assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 2

assistant: {'Thoughts': 'The user has chosen Auto-Mode, which implies they are looking for customized guidance on a free-style request related to CRISPR technology. I should now wait for their specific question or request to provide detailed assistance.', 'Choice': '2'}

assistant: Please directly type in your need.

user: Could you help me design Sanger primers for validating my base editing?

assistant: {'Thoughts': 'The user needs to design Sanger primers for validating base editing. This corresponds directly with the task base_editing.StateStep4_5_1_Sanger.', 'Tasks': ['base_editing.StateStep4_5_1_Sanger']}

assistant: To help you design the PCR primers for mutation sequencing by Sanger sequencing, we would need the following information:

- Species: For example: human, mouse.
- Sequence of your target site: Please include 600bp upstream and 600bp downstream of the gRNA.

Please type in the two answers in two lines sequentially. (Press Shift+Enter to type in a new line)


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
The inquiry is asking for specific information about the species and the sequence of the target site, which is necessary for designing Sanger primers.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: human
tgttgttgtttttcttgCTATGAGCATGTACTGGCCTTGGAACAAGAAGACAAGCCAAACATTaaaaaaaaTATGATTTTTAAGGAGATGTTAATAGGTATTGTTACAGGTTATTGGTATTAGTGACCTGATGTGATAAGTGGGGAAGGTCCTATGATATTGGCGGCAGTTGGCCTTGTAATGATGGCTGAAGAATACAGGAGTAAGTGGGTGCTGACAGAGCTGGTGTGCATAAAAGGAGGCCTAGTGGGAGAAGACTGATTCACTTGTTCTGGGTTTGAGCCCTGTAAACTGCTGTAATGAGGCTCTTTGGCTAAGTGGTGGCAGTGGCCAGCTGCAGGAATTGTGTAGGATTGGGAAAATGGGGGTTGCCACCTACAGTGTTTTTGTCGTTGTTGATGTTTATTTCACTCGAGGCCCTTTTTCAGTAAAGTCATCACCTGGCCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAATGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTAATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTAACATAATTGTTTCTCCTTTTTCCTAAGACATCTTTTTAAAATTAAGCGATACTTATTTTATTAGTTTTCTAATAAGCCAACTTGCTAGAATGTGAGATAGTATAAATAATATTGCAGGTTTGAACCTAATAAAAATCTTTAAGCTTGATGTATATATGACTGTGGCTGGTTTAAAATAGATTGGAACTTAACTTTAACTGTTAAAGCGAATCAATAAGTCAGCTCCATGGTGGtataaatttcaaagcgttctcacttgtataatctaatttgcttttcatcactgtgaggtagaaaggataagaacaattattctcatatagatgaagctgaaggtcaaagatattcacatgatctgcAGCTAACCCATTCTATTCAGGATTGTTTAGCAGCTTGATGTTTACATTTGAAAACAGGCATGACAGAAATGTATTCAGAATTGTGAAGGTTATTTACTTTTTAAACATTATATGAAATTGTCTTTCGTATAGGCCTGGTTTTTTAAAATTAAACTAATGAACTCTTATGTCATTTTCTC

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: status: success
result: [{'primer set 1': ['AGGAGGCCTAGTGGGAGAAG', 'CTGAGCCAGAACCTGACGTT'], 'primer set 2': ['GGAGGCCTAGTGGGAGAAGA', 'CTGAGCCAGAACCTGACGTT']}]


assistant: Finished. Clear the current chat or start a new one.