assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 2

assistant: {'Thoughts': 'The user has chosen Auto-Mode, which suggests they want customized guidance based on their own specific request or question.', 'Choice': '2'}

assistant: Please directly type in your need.

user: Please help me design guide RNAs for knocking out the CD96 gene in human

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: Please directly type in your need.

assistant: {'Thoughts': 'The user request is to design guide RNAs for knocking out the CD96 gene in humans. This directly matches the task for guideRNA design for knockout.', 'Tasks': ['knockout.StateStep3']}

assistant: 
Step 3. Designing guideRNA for gene knockout

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
In order to complete the current task, we would need you to answer the following questions. 

If you are not sure how to select, we recommend you use the Meta-mode where we could generate case-specific guidance based on your needs, please open a new chat and enter meta-mode (select option 1 for the initial prompt).

1. Which Cas system are you planning to use? (We currently support SpCas9, enCas12a, SaCas9, SpRYCas9)


assistant: Here is the GPT-suggested answer: 

SpCas9


 Reason: 
To proceed with designing guide RNAs for knocking out the CD96 gene, we need to specify which Cas system is being used. The available options are SpCas9, enCas12a, SaCas9, and SpRYCas9.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: {'Thoughts': "The user has provided 'SpCas9' as input, which directly matches one of the listed Cas systems. There is no need to compare other Cas systems as the user has specifically requested information about SpCas9. Thus, SpCas9 is the most relevant Cas system to the user's input.", 'Answer': 'SpCas9'} Final Result SpCas9

assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


assistant: Here is the GPT-suggested answer: 

I hope to design 2 sgRNAs targeting human CD96.


 Reason: 
The user wants to design guide RNAs for knocking out the CD96 gene in humans. SpCas9 has been selected as the Cas system. The user has not specified the number of sgRNAs or the specific exons to target. To proceed, we will assume the design of two sgRNAs to ensure effective knockout.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: Sugessted exon/exons: {'Exon/exons': 'Exon 2 or Exon 3', 'Reason': {'Exon 2 and Exon 3 are often targeted in gene editing experiments because they are usually part of the coding sequence and any disruption here can lead to a loss of function mutation. Targeting these exons increases the likelihood of achieving a functional knockout of the CD96 gene.'}}

assistant: 
Based on the information you provided, it may be beneficial to design sgRNAs targeting specific exons within the genes.

Would you like to continue sgRNA design with the exon/exons we suggested?


assistant: Here is the GPT-suggested answer: 

Yes, I would like to continue sgRNA design with the suggested exons.


 Reason: 
The tool suggests targeting exon 2 or exon 3 because these exons are likely to result in a loss of function mutation when disrupted. This makes them good candidates for achieving a functional knockout of the CD96 gene.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: https://crispr-gpt.s3.amazonaws.com/b725b838-d337-4eec-b492-0eeac91b63ca?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=cfPTJyMfqD1z2xx1wkbzYpTlQpc%3D&Expires=1725818714

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence       | PAM Sequence   |   Exon Number |   sgRNA Cut Position (1-based) |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:---------------------|:---------------|--------------:|-------------------------------:|---------------------------:|------------------:|----------------:|
| CD96                 | CRISPRko           | GTTCACCTATGCATGGTCGG | TGG            |             3 |                      111567643 |                     0.9168 |                 5 |               2 |
| CD96                 | CRISPRko           | ACTTACCACCGACCATGCAT | AGG            |             3 |                      111567637 |                     0.7353 |                 1 |               3 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
Input/Output may contain sensitive sequences. This is not supported in Automation mode! Please manually enter your response!

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: yes

assistant: To identify potential off-target sites for your genome editing guides, we recommend you using CRISPRitz (Cancellieri et al.,Bioinformatics,2020), a rapid, high-throughput and variant-aware in silico off-target site identification package.

Please find the github page below:
https://github.com/pinellolab/CRISPRitz

*Please cite the corresponding papers if you decide to use the tool.

Our CRISPR-GPT can run CRISPRitz on our server for you, if you'd like CRISPR-GPT to help you run this step please type “Yes”, otherwise, type “No” if you prefer to run CRISPRitz locally, and we will give you a set of instructions. Would you like CRISPR-GPT to run off-target analysis for you? (Yes/No)


assistant: Here is the GPT-suggested answer: 

Yes


 Reason: 
The inquiry asks if the user would like CRISPR-GPT to run the off-target analysis using CRISPRitz. According to the rules, I should directly answer this question.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: Are you hoping to perform (1). Mismatches-Only search or (2). Mismatches + Bulges search?

assistant: Here is the GPT-suggested answer: 

2. Mismatches + Bulges search


 Reason: 
The user is requesting assistance in designing guide RNAs for knocking out the CD96 gene in humans. The current inquiry is asking about the type of search method they wish to use. Since the user hasn't specified a preference, we need to select one option directly as per the rules.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: 
Please provide the species (human or mouse)
1. human
2. mouse


assistant: Here is the GPT-suggested answer: 

1. human


 Reason: 
The inquiry is asking for the species, and based on the user meta request, the species is human.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: 
Please provide the CAS system (SpCas9 or AsCas12a)
1. SpCas9
2. AsCas12a


assistant: Here is the GPT-suggested answer: 

1. SpCas9


 Reason: 
The user is requesting to design guide RNAs for knocking out the CD96 gene in humans. The first step is to choose the CAS system. Since the inquiry asks for a choice between SpCas9 and AsCas12a, I will provide one of the options.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: 
Please provide the sequence entering guide+PAM for SpCas9 (e.g. TCACCCAGGCTGGAATACAGNNN) or PAM+guide for AsCas12a (e.g. NNNNTCACCCAGGCTGGAATACAG).


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
Input/Output may contain sensitive sequences. This is not supported in Automation mode! Please manually enter your response!

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: GTTCACCTATGCATGGTCGGNNN

assistant: Running CRISPRItz mismatch_bulges with species: human, CAS: SpCas9, sequence: GTTCACCTATGCATGGTCGGNNN. We will send you an email once the result files are ready to be downloaded.

assistant: Finished. Clear the current chat or start a new one.