAIN_FLAG=1
SEQUENCE_TARGET=200,20
```
Please don’t forget to add corresponding illumina adaptors for the downstream library construction.


assistant: 
Next, we could help you analyze the NGS data using
CRISPResso2 (Clement et al., Nat Biotechnol.,2019).

1. CRISPResso2 - command-line script to analyze data - we run the script for you.
2. CRISPResso2 (Web tool)

*Please cite the corresponding papers if you decide to use the tool.
Which one do you prefer?


user: 2

assistant: 
Please find the webtool below: http://crispresso2.pinellolab.org/submission
*Please cite the corresponding papers if you decide to use the tool.


assistant: Finished. Clear the current chat or start a new one.