assistant: Welcome to CRISPR-GPT. I can help with the following tasks. Please select 
one to continue.

1. Meta-Mode (Step-by-Step Guidance on Pre-defined Meta-Task)
2. Auto-Mode (Customized Guidance on Free-style User Request)

Note: Chat with ChatGPT augmented with our up-to-date knowledge base 
directly by entering Questions followed by "Q:". For example, "Q: What is 
CRISPR?"


user: 2

assistant: {'Thoughts': 'The user has chosen Auto-Mode, which implies they want customized guidance on a free-style request related to CRISPR technology.', 'Choice': '2'}

assistant: Please directly type in your need.

user: Could you help me design 4 sgRNA knockout human APOE gene within cut position 44908949 to 44909009?

assistant: Warning: Your input contains possible human heritable editing. Please confirm you understand the ethical risk and have read the international guideline https://www.nature.com/articles/d41586-019-00726-5. Type 'yes' to continue.

user: yes

assistant: Please directly type in your need.

assistant: {'Thoughts': 'The user needs to design four sgRNAs for knocking out the human APOE gene within a specific cut position. This task directly corresponds to the guideRNA design for knockout.', 'Tasks': ['knockout.StateStep3']}

assistant: 
Step 3. Designing guideRNA for gene knockout

Next, we would like to guide you through the design of guideRNA for your target gene. Designing an effective and specific single-guide RNA (sgRNA) is crucial for successful CRISPR/Cas9-mediated genome editing.There are several factors to consider in this process, including the selection of target sites that are unique to your gene of interest and minimizing potential off-target effects. 



assistant: 
In order to complete the current task, we would need you to answer the following questions. 

If you are not sure how to select, we recommend you use the Meta-mode where we could generate case-specific guidance based on your needs, please open a new chat and enter meta-mode (select option 1 for the initial prompt).

1. Which Cas system are you planning to use? (We currently support SpCas9, enCas12a, SaCas9, SpRYCas9)


assistant: Here is the GPT-suggested answer: 

SpCas9


 Reason: 
To proceed with the design of sgRNA for the human APOE gene, we need to determine which Cas system the user plans to use. This is crucial because different Cas systems have different PAM sequences and cutting mechanisms, which will influence the design of the sgRNA.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: 

assistant: {'Thoughts': "The user input specifically mentions 'SpCas9.' Given the user's direct reference to SpCas9, it is clear they are interested in this particular Cas system. SpCas9 is widely used due to its high efficiency and extensive research documentation. While it has some drawbacks like potential off-target effects and large protein size, these are not mentioned in the user input, indicating that the user's focus is on the advantages that SpCas9 offers.", 'Answer': 'SpCas9'} Final Result SpCas9

assistant: 
We could help you design the guideRNA sequence based on CRISPick (https://portals.broadinstitute.org/gppx/crispick/public) (Kim et al.,Nat Biotechnol.,2018; DeWeirdt et al.,Nat Biotechnol.,2021; Doench et al.,Nat Biotechnol.,2016; Sanson et al.,Nat Commun, 2018).

Could you please describe what sgRNAs do you need? (For example, you can type in: I hope to design 2 sgRNAs targeting human EGFR; Please give me 1 sgRNA target Exon 1 of mouse Tgfbr1.)

*Please include the target and species information.
*Please cite the corresponding papers if you decide to use the designed sgRNA.


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
The user has requested to design 4 sgRNA sequences to knockout the human APOE gene within the specific cut positions of 44908949 to 44909009 using SpCas9. Given this information, the design will focus on these parameters and the human APOE gene sequence within the specified range.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: Could you help me design 4 sgRNA knockout human APOE gene within cut position 44908949 to 44909009

assistant: Sugessted exon/exons: {'Exon/exons': 'Exon 4', 'Reason': {'The user has provided a specific cut position range (44908949 to 44909009) for the human APOE gene. This range is within exon 4 of the APOE gene. Exon 4 is a commonly targeted exon for knockouts in the APOE gene due to its functional importance in lipid metabolism. Targeting this exon can disrupt the gene function effectively.'}}

assistant: 
Based on the information you provided, it may be beneficial to design sgRNAs targeting specific exons within the genes.

Would you like to continue sgRNA design with the exon/exons we suggested?


assistant: Here is the GPT-suggested answer: 

Yes, continue sgRNA design with exon 4 as suggested.


 Reason: 
The user has requested to design 4 sgRNA knockout targets for the human APOE gene within the specified cut position range of 44908949 to 44909009. The tool suggests targeting exon 4 due to its functional importance.

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: no

assistant: https://crispr-gpt.s3.amazonaws.com/9c7b29b2-b7d3-4325-b2b8-1881c90041fe?AWSAccessKeyId=AKIA6ODU3LTXQWKWTRED&Signature=7b3ZaevfgDismxdX%2FwHQXe573sw%3D&Expires=1725820241

| Target Gene Symbol   | CRISPR Mechanism   | sgRNA Sequence       | PAM Sequence   |   Exon Number |   sgRNA Cut Position (1-based) |   On-Target Efficacy Score |   Off-Target Rank |   Combined Rank |
|:---------------------|:-------------------|:---------------------|:---------------|--------------:|-------------------------------:|---------------------------:|------------------:|----------------:|
| APOE                 | CRISPRko           | CCGGCCAGCCGCTACAGGAG | CGG            |             4 |                       44908963 |                    0.04494 |                33 |              48 |
| APOE                 | CRISPRko           | GCGGCTGCGCGCGCGGATGG | AGG            |             4 |                       44909003 |                    0.2247  |                84 |              75 |
| APOE                 | CRISPRko           | GCCTGGGCCCGCTCCTGTAG | CGG            |             4 |                       44908960 |                   -0.1001  |                72 |              96 |
| APOE                 | CRISPRko           | CCTGGCCGGCCAGCCGCTAC | AGG            |             4 |                       44908958 |                   -0.6887  |                37 |             115 |

assistant: 
Would you like to use CRISPRitz to predict sgRNA off-target effects?


assistant: Here is the GPT-suggested answer: 

I don't know


 Reason: 
Input/Output may contain sensitive sequences. This is not supported in Automation mode! Please manually enter your response!

assistant: Press Enter to continue with the generated answer. Enter other text to correct answer

user: no

assistant: Finished. Clear the current chat or start a new one.