assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 1

assistant: {'Thoughts': 'The user has chosen Meta-Mode, which implies they are seeking step-by-step guidance on a predefined meta-task related to CRISPR technology.', 'Choice': '1'}

assistant: Please select the general gene editing scenarios to continue.
1. Generating a Knockout Using CRISPR.
2. CRISPR Base Editing Without Double-Strand Breaks.
3. Generating Small Insertion/deletion/base editing through Prime Editing.
4. Activation or Repression of Target Genes Using CRISPR.


user: I'm trying to activate human LTBR gene in primary T cells.

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: {'Thoughts': 'The user wants to activate the LTBR gene in primary T cells. Among the provided scenarios, the appropriate choice would involve activating or repressing target genes.', 'Choice': '4'}

assistant: 
CRISPR-Cas9 system can also be used to modulate gene expression, turning genes on (activation) or off (repression). This involves using a deactivated or 'dead' form of the Cas protein, dCas, which can still bind to DNA but no longer cuts it. The dCas9 can be fused with transactivators or repressors to upregulate or downregulate gene expression, respectively.

Now let’s start with designing your CRISPRa/i gene-editing experiment, we will go through a step by step process as listed below:
1. Selecting an CRISPR activation or repression system.
2. Selecting a delivery approach for CRISPRa/i system.
3. Designing guideRNA for CRISPRa/i.
4. Collecting appropriate experimantal protocols and validating the editing outcomes.


assistant: 
Step 1. Selecting an CRISPR activation or repression system.

We support two types of CRISPR/Cas system for CRISPR activation/repression, SpCas9, enCas12a, representing distinct variants with unique properties and applications.

1. SpCas9  (Jinek et al.,Science,2012;Cong et al.,Science,2013;Mali et al.,Science,2013;Jinek et al.,eLife,2013)
- Pros: Highly effective, well-studied, proven applications in many cell types/scenarios.  
- Cons: Large, potential off-target effects.  
- Uses: Genetic research, gene therapy, genetically modified models/organisms (GMMs/GMOs).

2. enCas12a  (Kleinstiver et al.,Nat Biotechnol.,2019;DeWeirdt et al.,Nat Biotechnol.,2020)
- Pros: Smaller, precise, low off-target rate, multi-target editing capability using a single guideRNA array.  
- Cons: May be less efficient than SpCas9 when using a single guideRNA (mitigated if using multi-guide array), limited target sites vs. SpCas9 due to more restrictive PAM.  
- Uses: High-precision and multiplexed genome editing (for genetic interaction, target redundant genes/pathways).

*Please cite the corresponding papers if you decide to use the system.


assistant: 
Please select the CRISPR-Cas system you would like to use. Or please briefly describe your need (exp: I want to edit mouse liver/I want low off-target rate/I want to do multiplexed editing) and we could recommend the CRSIPR-Cas system to you.

user: 1

assistant: {'Thoughts': "The user input is '1'. According to the given information, '1' corresponds to SpCas9. This system is highly effective, well-studied, and has proven applications in many cell types and scenarios, which aligns with the user's selection.", 'Answer': 'SpCas9'} Final Result SpCas9

assistant: 
Then, we will help you select the effector protein.

Do you want to activate or repress a gene of interest?


user: I'm trying to activate human LTBR gene in primary T cells.

assistant: {'Thoughts': 'The user wants to activate the LTBR gene in primary T cells. In CRISPR technology, gene activation is typically achieved using CRISPR activation (CRISPRa) systems. Therefore, the user is looking to increase the expression of the LTBR gene.', 'Choice': 'activate'}

assistant: We support 4 types of activation systems are available, representing distinct variants with unique properties and applications.

1. VP64: (Qi et al.,Cell,2013)

An early method, combining deactivated Cas with the activation domain VP64 to recruit transcriptional machinery to specific DNA sequences. It allows for modest gene activation and can be targeted to either initiate or elongate transcription. 

Performance: Provides around 2-fold gene activation, considered modest compared to newer methods.

2. Synergistic Activation Mediator (SAM): (Konermann et al.,Nature,2015)

An advanced technique that uses a dCas9/VP64 fusion, engineered with aptamers binding to MS2 proteins, which recruit additional activation domains. 

Performance: Offers the highest levels of gene activation for single targets, with effectiveness on par with other methods for multiple targets.

3. SunTag: (Gilbert et al.,Cell,2014)

Utilizes a repeating peptide array fused with multiple VP64 activations to recruit more transcriptional machinery per targeted gene.

Performance: Outperforms first-generation activators but has lower activation levels than SAM and involves more complex construction.

4. VPR: (Chavez et al.,Nat Method.,2015)

A tripartite complex fusing VP64, p65, and Rta activators with dCas9 to enhance transcription, working in tandem to recruit more transcription factors.

Performance: Shows higher activation levels than dCas9-VP64 but lower than SAM, with advantages in simplicity and delivery due to its single-component nature compared to SAM and SunTag.


Please select the activation system you would like to use. Or please briefly describe your need (exp: I want to a compact system/I want to maximize the efficiency) and we could recommend the activation system to you.


user: I'm trying to activate human LTBR gene in primary T cells.



assistant: {'Thoughts': 'The user wants to activate the LTBR gene in primary T cells. We should consider the effectiveness of gene activation and the complexity of the system. VP64 offers modest activation, which might not be sufficient. SAM provides the highest levels of gene activation, making it highly effective, but it is more complex. SunTag is also complex and less effective than SAM. VPR offers higher activation levels than VP64 and is simpler to deliver than SAM and SunTag, but it is less effective than SAM. Given the goal is to activate the gene efficiently, SAM is the most relevant system due to its superior gene activation levels despite its complexity.', 'Answer': 'SAM'}

assistant: 
Step 2. Selecting a delivery approach for CRISPR/Cas system

Different biological systems are amenable to different delivery methods for genome-editing tools. We currently support the following delivery method:

a. Plasmid transfection
b. Lentivirus/Retrovirus delivery
c. RNP/mRNA Electroporation
d. RNP/mRNA Microinjection
e. mRNA LNP
f. AAV (Adeno-Associated Virus)


Please select one from above or please briefly describe your application cases below (exp. I hope to edit A549 cell lines/ I hope to edit mouse liver).

*Please note we currently only support mammalian cells/tissues.


user: I'm trying to activate human LTBR gene in primary T cells.

assistant: Please find the recommended delivery approach below:

Top choice: 
### b. Lentivirus/Retrovirus

**Introduction**: Lentivirus and retrovirus vectors are tools for delivering genetic material into cells, allowing stable integration of the transferred genes into the host genome, leading to long-term expression.

- **Pros**:
  - **Stable Expression**: Allows for permanent gene expression modifications in the host cell.
  - **Broad Host Range**: Capable of infecting both dividing and non-dividing cells.
  - **High Efficiency**: Especially effective in hard-to-transfect cell types.

- **Cons**:
  - **Safety Concerns**: Though lentiviral vectors are designed to be safe, there remains a theoretical risk of insertional mutagenesis.
  - **Complex Production**: Virus production and purification can be technically challenging and time-consuming.
  - **Regulatory and Biosafety Considerations**: Use of viral vectors requires strict adherence to biosafety guidelines.

- **Applications**: Ideal for studies requiring stable gene expression, gene therapy research, and cell line generation.


The relevant papers we found on Google Scholar: 
- Lentivirus-mediated gene transfer in primary T cells is enhanced by a central DNA flap: https://www.nature.com/articles/3301378
- Lentivirus-mediated gene transfer and expression in established human tumor antigen-specific cytotoxic T cells and primary unstimulated T cells: https://www.liebertpub.com/doi/abs/10.1089/104303403322124800
- Simplified production and concentration of lentiviral vectors to achieve high transduction in primary human T cells: https://link.springer.com/article/10.1186/1472-6750-13-98
- Phenotypic and functional attributes of lentivirus-modified CD19-specific human CD8+ central memory T cells manufactured at clinical scale: https://journals.lww.com/immunotherapy-journal/fulltext/2012/11000/phenotypic_and_functional_attributes_of.5.aspx
- Production of Lentivirus for the Establishment of CAR-T Cells: https://link.springer.com/protocol/10.1007/978-1-0716-0146-4_4
- Lentivirus-mediated RNA interference of DC-SIGN expression inhibits human immunodeficiency virus transmission from dendritic cells to T cells: https://journals.asm.org/doi/abs/10.1128/jvi.78.20.10848-10855.2004
- Suppression of Activation of the Human Immunodeficiency Virus Long Terminal Repeat by CD8+ T Cells Is Not Lentivirus Specific: https://www.liebertpub.com/doi/abs/10.1089/aid.1995.11.1321
- Activation of transgene-specific T cells following lentivirus-mediated gene delivery to mouse lung: https://www.cell.com/molecular-therapy-family/molecular-therapy/fulltext/S1525-0016(16)31591-X
- Production and concentration of lentivirus for transduction of primary human T cells: https://link.springer.com/protocol/10.1007/978-1-4939-3753-0_7
- High frequencies of resting CD4+ T cells containing integrated viral DNA are found in rhesus macaques during acute lentivirus infections: https://www.pnas.org/doi/abs/10.1073/pnas.0903022106

Second choice: 
### c. RNP/mRNA Electroporation

**Introduction**: This method involves introducing ribonucleoprotein (RNP) complexes or mRNA directly into cells using an electrical field to make the cell membrane more permeable.

- **Pros**:
  - **Transient and Safe**: Provides a temporary expression without integrating into the genome, reducing long-term safety concerns.
  - **High Efficiency**: Can achieve high transfection efficiencies in a broad range of cell types, including difficult-to-transfect cells.
  - **Versatile**: Suitable for various applications from gene editing (using CRISPR-Cas9 RNPs) to protein expression.

- **Cons**:
  - **Cell Viability**: The electroporation process can be harsh, resulting in reduced cell viability.
  - **Optimization Required**: Conditions must be meticulously optimized for different cell types to achieve the desired balance of efficiency and viability.

- **Applications**: Gene editing, transient protein expression, immunotherapy research, and stem cell research.


The relevant papers we found on Google Scholar: 
- Optimization of electroporation and other non‐viral gene delivery strategies for T cells: https://aiche.onlinelibrary.wiley.com/doi/abs/10.1002/btpr.3066
- Generation of tumor-activated T cells using electroporation: https://www.sciencedirect.com/science/article/pii/S1567539421001493
- A new way to generate cytolytic tumor-specific T cells: electroporation of RNA coding for a T cell receptor into T lymphocytes: https://link.springer.com/article/10.1007/s00262-005-0098-2
- Selective modification of antigen-specific T cells by RNA electroporation: https://www.liebertpub.com/doi/abs/10.1089/hum.2007.115
- Optimized DNA electroporation for primary human T cell engineering: https://link.springer.com/article/10.1186/s12896-018-0419-0
- Optimized two‐step electroporation process to achieve efficient nonviral‐mediated gene insertion into primary T cells: https://febs.onlinelibrary.wiley.com/doi/abs/10.1002/2211-5463.13292
- Novel T cells with improved in vivo anti-tumor activity generated by RNA electroporation: https://academic.oup.com/proteincell/article-abstract/8/7/514/6765132
- Transfection of Jurkat T cells by droplet electroporation: https://www.sciencedirect.com/science/article/pii/S1369703X17300785
- Electroporation enables plasmid vaccines to elicit CD8+ T cell responses in the absence of CD4+ T cells: https://journals.aai.org/jimmunol/article/171/7/3379/71492
- mRNA-based CAR T-cells manufactured by miniaturized two-step electroporation produce selective cytotoxicity toward target cancer cells: https://pubs.rsc.org/en/content/articlehtml/2021/lc/d1lc00219h



assistant: Which delivery method would you like to use?


user: b

assistant: {'Thoughts': "The user has chosen option 'b', which corresponds to the use of lentivirus/retrovirus vectors for genetic material delivery. This method is advantageous for stable and long-term gene expression, has a broad host range, and is highly efficient, particularly in hard-to-transfect cells. However, it comes with safety concerns, complex production processes, and regulatory considerations.", 'Choice': 'b'}

assistant: 
Step 3. Designing guideRNA for gene activation or repression

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; I hope to design a guide RNA for CRISPRa that locates within 108146000 to 108146262.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


user: human LTBR

assistant: https://crispr-gpt.s3.amazonaws.com/f0b4d4c7-ceb5-4556-8849-cc34325555f0?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=LNk2tGnsgA8NIIfPM4GndA5ZWMs%3D&Expires=1725806264

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence       | PAM Sequence   | Target Domain   |   TSS Position |   sgRNA 'Cut' Position |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:---------------------|:---------------|:----------------|---------------:|-----------------------:|---------------------------:|------------------:|----------------:|
| LTBR                 | CRISPRa            | GGGAGTTCCAGAGAGCGCAA | GGG            | [TSS-300,TSS+0] |        6384169 |                6383870 |                     1.08   |                11 |               1 |
| LTBR                 | CRISPRa            | CCTGTCGCAATCGCAGCCCA | GGG            | [TSS-300,TSS+0] |        6384169 |                6384094 |                     0.9069 |                 8 |               2 |
| LTBR                 | CRISPRa            | GCCCTTGGACAAGCCTCGCA | GGG            | [TSS-300,TSS+0] |        6384169 |                6383901 |                     0.8506 |                 7 |               3 |
| LTBR                 | CRISPRa            | CAGGCTTGTCTGCCTCGATG | CGG            | [TSS-300,TSS+0] |        6384169 |                6384063 |                     0.5961 |                 5 |               4 |
| LTBR                 | CRISPRa            | GAAAGCACGTGAGGGCCGCG | GGG            | [TSS-300,TSS+0] |        6384169 |                6384022 |                     0.56   |                 9 |               5 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


user: yes

assistant: To identify potential off-target sites for your genome editing guides, we recommend you using CRISPRitz (Cancellieri et al.,Bioinformatics,2020), a rapid, high-throughput and variant-aware in silico off-target site identification package.

Please find the github page below:
https://github.com/pinellolab/CRISPRitz

*Please cite the corresponding papers if you decide to use the tool.

Our CRISPR-GPT can run CRISPRitz on our server for you, if you'd like CRISPR-GPT to help you run this step please type “Yes”, otherwise, type “No” if you prefer to run CRISPRitz locally, and we will give you a set of instructions. Would you like CRISPR-GPT to run off-target analysis for you? (Yes/No)


user: yes

assistant: Are you hoping to perform (1). Mismatches-Only search or (2). Mismatches + Bulges search?

user: 2

assistant: 
Please provide the species (human or mouse)
1. human
2. mouse


user: 1

assistant: 
Please provide the CAS system (SpCas9 or AsCas12a)
1. SpCas9
2. AsCas12a


user: 1

assistant: 
Please provide the sequence entering guide+PAM for SpCas9 (e.g. TCACCCAGGCTGGAATACAGNNN) or PAM+guide for AsCas12a (e.g. NNNNTCACCCAGGCTGGAATACAG).


user: GGGAGTTCCAGAGAGCGCAANNN

assistant: Running CRISPRItz mismatch_bulges with species: human, CAS: SpCas9, sequence: GGGAGTTCCAGAGAGCGCAANNN. We will send you an email once the result files are ready to be downloaded.

assistant: Step 4. Collecting appropriate experimantal protocols and validating the editing outcomes.

Based on information from the previous step 2, we are showing you related protocols using Lentivirus/Retrovirus delivery


assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: 2

assistant: {'ChatResponse': {'Thoughts': 'The user has selected step 2, which involves delivering the synthesized or cloned Cas and sgRNA system into the desired cells.', 'Choice': '2'}}

assistant: Please find the protocols below:
[BP2.docx](https://crispr-gpt.s3.amazonaws.com/BP2.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=7ac9bSvIe4umfn4hldTvCgwJh2U%3D&Expires=1725806301)



[BP4.docx](https://crispr-gpt.s3.amazonaws.com/BP4.docx?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=nIt4%2FhJEzIuj05oh1g0HSRf7TaE%3D&Expires=1725806301)



assistant: Now, we will help you through the detailed protocols of CRISPR experiments (Giuliano et al.,Curr Protoc Mol Biol., 2019).

1. Synthesize or clone the Cas and sgRNA system.
2. Deliver the product (synthesized or cloned the Cas and sgRNA system) into the desired cells.
3. Isolation of single cell clones.

*Please cite the corresponding papers if you decide to use the protocols.

Please type start so we can get you to the first step or enter the step numbers you are interested in. Type 'End' to finish.


user: end

assistant: {'ChatResponse': {'Thoughts': 'The user has chosen to finish the process, indicating they do not wish to proceed with the detailed steps at this time.', 'Choice': 'end'}}

assistant: In this protocol, you can validate the activation/repression through the following ways, including: 

1. protein: Staining of target protein by antibody, and measuring level of activation/repression using flow cytometry or western blot.
2. qPCR: Measure RNA expression by qPCR (design primer using webtool or external tool Primer3) 
3. RNA-seq: Measure RNA expression by next-generation sequencing (NGS).

Which one would you like to use?


user: 2

assistant: 
Quantitative polymerase chain reaction (qPCR) is a pivotal tool for validating the efficacy of CRISPR-mediated gene activation (CRISPRa) or interference (CRISPRi). After introducing the CRISPRa/i system into cells, qPCR allows researchers to quantitatively assess changes in target gene expression levels. By comparing the expression levels of the target gene in CRISPR-treated cells to those in control cells, one can determine the extent of activation or repression achieved. It's essential to use appropriate reference genes for normalization to ensure accurate quantification. The high sensitivity, specificity, and rapid turnaround of qPCR make it an ideal method for this purpose. Moreover, the use of melt curve analysis post-amplification ensures the specificity of the qPCR products, further validating the results. In essence, qPCR serves as a reliable and efficient means to confirm the functional outcomes of CRISPRa/i experiments.

Please find an example protocol here:
https://www.sigmaaldrich.com/US/en/technical-documents/protocol/genomics/qpcr/sybr-green-qpcr


assistant: We could help you design the related PCR primers using Primer3 (Untergasser et al.,Nucleic Acids Res.,2012) through following options:

1. Primer3 - command-line script to design primers - we run the script for you.
2. Primer-blast (Web tool, Manual design one by one)
3. Primer3 - command-line script to design primers - you run the code yourself

*Please cite the corresponding papers if you decide to use the tool.

Which one do you prefer?



user: 2

assistant: {'ChatResponse': {'Thoughts': 'The user prefers to design the qPCR primers manually using the NCBI-Blast primer design tool.', 'Choice': '2'}}

assistant: 
We recommend using NCBI-PrimerBlast to design your PCR primers.
Parameter should be:

Parameter should be:

(1) PCR Template: 
- Sequence: CDS Sequence of your interested gene
(2) Primer Parameters: 
- PCR product size: 50-100bp
(3) Primer Pair Specificity Checking Parameters:
- Database: Refseq mRNA
- Organism: Your model organisms.


assistant: Finished. Clear the current chat or start a new one.