assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 2

assistant: {'Thoughts': 'The user has selected Auto-Mode, which means they are looking for customized guidance on a free-style request related to CRISPR technology. I will now await their specific question or request to provide tailored assistance.', 'Choice': '2'}

assistant: Please directly type in your need.

user: help me design guideRNA to knockout the Xkr4 gene in mouse

assistant: {'Thoughts': 'The user specifically requested help with designing guideRNA for knocking out the Xkr4 gene in mouse. This directly aligns with the task designated as knockout.StateStep3.', 'Tasks': ['knockout.StateStep3']}

assistant: 
Step 3. Designing guideRNA for gene knockout

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
In order to complete the current task, we would need you to answer the following questions. 

If you are not sure how to select, we recommend you use the Meta-mode where we could generate case-specific guidance based on your needs, please open a new chat and enter meta-mode (select option 1 for the initial prompt).

1. Which Cas system are you planning to use? (We currently support SpCas9, enCas12a, SaCas9, SpRYCas9)


assistant: Here is the GPT-suggested answer: 

SpCas9


 Reason: 
To design the guideRNA for knocking out the Xkr4 gene in mouse, it is important to know which Cas system the user intends to use. This will determine the PAM sequence and other factors relevant to designing the guideRNA.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: {'Thoughts': "The user has provided 'SpCas9' as the input. Given the instruction to identify the single most relevant Cas system and the context provided for each system, it is clear that the user is directly specifying SpCas9. Therefore, the most relevant Cas system is SpCas9 itself.", 'Answer': 'SpCas9'} Final Result SpCas9

assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


assistant: Here is the GPT-suggested answer: 

Please design 2 sgRNAs targeting the mouse Xkr4 gene.


 Reason: 
The user has requested help to design guideRNA to knockout the Xkr4 gene in mouse using SpCas9. Based on the provided context, the response should directly address the user's request.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: Sugessted exon/exons: {'Exon/exons': 'Exon 2 or Exon 3', 'Reason': {"Since the user has not specified any exons to target, we recommend targeting Exon 2 or Exon 3 of the XKR4 gene. These exons are typically chosen because they are often essential for the gene's function and tend to contain conserved sequences that are critical for proper gene activity. Targeting these exons can increase the likelihood of disrupting the gene function effectively."}}

assistant: 
Based on the information you provided, it may be beneficial to design sgRNAs targeting specific exons within the genes.

Would you like to continue sgRNA design with the exon/exons we suggested?


assistant: Here is the GPT-suggested answer: 

Yes, continue sgRNA design with Exon 2 or Exon 3.


 Reason: 
The user has not specified any exons to target, and the tool suggests targeting Exon 2 or Exon 3 of the XKR4 gene for effective disruption of gene function.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: https://crispr-gpt.s3.amazonaws.com/51fa5872-f5a7-4c91-ad26-74eae3b03e87?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=7CgtuYHSlknOPeGNYWhuEDqNyvc%3D&Expires=1727037074

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence       | PAM Sequence   |   Exon Number |   sgRNA Cut Position (1-based) |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:---------------------|:---------------|--------------:|-------------------------------:|---------------------------:|------------------:|----------------:|
| Xkr4                 | CRISPRko           | AAGTCATGATGCACCAATGG | AGG            |             3 |                        3216752 |                     1.541  |                20 |               2 |
| Xkr4                 | CRISPRko           | GAGGGCGAATGTGATGACCC | TGG            |             3 |                        3216816 |                     1.45   |                35 |               5 |
| Xkr4                 | CRISPRko           | TCAGGAATAGATATCCAGCA | TGG            |             3 |                        3216160 |                     0.7501 |                15 |               6 |
| Xkr4                 | CRISPRko           | CAGAGCTGCAGGACCAATTG | TGG            |             2 |                        3421757 |                     0.811  |                26 |               7 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
Input/Output may contain sensitive sequences. This is not supported in Automation mode! Please manually enter your response!

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: no

assistant: Finished. Clear the current chat or start a new one.