assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 2

assistant: {'Thoughts': 'The user has selected Auto-Mode, indicating they want customized guidance on a free-style user request. This mode allows for more flexibility and tailored assistance based on the specific needs of the user.', 'Choice': '2'}

assistant: Please directly type in your need.

user: Help me design 2 sgRNAs targeting human BRD4 to knockout this gene in my loss-of-function study.

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: y

assistant: Please directly type in your need.

assistant: {'Thoughts': 'The user specifically requested help with designing sgRNAs for knocking out the BRD4 gene in a loss-of-function study. This directly matches the task for guideRNA design for knockout.', 'Tasks': ['knockout.StateStep3']}

assistant: 
Step 3. Designing guideRNA for gene knockout

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
In order to complete the current task, we would need you to answer the following questions. 

If you are not sure how to select, we recommend you use the Meta-mode where we could generate case-specific guidance based on your needs, please open a new chat and enter meta-mode (select option 1 for the initial prompt).

1. Which Cas system are you planning to use? (We currently support SpCas9, enCas12a, SaCas9, SpRYCas9)


assistant: Here is the GPT-suggested answer: 

SpCas9


 Reason: 
The user needs guidance on designing 2 sgRNAs targeting the human BRD4 gene for a knockout study. The first step involves choosing the Cas system they plan to use. Based on common usage and broad support, we can select SpCas9 for them.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: {'Thoughts': "The user input directly specifies 'SpCas9', which is one of the Cas systems listed. The pros and cons of SpCas9 align with the characteristics described in the user input. Therefore, the most relevant Cas system based on the user input is clearly SpCas9.", 'Answer': 'SpCas9'} Final Result SpCas9

assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


assistant: Here is the GPT-suggested answer: 

I hope to design 2 sgRNAs targeting human BRD4.


 Reason: 
The user has requested the design of 2 sgRNAs targeting human BRD4 for a loss-of-function study. The CRISPick tool can be used to identify effective sgRNA sequences for SpCas9 targeting BRD4 in the human genome.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: Sugessted exon/exons: {'Exon/exons': 'Exon 3 and Exon 4', 'Reason': {"BRD4 is a well-studied gene involved in transcription regulation and cancer progression. Exon 3 and Exon 4 are good targets because they are critical for the functional domains of the protein, specifically the bromodomain regions which are crucial for its activity. Targeting these exons can effectively disrupt the gene's function, leading to loss-of-function mutations which can be beneficial for studying gene function or therapeutic interventions."}}

assistant: 
Based on the information you provided, it may be beneficial to design sgRNAs targeting specific exons within the genes.

Would you like to continue sgRNA design with the exon/exons we suggested?


assistant: Here is the GPT-suggested answer: 

Yes


 Reason: 
The user has requested help designing sgRNAs for targeting human BRD4 to knockout the gene in a loss-of-function study. The tool suggests targeting Exon 3 and Exon 4 due to their importance in the gene's functionality, specifically in the bromodomain regions. We should proceed with designing sgRNAs for these exons.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: https://crispr-gpt.s3.amazonaws.com/a1178092-d310-4676-8794-9969656bc79b?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=9HMy6MTgxNiwQsZXOAbzXEFKKLE%3D&Expires=1726608623

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence       | PAM Sequence   |   Exon Number |   sgRNA Cut Position (1-based) |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:---------------------|:---------------|--------------:|-------------------------------:|---------------------------:|------------------:|----------------:|
| BRD4                 | CRISPRko           | TAAGATCATTAAAACGCCTA | TGG            |             3 |                       15269018 |                      1.205 |                 2 |               1 |
| BRD4                 | CRISPRko           | CAACTATTACTGGAATGCTC | AGG            |             3 |                       15268964 |                      1.136 |                60 |               5 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
Input/Output may contain sensitive sequences. This is not supported in Automation mode! Please manually enter your response!

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: yes

assistant: To identify potential off-target sites for your genome editing guides, we recommend you using CRISPRitz (Cancellieri et al.,Bioinformatics,2020), a rapid, high-throughput and variant-aware in silico off-target site identification package.

Please find the github page below:
https://github.com/pinellolab/CRISPRitz

*Please cite the corresponding papers if you decide to use the tool.

Our CRISPR-GPT can run CRISPRitz on our server for you, if you'd like CRISPR-GPT to help you run this step please type “Yes”, otherwise, type “No” if you prefer to run CRISPRitz locally, and we will give you a set of instructions. Would you like CRISPR-GPT to run off-target analysis for you? (Yes/No)


assistant: Here is the GPT-suggested answer: 

Yes


 Reason: 
The tool is offering to run the off-target analysis using CRISPRitz on their server. Since the user wants to design sgRNAs for BRD4, running the off-target analysis would be beneficial to ensure specificity.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: Are you hoping to perform (1). Mismatches-Only search or (2). Mismatches + Bulges search?

assistant: Here is the GPT-suggested answer: 

1. Mismatches-Only search


 Reason: 
The user is looking to design sgRNAs for targeting the human BRD4 gene for a knockout study. The current inquiry is asking for the type of search the user would like to perform for identifying potential off-target effects.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 2

assistant: 
Please provide the species (human or mouse)
1. human
2. mouse


assistant: Here is the GPT-suggested answer: 

human


 Reason: 
The user has specified that they want to target the human BRD4 gene.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: 
Please provide the CAS system (SpCas9 or AsCas12a)
1. SpCas9
2. AsCas12a


assistant: Here is the GPT-suggested answer: 

1. SpCas9


 Reason: 
The inquiry asks for the CAS system to be used for designing sgRNAs. According to the user's meta request, the goal is to knockout the BRD4 gene in a loss-of-function study. SpCas9 is a commonly used and well-characterized CAS system for such purposes.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: 
Please provide the sequence entering guide+PAM for SpCas9 (e.g. TCACCCAGGCTGGAATACAGNNN) or PAM+guide for AsCas12a (e.g. NNNNTCACCCAGGCTGGAATACAG).


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
Input/Output may contain sensitive sequences. This is not supported in Automation mode! Please manually enter your response!

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: TAAGATCATTAAAACGCCTANNN

assistant: Running CRISPRItz mismatch_bulges with species: human, CAS: SpCas9, sequence: TAAGATCATTAAAACGCCTANNN. We will send you an email once the result files are ready to be downloaded.

assistant: Finished. Clear the current chat or start a new one.