assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 2

assistant: {'Thoughts': "The user has selected Auto-Mode, which implies they are looking for customized guidance on a specific request related to CRISPR technology. I need to be prepared to provide detailed, tailored assistance based on the user's input.", 'Choice': '2'}

assistant: Please directly type in your need.

user: Could you help me design 4 Cas12a sgRNAs to knockout TGFBR1 in human cell line?

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: Please directly type in your need.

assistant: {'Thoughts': 'The user specifically asked for designing guideRNAs for knockout using Cas12a in a human cell line. Based on the task description table, this matches directly with the task for guideRNA design for knockout.', 'Tasks': ['knockout.StateStep3']}

assistant: 
Step 3. Designing guideRNA for gene knockout

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
In order to complete the current task, we would need you to answer the following questions. 

If you are not sure how to select, we recommend you use the Meta-mode where we could generate case-specific guidance based on your needs, please open a new chat and enter meta-mode (select option 1 for the initial prompt).

1. Which Cas system are you planning to use? (We currently support SpCas9, enCas12a, SaCas9, SpRYCas9)


assistant: Here is the GPT-suggested answer: 

enCas12a


 Reason: 
The user has requested help designing sgRNAs for the TGFBR1 gene in a human cell line using the Cas12a system.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: {'Thoughts': 'The user input directly specifies enCas12a, which is one of the Cas systems listed. Given the description, enCas12a is noted for its smaller size, lower off-target effects, and ability to perform multiplexed editing, which aligns well with applications requiring high precision and reduced off-target effects.', 'Answer': 'enCas12a'} Final Result enCas12a

assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


assistant: Here is the GPT-suggested answer: 

I hope to design 4 sgRNAs targeting human TGFBR1.


 Reason: 
The user wishes to design 4 sgRNAs targeting the TGFBR1 gene in a human cell line using enCas12a. The tool mentioned is CRISPick, which provides a platform for designing guide RNAs with high precision.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: Sugessted exon/exons: {'Exon/exons': 'Exon 2, Exon 3, Exon 4', 'Reason': {'Exon 2, 3, and 4 are often targeted in gene editing experiments because they are typically among the first few exons and are critical for the early part of the protein-coding sequence. Targeting these exons can effectively knock out the gene, leading to a loss-of-function mutation. Additionally, these exons are generally well-conserved and offer multiple potential sgRNA target sites, making them good candidates for CRISPR/Cas9-mediated gene editing.'}}

assistant: 
Based on the information you provided, it may be beneficial to design sgRNAs targeting specific exons within the genes.

Would you like to continue sgRNA design with the exon/exons we suggested?


assistant: Here is the GPT-suggested answer: 

Yes, I would like to continue sgRNA design with the exon/exons suggested.


 Reason: 
The user has requested sgRNAs for knocking out the TGFBR1 gene in a human cell line and the suggested exons (Exon 2, Exon 3, Exon 4) are provided along with their justification. The inquiry asks if the user would like to continue sgRNA design with the suggested exons.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: no

assistant: https://crispr-gpt.s3.amazonaws.com/02188ef4-4600-480e-8f47-df1cec24acbf?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=mrylZsqQqXO%2BtkHLIKbbh8ZieFI%3D&Expires=1725815733

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence          | PAM Sequence   |   Exon Number |   sgRNA Cut Position (1-based) |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:------------------------|:---------------|--------------:|-------------------------------:|---------------------------:|------------------:|----------------:|
| TGFBR1               | CRISPRko           | ACTCGAGGCCCTTTTTCAGTAAA | TTTC           |             3 |                       99132511 |                     0.9704 |                23 |               1 |
| TGFBR1               | CRISPRko           | AGAGGGTACTACGTTGAAAGACT | TTTC           |             3 |                       99132702 |                     0.9922 |                52 |               2 |
| TGFBR1               | CRISPRko           | CAGACAATGGTACTTGGACTCAG | TTTA           |             5 |                       99142554 |                     0.9447 |                44 |               3 |
| TGFBR1               | CRISPRko           | AGTAATCAAAAAGGGATCCATGC | TTTA           |             5 |                       99142584 |                     0.9628 |                60 |               4 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
Input/Output may contain sensitive sequences. This is not supported in Automation mode! Please manually enter your response!

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: no

assistant: Finished. Clear the current chat or start a new one.