phenotype gene additive pvalue additive beta recessive pvalue recessive beta rsid chrom pos ref alt INFO AF AC_Hom AN grch37_locus variant variant category ClinVar: Category ClinVar: Clinical significance ClinVar: Review Category Mode of inheritance (OMIM) Intestinal infectious diseases FUT2 4.014e-09 -0.069 rs601338 19 48703417 G A 0.997446 0.374424 51810 367388 19:49206674 19:48703417:G:A pLoF association Benign, association no_Criteria recessive Other infectious diseases LRRC63 1.75e-08 0.743 2.823e-05 2.531 rs41284167 13 46266861 A C 0.994734 0.0373883 566 367388 13:46840996 13:46266861:A:C missense_variant "" "" "" unknown Other infectious diseases FAM206BP 1.76e-08 0.7428 2.516e-05 2.579 rs17067933 13 46270492 C A 0.994729 0.03741 556 367388 13:46844627 13:46270492:C:A missense_variant "" "" "" unknown Hernia of abodminal wall LRRK1 4.22e-09 0.6911 rs41531245 15 101029169 C T 0.975161 0.00764042 8 367388 15:101569374 15:101029169:C:T missense_variant "" "" "" unknown Alzheimer's disease (Atypical or mixed) APOE 1.1e-31 1.075 3.717e-12 1.254 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease (Atypical or mixed) (more controls excluded) APOE 7.98e-36 1.1903 1.029e-13 1.421 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease (Early onset) APOE 6.53e-59 1.6616 2.083e-43 3.064 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease (Early onset) (more controls excluded) APOE 9.56e-08 0.3875 2.771e-07 0.237 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Alzheimer's disease (Early onset) (more controls excluded) APOE 6.61e-63 1.7542 2.484e-45 3.171 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease (Late onset) ZNF155 5.48e-09 0.5757 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Alzheimer's disease (Late onset) ZNF230 2.38e-09 0.6139 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Alzheimer's disease (Late onset) ZNF225 1.47e-09 0.6066 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Alzheimer's disease (Late onset) ZNF227 1.35e-09 0.6053 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Alzheimer's disease (Late onset) ZNF229 7.8e-10 0.6367 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Alzheimer's disease (Late onset) APOE 1.96e-18 0.3325 1.628e-15 0.192 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Alzheimer's disease (Late onset) APOE 2.46e-11 1.4961 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Alzheimer's disease (Late onset) APOE 7.19e-173 1.4076 1.114e-87 1.848 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease (Late onset) APOE 1.04e-11 -0.5206 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Alzheimer's disease (Late onset) CLPTM1 7.97e-09 0.2994 2.415e-09 0.171 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Alzheimer's disease (Late onset) PPP1R37 3.27e-12 0.5349 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Alzheimer's disease (Late onset) EXOC3L2 1.04e-13 0.4474 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Alzheimer's disease (Late onset) DMPK 9.41e-09 0.6596 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Alzheimer's disease (Late onset) (more controls excluded) ZNF155 1.04e-10 0.692 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) ZNF230 1.94e-10 0.6999 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) ZNF225 6.83e-11 0.7006 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) ZNF227 8.96e-11 0.6916 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) ZNF229 6.18e-11 0.7217 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) APOE 1.84e-18 0.3603 1.795e-16 0.213 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Alzheimer's disease (Late onset) (more controls excluded) APOE 2.31e-10 1.3935 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Alzheimer's disease (Late onset) (more controls excluded) APOE 1.42e-171 1.4345 2.701e-87 1.744 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease (Late onset) (more controls excluded) APOE 7.07e-13 -0.5918 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Alzheimer's disease (Late onset) (more controls excluded) CLPTM1 4.91e-09 0.3253 1.969e-09 0.185 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) PPP1R37 9.16e-13 0.5799 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) EXOC3L2 4.71e-13 0.4597 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) DMPK 3.2e-09 0.7196 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Alzheimer's disease (undefined) APOE 2.05e-19 1.7794 3.898e-10 2.678 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease (undefined) (more controls excluded) APOE 8.73e-20 1.8089 7.593e-10 2.448 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Mental and behavioural disorders due to alcohol, excluding acute intoxication ADH1B 3.48e-08 0.768 3.442e-08 0.385 rs1229984 4 99318162 T C 0.976798 0.99414 363100 367388 4:100239319 4:99318162:T:C missense_variant "" "" "" unknown Alcoholic liver disease PNPLA3 4.49e-12 0.3716 2.118e-07 0.388 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Alcoholic liver disease SAMM50 2.27e-10 0.339 1.688e-07 0.392 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown Acohol-induced acute pancreatitis SPINK1 5.18e-09 2.1444 rs17107315 5 147828115 T C 0.9984 0.0162226 122 367388 5:147207678 5:147828115:T:C missense_variant risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter both Alcohol-induced chronic pancreatitis SPINK1 2.67e-09 1.4054 rs17107315 5 147828115 T C 0.9984 0.0162226 122 367388 5:147207678 5:147828115:T:C missense_variant risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter both Childhood asthma (age<16) IL1RL1 9.5e-08 -0.2183 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Childhood asthma (age<16) GSDMA 1.57e-09 -0.2131 0.001305 -0.124 rs7212944 17 39966433 G A 0.990309 0.325506 38980 367388 17:38122686 17:39966433:G:A missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) IL1RL1 8.59e-08 -0.2187 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) GSDMA 1.45e-09 -0.2132 0.001266 -0.124 rs7212944 17 39966433 G A 0.990309 0.325506 38980 367388 17:38122686 17:39966433:G:A missense_variant "" "" "" unknown Asthma, hospital admissions , main diagnosis only BCL2L11 3.32e-09 0.1281 1.088e-05 0.197 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma, hospital admissions , main diagnosis only IL4R 4.28e-11 -0.1649 rs144651842 16 27344903 G A 0.989332 0.0774985 2290 367388 16:27356224 16:27344903:G:A missense_variant "" "" "" dominant Asthma, hospital admissions , main diagnosis only GSDMB 2.08e-12 -0.0936 0.0002163 -0.04 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Asthma, hospital admissions , main diagnosis only GSDMB 2.6e-12 -0.0932 0.0001719 -0.041 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Asthma (mode) IL1RL1 3.55e-08 -0.0893 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Asthma (mode) BCL2L11 2.49e-10 0.1347 2.884e-06 0.205 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma (mode) SLC22A4 1.44e-11 -0.0954 3.259e-07 -0.08 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Asthma (mode) IL13 1.83e-08 -0.0764 1.351e-07 -0.05 rs20541 5 132660272 A G 0.997119 0.631752 146944 367388 5:131995964 5:132660272:A:G missense_variant risk factor risk factor no_Criteria dominant Asthma (mode) IL4R 6.04e-11 -0.1613 rs144651842 16 27344903 G A 0.989332 0.0774985 2290 367388 16:27356224 16:27344903:G:A missense_variant "" "" "" dominant Asthma (mode) GSDMB 1.01e-11 -0.0892 0.001275 -0.034 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Asthma (mode) GSDMB 1.16e-11 -0.0889 0.001035 -0.035 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Asthma, unspecified (mode) BCL2L11 5.51e-09 0.1703 6.578e-07 0.304 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma, unspecified (mode) (more controls excluded) BCL2L11 3.01e-09 0.174 2.506e-07 0.319 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Atopic dermatitis, strict definition FLG 1.46e-14 1.1538 0.000112 8.176 rs138726443 1 152307547 G A 0.989584 0.00736551 16 367388 1:152280023 1:152307547:G:A LC (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Atopic dermatitis, strict definition FLG 2.52e-22 1.1036 0.000612 2.193 rs138381300 1 152312600 CACTG C 0.906426 0.0134898 86 367388 1:152285076 1:152312600:CACTG:C LC Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Atopic dermatitis, strict definition FLG 1.3e-10 1.6454 rs61816761 1 152313385 G A 0.949337 0.00285801 0 367388 1:152285861 1:152313385:G:A LC (likely)Pathogenic Pathogenic/Likely pathogenic Criteria_multSubmitter dominant Atopic dermatitis, strict definition RTEL1-TNFRSF6B 4.19e-11 0.1764 4.665e-09 0.098 rs41309367 20 63678201 C T 0.995562 0.735231 199070 367388 20:62309554 20:63678201:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Atopic dermatitis, strict definition RTEL1-TNFRSF6B 3.36e-10 0.1872 1.068e-08 0.1 rs2236506 20 63690302 G A 0.993536 0.804966 238564 367388 20:62321655 20:63690302:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Atopic dermatitis, strict definition RTEL1 3.28e-10 0.1852 1.634e-09 0.105 rs3208008 20 63694757 A C 0.99444 0.799357 235198 367388 20:62326110 20:63694757:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Atopic dermatitis, strict definition RTEL1-TNFRSF6B 3.17e-10 -0.1855 0.0005418 -0.147 rs2257440 20 63696914 C T 0.993832 0.200586 15238 367388 20:62328267 20:63696914:C:T missense_variant "" "" "" unknown Atopic dermatitis, strict definition ARFRP1 3.86e-10 0.1847 1.878e-09 0.104 rs367993153 20 63701286 A AC 0.994044 0.800462 235864 367388 20:62332638 20:63701286:A:AC pLoF "" "" "" unknown Atopic dermatitis, strict definition SLC2A4RG 1.69e-10 0.1767 7.996e-10 0.103 rs8957 20 63742354 G T 0.999204 0.761252 213182 367388 20:62373707 20:63742354:G:T missense_variant "" "" "" unknown Atopic dermatitis, strict definition with reimbursement FLG 1.87e-14 1.1204 0.000157 7.37 rs138726443 1 152307547 G A 0.989584 0.00736551 16 367388 1:152280023 1:152307547:G:A LC (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Atopic dermatitis, strict definition with reimbursement FLG 8.09e-22 1.0643 0.0006456 2.159 rs138381300 1 152312600 CACTG C 0.906426 0.0134898 86 367388 1:152285076 1:152312600:CACTG:C LC Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Atopic dermatitis, strict definition with reimbursement FLG 4.22e-10 1.5424 rs61816761 1 152313385 G A 0.949337 0.00285801 0 367388 1:152285861 1:152313385:G:A LC (likely)Pathogenic Pathogenic/Likely pathogenic Criteria_multSubmitter dominant Atopic dermatitis, strict definition with reimbursement RTEL1-TNFRSF6B 8.77e-11 0.1699 1.531e-08 0.092 rs41309367 20 63678201 C T 0.995562 0.735231 199070 367388 20:62309554 20:63678201:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Atopic dermatitis, strict definition with reimbursement RTEL1-TNFRSF6B 1.09e-10 0.1887 3.817e-09 0.101 rs2236506 20 63690302 G A 0.993536 0.804966 238564 367388 20:62321655 20:63690302:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Atopic dermatitis, strict definition with reimbursement RTEL1 6.16e-11 0.1891 3.535e-10 0.107 rs3208008 20 63694757 A C 0.99444 0.799357 235198 367388 20:62326110 20:63694757:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Atopic dermatitis, strict definition with reimbursement RTEL1-TNFRSF6B 6.01e-11 -0.1893 0.0003145 -0.15 rs2257440 20 63696914 C T 0.993832 0.200586 15238 367388 20:62328267 20:63696914:C:T missense_variant "" "" "" unknown Atopic dermatitis, strict definition with reimbursement ARFRP1 8.23e-11 0.1881 4.598e-10 0.106 rs367993153 20 63701286 A AC 0.994044 0.800462 235864 367388 20:62332638 20:63701286:A:AC pLoF "" "" "" unknown Atopic dermatitis, strict definition with reimbursement SLC2A4RG 4.69e-10 0.1688 4.708e-09 0.096 rs8957 20 63742354 G T 0.999204 0.761252 213182 367388 20:62373707 20:63742354:G:T missense_variant "" "" "" unknown Other specified/unspecified bacterial intestinal infections UMODL1-AS1 6.5e-08 1.238 rs12482506 21 42103744 G C 0.976883 0.0177605 114 367388 21:43523854 21:42103744:G:C missense_variant "" "" "" unknown Malignant neoplasm of breast KCNU1 1.72e-09 -0.1784 0.000442 -0.188 rs16885577 8 36930961 A G 0.999761 0.133026 6628 367388 8:36788479 8:36930961:A:G missense_variant "" "" "" unknown Malignant neoplasm of breast PALB2 5.97e-20 3.0311 rs180177102 16 23634953 CA C 0.914047 0.00139362 0 367388 16:23646274 16:23634953:CA:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Malignant neoplasm of breast CHEK2 2e-20 1.1704 0.000283 3.521 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Malignant neoplasm of breast (other cancers excluded from controls) KCNU1 7.52e-09 -0.1738 0.0003156 -0.196 rs16885577 8 36930961 A G 0.999761 0.133026 6628 367388 8:36788479 8:36930961:A:G missense_variant "" "" "" unknown Malignant neoplasm of breast (other cancers excluded from controls) PALB2 4.89e-21 3.1716 rs180177102 16 23634953 CA C 0.914047 0.00139362 0 367388 16:23646274 16:23634953:CA:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Malignant neoplasm of breast (other cancers excluded from controls) CHEK2 1.85e-21 1.2242 4.091e-05 5.126 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Malignant neoplasm SPDL1 4.1e-09 -0.1637 rs116483731 5 169588475 G A 0.99787 0.0301289 382 367388 5:169015479 5:169588475:G:A missense_variant "" "" "" unknown Malignant neoplasm ATM 2.58e-08 0.2777 rs1800057 11 108272729 C G 0.996379 0.00906671 36 367388 11:108143456 11:108272729:C:G missense_variant (likely)Benign Benign Criteria_multSubmitter both Malignant neoplasm KDELC2 4.93e-08 0.2797 rs74911261 11 108486410 G A 0.984613 0.00871014 34 367388 11:108357137 11:108486410:G:A missense_variant "" "" "" unknown Malignant neoplasm PALB2 1.09e-14 1.0955 rs180177102 16 23634953 CA C 0.914047 0.00139362 0 367388 16:23646274 16:23634953:CA:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Malignant neoplasm HOXB13 5.49e-12 0.3796 rs138213197 17 48728343 C T 0.99205 0.00755332 28 367388 17:46805705 17:48728343:C:T missense_variant risk factor Pathogenic/Likely pathogenic, risk factor Criteria_multSubmitter unknown Malignant neoplasm ABI3 3.11e-08 0.379 rs755071175 17 49210775 G T 0.971573 0.00491306 10 367388 17:47288137 17:49210775:G:T missense_variant "" "" "" unknown Malignant neoplasm CHEK2 8.74e-17 0.4779 1.047e-06 1.878 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Malignant neoplasm of liver and intrahepatic bile ducts (other cancers excluded from controls) TM6SF2 1.19e-09 1.4501 3.76e-09 5.564 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Malignant neoplasm of liver and intrahepatic bile ducts TM6SF2 1.17e-09 1.3742 4.115e-09 5.64 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Malignant neoplasm of liver and intrahepatic bile ducts (other cancers excluded from controls) TM6SF2 2.15e-09 1.3376 8.393e-09 5.081 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown malignant neoplasm of male genital organs ANO7 2.15e-08 -0.2866 rs77482050 2 241200185 G A 0.998922 0.0555897 1148 367388 2:242139600 2:241200185:G:A missense_variant "" "" "" unknown malignant neoplasm of male genital organs WNT9B 1.22e-09 0.4831 rs118185468 17 46872579 A G 0.989821 0.0219114 216 367388 17:44949945 17:46872579:A:G missense_variant "" "" "" unknown malignant neoplasm of male genital organs CDK5RAP3 1.97e-17 1.2744 0.0007378 3.316 rs191902054 17 47971193 G A 0.995817 0.00630668 30 367388 17:46048559 17:47971193:G:A missense_variant "" "" "" unknown malignant neoplasm of male genital organs CDK5RAP3 2.06e-17 1.2731 0.0007378 3.316 rs61758369 17 47981246 A G 0.996049 0.00631757 28 367388 17:46058612 17:47981246:A:G missense_variant "" "" "" unknown malignant neoplasm of male genital organs HOXB13 1.2e-62 2.4038 3.789e-05 4.321 rs138213197 17 48728343 C T 0.99205 0.00755332 28 367388 17:46805705 17:48728343:C:T missense_variant risk factor Pathogenic/Likely pathogenic, risk factor Criteria_multSubmitter unknown malignant neoplasm of male genital organs ABI3 3.09e-25 1.776 rs755071175 17 49210775 G T 0.971573 0.00491306 10 367388 17:47288137 17:49210775:G:T missense_variant "" "" "" unknown malignant neoplasm of male genital organs KLK3 8e-12 -0.3108 0.0001635 -0.447 rs17632542 19 50858501 T C 0.998998 0.0671307 1736 367388 19:51361757 19:50858501:T:C missense_variant "" "" "" unknown malignant neoplasm of male genital organs (other cancers excluded from controls) ANO7 8.36e-09 -0.3018 rs77482050 2 241200185 G A 0.998922 0.0555897 1148 367388 2:242139600 2:241200185:G:A missense_variant "" "" "" unknown malignant neoplasm of male genital organs (other cancers excluded from controls) WNT9B 1.69e-10 0.5215 rs118185468 17 46872579 A G 0.989821 0.0219114 216 367388 17:44949945 17:46872579:A:G missense_variant "" "" "" unknown malignant neoplasm of male genital organs (other cancers excluded from controls) CDK5RAP3 1.8e-16 1.2233 0.001194 2.782 rs191902054 17 47971193 G A 0.995817 0.00630668 30 367388 17:46048559 17:47971193:G:A missense_variant "" "" "" unknown malignant neoplasm of male genital organs (other cancers excluded from controls) CDK5RAP3 1.88e-16 1.2221 0.001194 2.782 rs61758369 17 47981246 A G 0.996049 0.00631757 28 367388 17:46058612 17:47981246:A:G missense_variant "" "" "" unknown malignant neoplasm of male genital organs (other cancers excluded from controls) HOXB13 1.04e-59 2.279 5.802e-05 3.79 rs138213197 17 48728343 C T 0.99205 0.00755332 28 367388 17:46805705 17:48728343:C:T missense_variant risk factor Pathogenic/Likely pathogenic, risk factor Criteria_multSubmitter unknown malignant neoplasm of male genital organs (other cancers excluded from controls) ABI3 1.96e-26 1.8469 rs755071175 17 49210775 G T 0.971573 0.00491306 10 367388 17:47288137 17:49210775:G:T missense_variant "" "" "" unknown malignant neoplasm of male genital organs (other cancers excluded from controls) KLK3 5.43e-12 -0.3217 0.0001412 -0.467 rs17632542 19 50858501 T C 0.998998 0.0671307 1736 367388 19:51361757 19:50858501:T:C missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) ZBTB7B 4.74e-07 0.1688 rs141845046 1 155015228 C T 0.989686 0.0698254 1922 367388 1:154987704 1:155015228:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) CASP8 1.45e-11 -0.121 2.331e-09 -0.073 rs3769823 2 201258272 A G 0.994704 0.653968 156938 367388 2:202122995 2:201258272:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Other malignant neoplasms of skin (=non-melanoma skin cancer) SLC45A2 1.3e-07 0.3554 5.965e-08 0.185 rs16891982 5 33951588 C G 0.970832 0.981279 353786 367388 5:33951693 5:33951588:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) RP11-145E5.5 6.9e-10 -0.1047 0.0005201 -0.048 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) XPA 8e-11 1.2382 rs104894132 9 97675579 G A 0.992244 0.00234902 0 367388 9:100437861 9:97675579:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) TYR 1.94e-15 0.1774 2.865e-05 0.141 rs1126809 11 89284793 G A 0.998018 0.178944 11978 367388 11:89017961 11:89284793:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl both Other malignant neoplasms of skin (=non-melanoma skin cancer) KRT5 1.51e-12 0.205 0.0009264 0.206 rs11170164 12 52519884 C T 0.997728 0.0966417 3400 367388 12:52913668 12:52519884:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Other malignant neoplasms of skin (=non-melanoma skin cancer) OCA2 4.05e-35 0.5307 4.879e-10 0.875 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) GOLGA8M 1.43e-12 0.2171 0.0002016 0.259 rs531763484 15 28702279 G A 0.96956 0.0889359 3026 367388 15:28947425 15:28702279:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) GOLGA8M 5.22e-12 0.2069 0.0002193 0.246 rs78557271 15 28702280 A G 0.96098 0.0930814 3298 367388 15:28947426 15:28702280:A:G missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) GOLGA8M 3.31e-12 0.2097 0.000219 0.248 rs2003233 15 28702528 G A 0.964317 0.0925561 3288 367388 15:28947674 15:28702528:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) GOLGA8M 1.42e-10 0.2003 0.0008683 0.242 rs200180898 15 28705604 T C 0.945257 0.0893878 3032 367388 15:28950750 15:28705604:T:C missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) GOLGA8M 2.11e-12 0.2117 7.718e-05 0.267 rs28623038 15 28708257 G A 0.975447 0.0913095 3216 367388 15:28953403 15:28708257:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) GOLGA8M 2.11e-12 0.2117 7.731e-05 0.267 rs28418661 15 28708266 C T 0.975453 0.0913122 3216 367388 15:28953412 15:28708266:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) RPL13 2.25e-14 -0.169 5.482e-05 -0.134 rs9930567 16 89561665 G A 0.984746 0.187184 12852 367388 16:89628073 16:89561665:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) SPATA33 1.9e-14 0.2034 6.546e-05 0.205 rs35415928 16 89657860 C T 0.996679 0.117334 5112 367388 16:89724268 16:89657860:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) FANCA 7.19e-08 0.194 rs9282681 16 89739506 T C 0.999504 0.0598441 1394 367388 16:89805914 16:89739506:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) FANCA 9.21e-08 0.1923 rs11076619 16 89764835 C A 0.999031 0.0598985 1402 367388 16:89831243 16:89764835:C:A missense_variant "" "" "" recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) FANCA 8.67e-08 0.1939 0.009103 0.253 rs11646374 16 89791527 G A 0.997773 0.0591718 1362 367388 16:89857935 16:89791527:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) FANCA 1.3e-12 0.2175 7.213e-05 0.275 rs1800282 16 89816599 A T 0.980732 0.0843686 2698 367388 16:89883007 16:89816599:A:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) MC1R 3.89e-34 0.4261 1.106e-10 0.618 rs1805007 16 89919709 C T 0.989317 0.0670055 1688 367388 16:89986117 16:89919709:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) MC1R 1.39e-21 0.3234 3.459e-06 0.403 rs1805008 16 89919736 C T 0.995937 0.0685896 1760 367388 16:89986144 16:89919736:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) TUBB3 3.78e-16 0.2525 8.743e-06 0.324 rs77681059 16 89933636 C T 0.995589 0.0827381 2522 367388 16:90000044 16:89933636:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other malignant neoplasms of skin (=non-melanoma skin cancer) CENPBD1 6.85e-10 -0.1254 4.305e-07 -0.062 rs4785755 16 89971420 G A 0.998123 0.775738 221298 367388 16:90037828 16:89971420:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) GAS8-AS1 2.04e-14 -0.145 7.624e-08 -0.12 rs3785183 16 90029153 C T 0.99771 0.285105 30254 367388 16:90095561 16:90029153:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) PRDM7 3.59e-15 0.2596 0.002846 0.243 rs150196149 16 90060585 A G 0.982595 0.0728467 1960 367388 16:90126993 16:90060585:A:G missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) TMEM102 3.25e-08 0.5429 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) TGM3 1.93e-10 -0.1519 4.269e-09 -0.079 rs214803 20 2309687 C A 0.999888 0.853528 268116 367388 20:2290333 20:2309687:C:A missense_variant "" "" "" recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) ZBTB7B 6.82e-07 0.169 rs141845046 1 155015228 C T 0.989686 0.0698254 1922 367388 1:154987704 1:155015228:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) CASP8 7.66e-12 -0.1248 1.618e-09 -0.075 rs3769823 2 201258272 A G 0.994704 0.653968 156938 367388 2:202122995 2:201258272:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) XPA 1.29e-09 1.1198 rs104894132 9 97675579 G A 0.992244 0.00234902 0 367388 9:100437861 9:97675579:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) TYR 2.08e-14 0.1733 3.745e-05 0.141 rs1126809 11 89284793 G A 0.998018 0.178944 11978 367388 11:89017961 11:89284793:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl both Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) KRT5 6.09e-12 0.2021 0.001096 0.206 rs11170164 12 52519884 C T 0.997728 0.0966417 3400 367388 12:52913668 12:52519884:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) OCA2 2.78e-32 0.5082 2.547e-09 0.812 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) GOLGA8M 2.86e-12 0.217 0.0004502 0.245 rs531763484 15 28702279 G A 0.96956 0.0889359 3026 367388 15:28947425 15:28702279:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) GOLGA8M 1.05e-11 0.2069 0.0002423 0.248 rs78557271 15 28702280 A G 0.96098 0.0930814 3298 367388 15:28947426 15:28702280:A:G missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) GOLGA8M 7.2e-12 0.2093 0.0002994 0.244 rs2003233 15 28702528 G A 0.964317 0.0925561 3288 367388 15:28947674 15:28702528:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) GOLGA8M 2.39e-10 0.2008 0.001176 0.239 rs200180898 15 28705604 T C 0.945257 0.0893878 3032 367388 15:28950750 15:28705604:T:C missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) GOLGA8M 4.43e-12 0.2116 0.0001106 0.263 rs28623038 15 28708257 G A 0.975447 0.0913095 3216 367388 15:28953403 15:28708257:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) GOLGA8M 4.44e-12 0.2116 0.0001108 0.263 rs28418661 15 28708266 C T 0.975453 0.0913122 3216 367388 15:28953412 15:28708266:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) RPL13 5.62e-14 -0.1693 1.939e-05 -0.144 rs9930567 16 89561665 G A 0.984746 0.187184 12852 367388 16:89628073 16:89561665:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) SPATA33 5.49e-13 0.1937 0.00027 0.187 rs35415928 16 89657860 C T 0.996679 0.117334 5112 367388 16:89724268 16:89657860:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) FANCA 6.99e-08 0.1975 0.008688 0.257 rs9282681 16 89739506 T C 0.999504 0.0598441 1394 367388 16:89805914 16:89739506:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) FANCA 8.81e-08 0.1958 0.008517 0.257 rs11076619 16 89764835 C A 0.999031 0.0598985 1402 367388 16:89831243 16:89764835:C:A missense_variant "" "" "" recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) FANCA 9.86e-08 0.1962 0.008442 0.261 rs11646374 16 89791527 G A 0.997773 0.0591718 1362 367388 16:89857935 16:89791527:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) FANCA 1.04e-12 0.2221 0.0001366 0.265 rs1800282 16 89816599 A T 0.980732 0.0843686 2698 367388 16:89883007 16:89816599:A:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) MC1R 1.1e-30 0.404 1.904e-09 0.556 rs1805007 16 89919709 C T 0.989317 0.0670055 1688 367388 16:89986117 16:89919709:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) MC1R 1.32e-21 0.3284 5.746e-06 0.393 rs1805008 16 89919736 C T 0.995937 0.0685896 1760 367388 16:89986144 16:89919736:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) TUBB3 2.79e-16 0.2577 1.528e-05 0.316 rs77681059 16 89933636 C T 0.995589 0.0827381 2522 367388 16:90000044 16:89933636:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) CENPBD1 2.03e-10 -0.1316 1.544e-07 -0.066 rs4785755 16 89971420 G A 0.998123 0.775738 221298 367388 16:90037828 16:89971420:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) GAS8-AS1 1.58e-13 -0.1426 2.07e-07 -0.118 rs3785183 16 90029153 C T 0.99771 0.285105 30254 367388 16:90095561 16:90029153:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) PRDM7 2.74e-15 0.2652 0.001982 0.257 rs150196149 16 90060585 A G 0.982595 0.0728467 1960 367388 16:90126993 16:90060585:A:G missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) TMEM102 4.05e-09 0.5943 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) TGM3 1.75e-10 -0.1549 3.508e-09 -0.081 rs214803 20 2309687 C A 0.999888 0.853528 268116 367388 20:2290333 20:2309687:C:A missense_variant "" "" "" recessive Malignant neoplasm of prostate ANO7 5.59e-09 -0.3064 rs77482050 2 241200185 G A 0.998922 0.0555897 1148 367388 2:242139600 2:241200185:G:A missense_variant "" "" "" unknown Malignant neoplasm of prostate WNT9B 5.69e-10 0.5051 rs118185468 17 46872579 A G 0.989821 0.0219114 216 367388 17:44949945 17:46872579:A:G missense_variant "" "" "" unknown Malignant neoplasm of prostate CDK5RAP3 1.93e-18 1.3464 0.000563 3.415 rs191902054 17 47971193 G A 0.995817 0.00630668 30 367388 17:46048559 17:47971193:G:A missense_variant "" "" "" unknown Malignant neoplasm of prostate CDK5RAP3 2.01e-18 1.3453 0.000563 3.415 rs61758369 17 47981246 A G 0.996049 0.00631757 28 367388 17:46058612 17:47981246:A:G missense_variant "" "" "" unknown Malignant neoplasm of prostate HOXB13 2.93e-64 2.4873 2.531e-05 4.526 rs138213197 17 48728343 C T 0.99205 0.00755332 28 367388 17:46805705 17:48728343:C:T missense_variant risk factor Pathogenic/Likely pathogenic, risk factor Criteria_multSubmitter unknown Malignant neoplasm of prostate ABI3 2.42e-26 1.8576 rs755071175 17 49210775 G T 0.971573 0.00491306 10 367388 17:47288137 17:49210775:G:T missense_variant "" "" "" unknown Malignant neoplasm of prostate KLK3 9.7e-12 -0.3174 0.0002553 -0.443 rs17632542 19 50858501 T C 0.998998 0.0671307 1736 367388 19:51361757 19:50858501:T:C missense_variant "" "" "" unknown Malignant neoplasm of prostate (other cancers excluded from controls) ANO7 1.72e-09 -0.3251 rs77482050 2 241200185 G A 0.998922 0.0555897 1148 367388 2:242139600 2:241200185:G:A missense_variant "" "" "" unknown Malignant neoplasm of prostate (other cancers excluded from controls) WNT9B 5.68e-11 0.5506 rs118185468 17 46872579 A G 0.989821 0.0219114 216 367388 17:44949945 17:46872579:A:G missense_variant "" "" "" unknown Malignant neoplasm of prostate (other cancers excluded from controls) CDK5RAP3 2.25e-17 1.2907 0.0009319 2.838 rs191902054 17 47971193 G A 0.995817 0.00630668 30 367388 17:46048559 17:47971193:G:A missense_variant "" "" "" unknown Malignant neoplasm of prostate (other cancers excluded from controls) CDK5RAP3 2.34e-17 1.2896 0.0009319 2.838 rs61758369 17 47981246 A G 0.996049 0.00631757 28 367388 17:46058612 17:47981246:A:G missense_variant "" "" "" unknown Malignant neoplasm of prostate (other cancers excluded from controls) HOXB13 4.4e-61 2.3515 3.891e-05 3.936 rs138213197 17 48728343 C T 0.99205 0.00755332 28 367388 17:46805705 17:48728343:C:T missense_variant risk factor Pathogenic/Likely pathogenic, risk factor Criteria_multSubmitter unknown Malignant neoplasm of prostate (other cancers excluded from controls) ABI3 1.61e-27 1.9285 rs755071175 17 49210775 G T 0.971573 0.00491306 10 367388 17:47288137 17:49210775:G:T missense_variant "" "" "" unknown Malignant neoplasm of prostate (other cancers excluded from controls) KLK3 4.28e-12 -0.3328 0.0002132 -0.466 rs17632542 19 50858501 T C 0.998998 0.0671307 1736 367388 19:51361757 19:50858501:T:C missense_variant "" "" "" unknown Malignant neoplasm of skin ZBTB7B 4.25e-07 0.1695 rs141845046 1 155015228 C T 0.989686 0.0698254 1922 367388 1:154987704 1:155015228:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin CASP8 1.54e-11 -0.1208 2.413e-09 -0.073 rs3769823 2 201258272 A G 0.994704 0.653968 156938 367388 2:202122995 2:201258272:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Malignant neoplasm of skin SLC45A2 1.28e-07 0.3556 5.865e-08 0.185 rs16891982 5 33951588 C G 0.970832 0.981279 353786 367388 5:33951693 5:33951588:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Malignant neoplasm of skin RP11-145E5.5 7.62e-10 -0.1044 0.0005465 -0.048 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin XPA 8.01e-11 1.2382 rs104894132 9 97675579 G A 0.992244 0.00234902 0 367388 9:100437861 9:97675579:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Malignant neoplasm of skin TYR 2.19e-15 0.177 2.924e-05 0.141 rs1126809 11 89284793 G A 0.998018 0.178944 11978 367388 11:89017961 11:89284793:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl both Malignant neoplasm of skin KRT5 1.34e-12 0.2055 0.0009396 0.206 rs11170164 12 52519884 C T 0.997728 0.0966417 3400 367388 12:52913668 12:52519884:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Malignant neoplasm of skin OCA2 4.52e-35 0.5302 4.946e-10 0.874 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Malignant neoplasm of skin GOLGA8M 1.56e-12 0.2167 0.0002042 0.259 rs531763484 15 28702279 G A 0.96956 0.0889359 3026 367388 15:28947425 15:28702279:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin GOLGA8M 5.72e-12 0.2065 0.0002221 0.246 rs78557271 15 28702280 A G 0.96098 0.0930814 3298 367388 15:28947426 15:28702280:A:G missense_variant "" "" "" unknown Malignant neoplasm of skin GOLGA8M 3.63e-12 0.2092 0.0002217 0.247 rs2003233 15 28702528 G A 0.964317 0.0925561 3288 367388 15:28947674 15:28702528:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin GOLGA8M 1.55e-10 0.1999 0.000878 0.242 rs200180898 15 28705604 T C 0.945257 0.0893878 3032 367388 15:28950750 15:28705604:T:C missense_variant "" "" "" unknown Malignant neoplasm of skin GOLGA8M 2.31e-12 0.2113 7.818e-05 0.266 rs28623038 15 28708257 G A 0.975447 0.0913095 3216 367388 15:28953403 15:28708257:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin GOLGA8M 2.31e-12 0.2113 7.831e-05 0.266 rs28418661 15 28708266 C T 0.975453 0.0913122 3216 367388 15:28953412 15:28708266:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin RPL13 2.37e-14 -0.1689 5.395e-05 -0.134 rs9930567 16 89561665 G A 0.984746 0.187184 12852 367388 16:89628073 16:89561665:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin SPATA33 1.74e-14 0.2037 6.617e-05 0.205 rs35415928 16 89657860 C T 0.996679 0.117334 5112 367388 16:89724268 16:89657860:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin FANCA 7.53e-08 0.1936 rs9282681 16 89739506 T C 0.999504 0.0598441 1394 367388 16:89805914 16:89739506:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Malignant neoplasm of skin FANCA 9.65e-08 0.1919 rs11076619 16 89764835 C A 0.999031 0.0598985 1402 367388 16:89831243 16:89764835:C:A missense_variant "" "" "" recessive Malignant neoplasm of skin FANCA 9.07e-08 0.1935 0.00916 0.253 rs11646374 16 89791527 G A 0.997773 0.0591718 1362 367388 16:89857935 16:89791527:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Malignant neoplasm of skin FANCA 1.39e-12 0.2172 7.252e-05 0.275 rs1800282 16 89816599 A T 0.980732 0.0843686 2698 367388 16:89883007 16:89816599:A:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Malignant neoplasm of skin MC1R 3.02e-34 0.4268 1.121e-10 0.618 rs1805007 16 89919709 C T 0.989317 0.0670055 1688 367388 16:89986117 16:89919709:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Malignant neoplasm of skin MC1R 1.5e-21 0.323 3.48e-06 0.402 rs1805008 16 89919736 C T 0.995937 0.0685896 1760 367388 16:89986144 16:89919736:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Malignant neoplasm of skin TUBB3 4.07e-16 0.2522 8.804e-06 0.324 rs77681059 16 89933636 C T 0.995589 0.0827381 2522 367388 16:90000044 16:89933636:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Malignant neoplasm of skin CENPBD1 7.61e-10 -0.1251 4.729e-07 -0.062 rs4785755 16 89971420 G A 0.998123 0.775738 221298 367388 16:90037828 16:89971420:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin GAS8-AS1 2.02e-14 -0.145 7.392e-08 -0.12 rs3785183 16 90029153 C T 0.99771 0.285105 30254 367388 16:90095561 16:90029153:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin PRDM7 3.84e-15 0.2593 0.002868 0.242 rs150196149 16 90060585 A G 0.982595 0.0728467 1960 367388 16:90126993 16:90060585:A:G missense_variant "" "" "" unknown Malignant neoplasm of skin TMEM102 3.33e-08 0.5424 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin TGM3 2.12e-10 -0.1515 4.669e-09 -0.079 rs214803 20 2309687 C A 0.999888 0.853528 268116 367388 20:2290333 20:2309687:C:A missense_variant "" "" "" recessive Malignant neoplasm of skin (other cancers excluded from controls) ZBTB7B 6.1e-07 0.1696 rs141845046 1 155015228 C T 0.989686 0.0698254 1922 367388 1:154987704 1:155015228:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) CASP8 8.24e-12 -0.1245 1.693e-09 -0.075 rs3769823 2 201258272 A G 0.994704 0.653968 156938 367388 2:202122995 2:201258272:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Malignant neoplasm of skin (other cancers excluded from controls) XPA 1.31e-09 1.1182 rs104894132 9 97675579 G A 0.992244 0.00234902 0 367388 9:100437861 9:97675579:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Malignant neoplasm of skin (other cancers excluded from controls) TYR 2.35e-14 0.1727 3.832e-05 0.141 rs1126809 11 89284793 G A 0.998018 0.178944 11978 367388 11:89017961 11:89284793:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl both Malignant neoplasm of skin (other cancers excluded from controls) KRT5 5.46e-12 0.2023 0.001118 0.205 rs11170164 12 52519884 C T 0.997728 0.0966417 3400 367388 12:52913668 12:52519884:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Malignant neoplasm of skin (other cancers excluded from controls) OCA2 3.28e-32 0.507 2.617e-09 0.81 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Malignant neoplasm of skin (other cancers excluded from controls) GOLGA8M 3.21e-12 0.2162 0.0004572 0.244 rs531763484 15 28702279 G A 0.96956 0.0889359 3026 367388 15:28947425 15:28702279:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) GOLGA8M 1.18e-11 0.2061 0.0002464 0.247 rs78557271 15 28702280 A G 0.96098 0.0930814 3298 367388 15:28947426 15:28702280:A:G missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) GOLGA8M 8.06e-12 0.2085 0.0003043 0.244 rs2003233 15 28702528 G A 0.964317 0.0925561 3288 367388 15:28947674 15:28702528:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) GOLGA8M 2.65e-10 0.2 0.001194 0.238 rs200180898 15 28705604 T C 0.945257 0.0893878 3032 367388 15:28950750 15:28705604:T:C missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) GOLGA8M 4.96e-12 0.2108 0.0001126 0.262 rs28623038 15 28708257 G A 0.975447 0.0913095 3216 367388 15:28953403 15:28708257:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) GOLGA8M 4.97e-12 0.2108 0.0001128 0.262 rs28418661 15 28708266 C T 0.975453 0.0913122 3216 367388 15:28953412 15:28708266:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) RPL13 6.06e-14 -0.1688 1.92e-05 -0.144 rs9930567 16 89561665 G A 0.984746 0.187184 12852 367388 16:89628073 16:89561665:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) SPATA33 5.17e-13 0.1936 0.0002742 0.186 rs35415928 16 89657860 C T 0.996679 0.117334 5112 367388 16:89724268 16:89657860:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) FANCA 7.38e-08 0.1969 0.008755 0.257 rs9282681 16 89739506 T C 0.999504 0.0598441 1394 367388 16:89805914 16:89739506:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Malignant neoplasm of skin (other cancers excluded from controls) FANCA 9.3e-08 0.1952 0.008584 0.257 rs11076619 16 89764835 C A 0.999031 0.0598985 1402 367388 16:89831243 16:89764835:C:A missense_variant "" "" "" recessive Malignant neoplasm of skin (other cancers excluded from controls) FANCA 1.11e-12 0.2215 0.0001369 0.265 rs1800282 16 89816599 A T 0.980732 0.0843686 2698 367388 16:89883007 16:89816599:A:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Malignant neoplasm of skin (other cancers excluded from controls) MC1R 9.12e-31 0.404 1.946e-09 0.555 rs1805007 16 89919709 C T 0.989317 0.0670055 1688 367388 16:89986117 16:89919709:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Malignant neoplasm of skin (other cancers excluded from controls) MC1R 1.44e-21 0.3276 5.802e-06 0.393 rs1805008 16 89919736 C T 0.995937 0.0685896 1760 367388 16:89986144 16:89919736:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Malignant neoplasm of skin (other cancers excluded from controls) TUBB3 3.01e-16 0.2571 1.543e-05 0.315 rs77681059 16 89933636 C T 0.995589 0.0827381 2522 367388 16:90000044 16:89933636:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Malignant neoplasm of skin (other cancers excluded from controls) CENPBD1 2.26e-10 -0.1311 1.694e-07 -0.065 rs4785755 16 89971420 G A 0.998123 0.775738 221298 367388 16:90037828 16:89971420:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) GAS8-AS1 1.58e-13 -0.1424 2.029e-07 -0.118 rs3785183 16 90029153 C T 0.99771 0.285105 30254 367388 16:90095561 16:90029153:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) PRDM7 2.93e-15 0.2646 0.001998 0.256 rs150196149 16 90060585 A G 0.982595 0.0728467 1960 367388 16:90126993 16:90060585:A:G missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) TMEM102 4.24e-09 0.5927 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) TGM3 1.96e-10 -0.1542 3.902e-09 -0.081 rs214803 20 2309687 C A 0.999888 0.853528 268116 367388 20:2290333 20:2309687:C:A missense_variant "" "" "" recessive Malignant neoplasm of small intestine LGR5 6.74e-10 7.3628 8.292e-07 30.017 rs200138614 12 71584145 G T 0.970757 0.0030431 10 367388 12:71977925 12:71584145:G:T missense_variant "" "" "" unknown Malignant neoplasm of small intestine (other cancers excluded from controls) LGR5 2.13e-10 7.8689 7.936e-08 73.348 rs200138614 12 71584145 G T 0.970757 0.0030431 10 367388 12:71977925 12:71584145:G:T missense_variant "" "" "" unknown Cardiac arrhytmias, COPD co-morbidities PLEKHA3 3.67e-08 0.0846 rs967507 2 178502359 A G 0.991476 0.175311 11362 367388 2:179367086 2:178502359:A:G missense_variant "" "" "" unknown Cardiac arrhytmias, COPD co-morbidities TTN 1.64e-08 0.0738 0.003182 0.045 rs9808377 2 178556967 A G 0.997814 0.27606 28118 367388 2:179421694 2:178556967:A:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities TTN 3.09e-08 0.0723 0.002851 0.046 rs3829746 2 178562809 T C 0.997256 0.276525 28192 367388 2:179427536 2:178562809:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities TTN 5.41e-08 0.0847 rs3731746 2 178566270 G A 0.997177 0.167319 10538 367388 2:179430997 2:178566270:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities TTN 5.56e-08 0.0845 rs2303838 2 178580212 C T 0.997149 0.16813 10646 367388 2:179444939 2:178580212:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities TTN 1.03e-08 0.0749 0.003094 0.046 rs2042996 2 178586693 G A 0.997769 0.275681 28028 367388 2:179451420 2:178586693:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities TTN 2.79e-08 0.0724 0.00264 0.046 rs1001238 2 178599800 T C 0.997761 0.277598 28424 367388 2:179464527 2:178599800:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities CAND2 1.54e-10 0.0772 2.269e-10 0.054 rs11718898 3 12807323 T C 0.998826 0.615325 139138 367388 3:12848822 3:12807323:T:C missense_variant "" "" "" unknown Cardiac arrhytmias, COPD co-morbidities CAND2 1.31e-07 0.0623 1.014e-08 0.052 rs3732675 3 12816529 T C 0.996645 0.548502 110458 367388 3:12858028 3:12816529:T:C missense_variant "" "" "" unknown Cardiac arrhytmias, COPD co-morbidities SCN5A 2.14e-08 -0.4828 rs45620037 3 38613787 G A 0.994551 0.00485318 22 367388 3:38655278 3:38613787:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities PITX2 5.32e-09 0.3371 rs143452464 4 110622340 G A 0.995482 0.0099976 42 367388 4:111543496 4:110622340:G:A missense_variant "" "" "" dominant Cardiac arrhytmias, COPD co-morbidities RPL3L 9.43e-08 0.3005 rs201864074 16 1954141 C T 0.985791 0.0108142 76 367388 16:2004142 16:1954141:C:T missense_variant "" "" "" unknown Benign neoplasms LRRC34 4.59e-11 -0.0625 0.0008832 -0.038 rs10936600 3 169796797 A T 0.999129 0.272448 27316 367388 3:169514585 3:169796797:A:T missense_variant "" "" "" unknown Benign neoplasms LRRC34 2.93e-09 -0.0554 0.00406 -0.031 rs6793295 3 169800667 T C 0.998971 0.287358 30498 367388 3:169518455 3:169800667:T:C missense_variant "" "" "" unknown Benign neoplasms COL17A1 8.87e-18 -0.1712 7.953e-18 -0.089 rs805698 10 104057158 C T 0.999119 0.952418 333294 367388 10:105816916 10:104057158:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Benign neoplasms SFR1 4.41e-08 0.0639 rs10786783 10 104123007 A G 0.996397 0.154507 8920 367388 10:105882765 10:104123007:A:G missense_variant "" "" "" unknown Benign neoplasms GSTO2 3.4e-10 0.1311 rs3758572 10 104299143 G T 0.997502 0.0428212 734 367388 10:106058901 10:104299143:G:T missense_variant "" "" "" unknown Benign neoplasms ODF3 1.79e-09 -0.0953 5.2e-05 -0.156 rs72878024 11 199492 G A 0.989911 0.0772834 2214 367388 11:199492 11:199492:G:A missense_variant "" "" "" unknown Benign neoplasms ATM 3.3e-08 -0.0555 5.475e-05 -0.054 rs1801516 11 108304735 G A 0.999862 0.227209 19442 367388 11:108175462 11:108304735:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Benign neoplasms ALOX12-AS1 4.14e-08 0.2795 rs11571362 17 7002566 T C 0.986945 0.00704705 36 367388 17:6905885 17:7002566:T:C missense_variant "" "" "" unknown Benign neoplasms RNASEK 3.29e-08 0.2813 rs543304144 17 7012606 C T 0.987001 0.00704432 36 367388 17:6915925 17:7012606:C:T missense_variant "" "" "" unknown Benign neoplasms TMEM102 1.54e-16 0.3944 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Benign neoplasms CHEK2 1.2e-13 0.3679 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Benign neoplasms CHEK2 1.66e-16 0.2044 rs17879961 22 28725099 A G 0.998737 0.0297261 378 367388 22:29121087 22:28725099:A:G missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Benign neoplasm of colon, rectum, anus and anal canal LAMA5 7.3e-08 -0.1352 6.044e-05 -0.172 rs2297587 20 62320641 C T 0.996407 0.148709 8360 367388 20:60895697 20:62320641:C:T missense_variant "" "" "" unknown Benign neoplasm of colon, rectum, anus and anal canal LAMA5 7.94e-08 -0.1339 0.0001363 -0.161 rs11698080 20 62324126 C T 0.997111 0.150606 8610 367388 20:60899182 20:62324126:C:T missense_variant "" "" "" unknown Benign neoplasm of colon, rectum, anus and anal canal (other cancers excluded from controls) LAMA5 4.9e-08 -0.1386 2.951e-05 -0.181 rs2297587 20 62320641 C T 0.996407 0.148709 8360 367388 20:60895697 20:62320641:C:T missense_variant "" "" "" unknown Benign neoplasm of colon, rectum, anus and anal canal (other cancers excluded from controls) LAMA5 5.61e-08 -0.1372 7.353e-05 -0.169 rs11698080 20 62324126 C T 0.997111 0.150606 8610 367388 20:60899182 20:62324126:C:T missense_variant "" "" "" unknown Benign neoplasm of colon, rectum, anus and anal canal (other cancers excluded from controls) CHEK2 4.94e-09 0.6836 0.003644 5.249 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Benign neoplasms (other cancers excluded from controls) LRRC34 6.97e-12 -0.0676 0.0003575 -0.042 rs10936600 3 169796797 A T 0.999129 0.272448 27316 367388 3:169514585 3:169796797:A:T missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) LRRC34 4.58e-10 -0.0604 0.001436 -0.036 rs6793295 3 169800667 T C 0.998971 0.287358 30498 367388 3:169518455 3:169800667:T:C missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) CHMP4C 1.73e-07 0.328 rs147304043 8 81753186 G C 0.996735 0.00495661 6 367388 8:82665421 8:81753186:G:C missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) OBFC1 6.28e-08 -0.0863 8.464e-08 -0.045 rs10786775 10 103897558 G C 0.999876 0.917692 309310 367388 10:105657316 10:103897558:G:C missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) OBFC1 7.53e-08 -0.0858 8.424e-08 -0.045 rs2487999 10 103900068 T C 0.999962 0.91767 309310 367388 10:105659826 10:103900068:T:C missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) COL17A1 4.23e-18 -0.179 4.953e-18 -0.093 rs805698 10 104057158 C T 0.999119 0.952418 333294 367388 10:105816916 10:104057158:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Benign neoplasms (other cancers excluded from controls) SFR1 1.21e-08 0.069 rs10786783 10 104123007 A G 0.996397 0.154507 8920 367388 10:105882765 10:104123007:A:G missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) GSTO2 2.5e-10 0.137 rs3758572 10 104299143 G T 0.997502 0.0428212 734 367388 10:106058901 10:104299143:G:T missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) ODF3 5.56e-09 -0.0959 1.689e-05 -0.172 rs72878024 11 199492 G A 0.989911 0.0772834 2214 367388 11:199492 11:199492:G:A missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) ATM 6.28e-09 -0.0606 0.0002731 -0.05 rs1801516 11 108304735 G A 0.999862 0.227209 19442 367388 11:108175462 11:108304735:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Benign neoplasms (other cancers excluded from controls) RNASEK 9.13e-08 0.2805 rs543304144 17 7012606 C T 0.987001 0.00704432 36 367388 17:6915925 17:7012606:C:T missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) TMEM102 1.84e-17 0.4203 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Benign neoplasms (other cancers excluded from controls) CHEK2 1.98e-18 0.4599 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Benign neoplasms (other cancers excluded from controls) CHEK2 1.91e-17 0.2191 0.008899 0.254 rs17879961 22 28725099 A G 0.998737 0.0297261 378 367388 22:29121087 22:28725099:A:G missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Haemangioma and lymphangioma, any site OTOGL 4.13e-08 1.1073 rs61735664 12 80341957 A G 0.990057 0.0169467 136 367388 12:80735737 12:80341957:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Haemangioma and lymphangioma, any site (other cancers excluded from controls) OTOGL 3.52e-08 1.1179 rs61735664 12 80341957 A G 0.990057 0.0169467 136 367388 12:80735737 12:80341957:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Haemangioma, any site OTOGL 1.09e-08 1.2094 rs61735664 12 80341957 A G 0.990057 0.0169467 136 367388 12:80735737 12:80341957:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Haemangioma, any site (other cancers excluded from controls) OTOGL 9.04e-09 1.2219 rs61735664 12 80341957 A G 0.990057 0.0169467 136 367388 12:80735737 12:80341957:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Leiomyoma of uterus DMRT3 2.9e-08 0.2948 rs10978001 9 990076 G A 0.996815 0.0174039 142 367388 9:990076 9:990076:G:A missense_variant "" "" "" unknown Leiomyoma of uterus COL17A1 2.19e-21 -0.316 8.778e-21 -0.162 rs805698 10 104057158 C T 0.999119 0.952418 333294 367388 10:105816916 10:104057158:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Leiomyoma of uterus SFR1 4.56e-10 0.1206 rs10786783 10 104123007 A G 0.996397 0.154507 8920 367388 10:105882765 10:104123007:A:G missense_variant "" "" "" unknown Leiomyoma of uterus GSTO2 3.42e-10 0.2173 rs3758572 10 104299143 G T 0.997502 0.0428212 734 367388 10:106058901 10:104299143:G:T missense_variant "" "" "" unknown Leiomyoma of uterus ATM 1.13e-09 0.4513 rs1800057 11 108272729 C G 0.996379 0.00906671 36 367388 11:108143456 11:108272729:C:G missense_variant (likely)Benign Benign Criteria_multSubmitter both Leiomyoma of uterus ATM 3.94e-10 -0.1046 8.023e-07 -0.11 rs1801516 11 108304735 G A 0.999862 0.227209 19442 367388 11:108175462 11:108304735:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Leiomyoma of uterus KDELC2 2.66e-09 0.4535 rs74911261 11 108486410 G A 0.984613 0.00871014 34 367388 11:108357137 11:108486410:G:A missense_variant "" "" "" unknown Leiomyoma of uterus ALOX12-AS1 4.39e-08 0.4072 rs142135825 17 6985497 C A 0.983846 0.00902316 52 367388 17:6888816 17:6985497:C:A missense_variant "" "" "" unknown Leiomyoma of uterus ALOX12-AS1 5.31e-11 0.5671 rs11571362 17 7002566 T C 0.986945 0.00704705 36 367388 17:6905885 17:7002566:T:C missense_variant "" "" "" unknown Leiomyoma of uterus RNASEK 5.1e-11 0.5671 rs543304144 17 7012606 C T 0.987001 0.00704432 36 367388 17:6915925 17:7012606:C:T missense_variant "" "" "" unknown Leiomyoma of uterus TMEM102 7.02e-17 0.6813 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Leiomyoma of uterus CHEK2 2.9e-08 0.4489 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Leiomyoma of uterus CHEK2 2.17e-11 0.2741 rs17879961 22 28725099 A G 0.998737 0.0297261 378 367388 22:29121087 22:28725099:A:G missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Leiomyoma of uterus (other cancers excluded from controls) DMRT3 1.99e-09 0.331 rs10978001 9 990076 G A 0.996815 0.0174039 142 367388 9:990076 9:990076:G:A missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) COL17A1 3.3e-21 -0.3232 9.762e-21 -0.166 rs805698 10 104057158 C T 0.999119 0.952418 333294 367388 10:105816916 10:104057158:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Leiomyoma of uterus (other cancers excluded from controls) SFR1 1.9e-10 0.1276 rs10786783 10 104123007 A G 0.996397 0.154507 8920 367388 10:105882765 10:104123007:A:G missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) GSTO2 2.7e-10 0.2255 rs3758572 10 104299143 G T 0.997502 0.0428212 734 367388 10:106058901 10:104299143:G:T missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) NPAT 1.94e-08 0.5755 rs781543382 11 108172808 TAGA T 0.993525 0.00507638 14 367388 11:108043535 11:108172808:TAGA:T inframe_indel (likely)Benign Benign Criteria_oneSubmitter unknown Leiomyoma of uterus (other cancers excluded from controls) ATM 2.12e-08 0.5749 rs1800056 11 108267276 T C 0.99616 0.00505732 14 367388 11:108138003 11:108267276:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Leiomyoma of uterus (other cancers excluded from controls) ATM 2.13e-10 0.4885 rs1800057 11 108272729 C G 0.996379 0.00906671 36 367388 11:108143456 11:108272729:C:G missense_variant (likely)Benign Benign Criteria_multSubmitter both Leiomyoma of uterus (other cancers excluded from controls) ATM 2.89e-11 -0.1151 8.709e-07 -0.114 rs1801516 11 108304735 G A 0.999862 0.227209 19442 367388 11:108175462 11:108304735:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Leiomyoma of uterus (other cancers excluded from controls) KDELC2 5.07e-10 0.4914 rs74911261 11 108486410 G A 0.984613 0.00871014 34 367388 11:108357137 11:108486410:G:A missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) ALOX12-AS1 4.35e-10 0.5443 rs11571362 17 7002566 T C 0.986945 0.00704705 36 367388 17:6905885 17:7002566:T:C missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) RNASEK 4.07e-10 0.5448 rs543304144 17 7012606 C T 0.987001 0.00704432 36 367388 17:6915925 17:7012606:C:T missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) CTDNEP1 2.43e-07 0.1242 rs3744399 17 7251263 T C 0.979781 0.101084 4024 367388 17:7154582 17:7251263:T:C missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) TMEM102 2.5e-17 0.7075 rs146078823 17 7437432 C T 0.954339 0.008408 62 367388 17:7340751 17:7437432:C:T missense_variant "" "" "" unknown Leiomyoma of uterus (other cancers excluded from controls) CHEK2 1.23e-11 0.5894 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Leiomyoma of uterus (other cancers excluded from controls) CHEK2 3.06e-12 0.2965 rs17879961 22 28725099 A G 0.998737 0.0297261 378 367388 22:29121087 22:28725099:A:G missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant In situ neoplasms OCA2 1.89e-08 0.4135 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive In situ neoplasms (other cancers excluded from controls) OCA2 2.65e-09 0.447 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Carcinoma in situ of skin OCA2 1.74e-12 0.8621 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Carcinoma in situ of skin (other cancers excluded from controls) OCA2 1.4e-13 0.929 0.007096 1.076 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Primary_lymphoid and hematopoietic malignant neoplasms (other cancers excluded from controls) CHEK2 2.58e-08 0.4903 rs17879961 22 28725099 A G 0.998737 0.0297261 378 367388 22:29121087 22:28725099:A:G missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Chirrosis of liver, NAS PNPLA3 4.61e-15 0.7961 1.184e-08 0.836 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Chirrosis of liver, NAS SAMM50 9.69e-10 0.6067 1.091e-06 0.699 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis ZFP36L2 2.51e-47 0.6409 rs538857577 2 43224855 C T 0.99412 0.0244592 284 367388 2:43451994 2:43224855:C:T missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis ZFP36L2 5.94e-12 -0.1769 7.402e-05 -0.263 rs11675632 2 43225479 C T 0.997748 0.0723513 1912 367388 2:43452618 2:43225479:C:T missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis THADA 1.23e-48 0.5848 rs958225355 2 43428137 CAGA C 0.999594 0.0296499 386 367388 2:43655276 2:43428137:CAGA:C inframe_indel "" "" "" unknown Cholelithiasis, broad definition with cholecystitis THADA 2.24e-11 -0.1069 0.0002339 -0.081 rs17031056 2 43570480 C T 0.997164 0.213809 17062 367388 2:43797619 2:43570480:C:T missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis THADA 4.75e-15 0.9457 rs111983293 2 43575014 T C 0.9868 0.00319281 0 367388 2:43802153 2:43575014:T:C missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis DYNC2LI1 2.97e-37 -0.1997 2.413e-11 -0.139 rs11556157 2 43800874 A T 0.995673 0.233704 19912 367388 2:44028013 2:43800874:A:T missense_variant "" "" "" recessive Cholelithiasis, broad definition with cholecystitis ABCG5 2.99e-36 0.2419 1.113e-11 0.235 rs6720173 2 43813262 G C 0.998145 0.135973 6958 367388 2:44040401 2:43813262:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Cholelithiasis, broad definition with cholecystitis ABCG5 3.87e-219 0.786 2.552e-23 0.582 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Cholelithiasis, broad definition with cholecystitis ABCG8 1.16e-230 0.7988 3.391e-26 0.608 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Cholelithiasis, broad definition with cholecystitis PREPL 1.85e-09 1.229 rs745462411 2 44344565 A C 0.975366 0.00103433 0 367388 2:44571704 2:44344565:A:C missense_variant "" "" "" recessive Cholelithiasis, broad definition with cholecystitis UGT1A6 1.38e-05 0.0567 3.876e-08 0.06 rs6759892 2 233693023 T G 0.999998 0.482354 86036 367388 2:234601669 2:233693023:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Cholelithiasis, broad definition with cholecystitis UGT1A6 4.84e-09 0.0768 1.534e-11 0.077 rs1105879 2 233693556 A C 0.999952 0.451147 75358 367388 2:234602202 2:233693556:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Cholelithiasis, broad definition with cholecystitis UGT1A3 4e-06 0.0608 2.493e-09 0.072 rs6431625 2 233729266 T C 0.999406 0.420509 65620 367388 2:234637912 2:233729266:T:C missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis LRBA 6.7e-13 0.1126 3.499e-06 0.098 rs2290846 4 150277928 G A 0.99993 0.221648 18096 367388 4:151199080 4:150277928:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Cholelithiasis, broad definition with cholecystitis LRBA 6.87e-11 0.1001 4.713e-06 0.092 rs3749574 4 150285975 C T 0.999017 0.234828 20356 367388 4:151207127 4:150285975:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Cholelithiasis, broad definition with cholecystitis STKLD1 6.73e-08 0.125 0.0062 0.144 rs41302673 9 133405414 T G 0.988635 0.0881656 2996 367388 9:136270538 9:133405414:T:G missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis MARCH8 4.47e-11 0.0955 1.947e-06 0.081 rs2291428 10 45463408 G C 0.997674 0.280243 29026 367388 10:45958856 10:45463408:G:C missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis MARCH8 1.05e-10 0.0995 9.903e-06 0.086 rs2291429 10 45463433 A C 0.935118 0.269916 26882 367388 10:45958881 10:45463433:A:C missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis SERPINA1 1.09e-15 0.3783 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Cholelithiasis, broad definition with cholecystitis HNF4A 4.78e-29 0.36 0.002317 0.31 rs1800961 20 44413724 C T 0.995363 0.0450614 752 367388 20:43042364 20:44413724:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Crohn's disease of small interstine NOD2 2.21e-08 1.4123 1.309e-05 9.269 rs199883290 16 50729867 G GC 0.977701 0.0152346 88 367388 16:50763778 16:50729867:G:GC pLoF risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter dominant Cirrhosis, broad definition used in the article https://doi.org/10.1101/594523 PNPLA3 6.7e-21 0.4428 2.638e-13 0.488 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Cirrhosis, broad definition used in the article https://doi.org/10.1101/594523 SAMM50 5.16e-17 0.3941 7.85e-13 0.481 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown Early onset COPD SERPINA1 3.13e-07 0.5414 1.67e-10 5.118 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Early onset COPD CHRNA5 7.7e-17 0.2515 2.162e-10 0.208 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown COPD, early/later onset CHRNA5 4.33e-19 0.2039 7.589e-12 0.169 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown COPD, hospital admissions CHRNA5 6.72e-19 0.2041 1.841e-11 0.167 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown COPD-related respiratory insufficiency CCDC17 4.33e-08 1.2563 rs56364098 1 45623643 G A 0.984135 0.00238712 6 367388 1:46089315 1:45623643:G:A pLoF "" "" "" unknown COPD (mode) SERPINA1 1.46e-05 0.3719 1.447e-08 3.353 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive COPD (mode) CHRNA5 2.33e-20 0.2317 3.998e-11 0.178 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Anaemias RNF43 2.07e-21 0.7871 6.195e-05 2.496 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Other and unspecified anaemias RNF43 2.19e-10 0.6521 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Vitamin B12 deficiency anaemia PTPN22 5.31e-19 -0.5141 5.097e-14 -0.24 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Iron deficiency anaemia RNF43 7.12e-25 1.098 0.000355 2.802 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Iron deficiency anaemia secondary to blood loss (chronic) RNF43 9.97e-10 1.0382 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Other and unspecified iron deficiency RNF43 2e-20 1.1877 0.006981 2.289 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Aplastic and other anaemias RNF43 4.33e-11 0.6468 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Diseases of the blood and blood-forming organs and certain disorders involving the immune mechanism JAK2 7.74e-07 1.1903 rs77375493 9 5073770 G T 0.875366 0.000593378 24 367388 9:5073770 9:5073770:G:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Diseases of the blood and blood-forming organs and certain disorders involving the immune mechanism RNF43 1.28e-17 0.4815 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Other diseases of blood and blood-forming organs JAK2 7.08e-12 5.9329 rs77375493 9 5073770 G T 0.875366 0.000593378 24 367388 9:5073770 9:5073770:G:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Chronic Coagulation defects CREB3L1 3.31e-09 6.6245 rs187725533 11 46311035 A T 0.991819 0.00412915 12 367388 11:46332586 11:46311035:A:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter recessive Chronic Coagulation defects VWF 2.4e-09 20.8462 rs745322229 12 6044297 CG C 0.960198 0.000756693 2 367388 12:6153463 12:6044297:CG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Other and unspecified coagulation defects CCDC181 9.23e-08 -0.4223 2.619e-08 -0.278 rs3820059 1 169421916 A G 0.999268 0.713521 187346 367388 1:169391154 1:169421916:A:G missense_variant "" "" "" unknown Other and unspecified coagulation defects KIFAP3 4.42e-15 3.1603 rs200944427 1 169961073 C T 0.989982 0.0122867 84 367388 1:169930214 1:169961073:C:T missense_variant "" "" "" unknown Other and unspecified coagulation defects CREB3L1 2.31e-11 5.0113 rs187725533 11 46311035 A T 0.991819 0.00412915 12 367388 11:46332586 11:46311035:A:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter recessive Other and unspecified coagulation defects MYBPC3 1.48e-08 5.0717 rs370890951 11 47332912 A G 0.984542 0.0029179 6 367388 11:47354463 11:47332912:A:G missense_variant (likely)Benign Likely benign Criteria_multSubmitter dominant Coagulation defects, purpura and other haemorrhagic conditions KIFAP3 3.8e-10 1.0202 rs200944427 1 169961073 C T 0.989982 0.0122867 84 367388 1:169930214 1:169961073:C:T missense_variant "" "" "" unknown Coagulation defects, purpura and other haemorrhagic conditions CREB3L1 1.07e-13 2.2765 rs187725533 11 46311035 A T 0.991819 0.00412915 12 367388 11:46332586 11:46311035:A:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter recessive Coagulation defects, purpura and other haemorrhagic conditions MYBPC3 3.8e-10 2.3002 rs370890951 11 47332912 A G 0.984542 0.0029179 6 367388 11:47354463 11:47332912:A:G missense_variant (likely)Benign Likely benign Criteria_multSubmitter dominant Other coagulation defects KIFAP3 3.47e-18 2.8302 rs200944427 1 169961073 C T 0.989982 0.0122867 84 367388 1:169930214 1:169961073:C:T missense_variant "" "" "" unknown Other coagulation defects CREB3L1 1.11e-17 5.3727 rs187725533 11 46311035 A T 0.991819 0.00412915 12 367388 11:46332586 11:46311035:A:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter recessive Other coagulation defects MYBPC3 4.09e-12 5.1137 rs370890951 11 47332912 A G 0.984542 0.0029179 6 367388 11:47354463 11:47332912:A:G missense_variant (likely)Benign Likely benign Criteria_multSubmitter dominant Other coagulation defects OR4C6 6.42e-09 4.8924 rs145608757 11 55666080 C G 0.922467 0.00227552 4 367388 11:55433556 11:55666080:C:G missense_variant "" "" "" unknown Immunodeficiency with predominantly antibody defects IGHG3 7.46e-05 0.352 4.444e-08 0.497 rs74093865 14 105769806 G A 0.921368 0.397386 58156 367388 14:106236143 14:105769806:G:A missense_variant "" "" "" unknown Nutritional anaemias RNF43 5.68e-21 0.8669 0.0003858 2.334 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Other anaemias RNF43 3.4e-10 0.6402 rs199598395 17 58358769 C T 0.9825 0.0133809 64 367388 17:56436130 17:58358769:C:T missense_variant "" "" "" dominant Oher diseases of blood and blood-forming organs JAK2 6.97e-15 18.3385 rs77375493 9 5073770 G T 0.875366 0.000593378 24 367388 9:5073770 9:5073770:G:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Von Willebrand disease VWF 2.05e-11 40.6378 rs745322229 12 6044297 CG C 0.960198 0.000756693 2 367388 12:6153463 12:6044297:CG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Diabetes, varying definitions PTPN22 3.03e-13 -0.1067 3.439e-10 -0.052 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetes, varying definitions PPARG 7.41e-11 -0.091 0.0005755 -0.076 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Diabetes, varying definitions WFS1 3.96e-14 0.0843 1.357e-13 0.055 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetes, varying definitions RFX6 1.84e-08 0.7958 rs770636874 6 116916217 TAC T 0.938397 0.00149433 0 367388 6:117237380 6:116916217:TAC:T pLoF "" "" "" recessive Diabetes, varying definitions GPSM1 2.87e-12 -0.0805 6.103e-08 -0.071 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Diabetes, varying definitions TET1 3.71e-08 0.1094 rs142008363 10 68572720 G T 0.984565 0.0737776 2178 367388 10:70332477 10:68572720:G:T missense_variant "" "" "" unknown Diabetes, varying definitions RP11-366L20.2 7.58e-08 0.1928 0.004854 0.457 rs73119894 12 65866936 G A 0.993848 0.0219278 194 367388 12:66260716 12:65866936:G:A missense_variant "" "" "" unknown Diabetes, varying definitions HNF1A 2.9e-08 0.1423 0.002856 0.242 rs1800574 12 120979061 C T 0.998343 0.0427069 722 367388 12:121416864 12:120979061:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetes, varying definitions HNF1A 1.4e-09 -0.0708 1.619e-05 -0.059 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Background diabetic retinopathy PTPN22 3.74e-16 -0.4243 6.453e-13 -0.209 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Background diabetic retinopathy INS 1.79e-12 0.3306 1.486e-15 0.219 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Background diabetic retinopathy INS 7.66e-10 -0.3208 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetes-related co-morbidities/complications (more controls excluded) PTPN22 5.01e-13 -0.0978 7.724e-10 -0.047 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetes-related co-morbidities/complications (more controls excluded) APOE 2.55e-07 -0.1116 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Diabetic hypoglycemia PTPN22 9.59e-14 -0.2874 1.826e-09 -0.13 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic ketoacidosis PTPN22 4.02e-29 -0.4004 7.961e-24 -0.203 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic ketoacidosis INS 1.25e-28 0.369 6.505e-30 0.219 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetic ketoacidosis INS 7.98e-21 -0.3471 0.0003037 -0.229 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic maculopathy PTPN22 4.74e-11 -0.3627 3.087e-10 -0.195 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic maculopathy INS 1.04e-10 0.3227 1.418e-12 0.207 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetic maculopathy INS 2.32e-09 -0.3331 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic maculopathy AIRE 2.39e-09 0.6388 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic maculopathy (more controls excluded) PTPN22 4.47e-12 -0.3884 4.589e-11 -0.206 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic maculopathy (more controls excluded) INS 1.67e-11 0.3384 2.016e-13 0.217 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetic maculopathy (more controls excluded) INS 4.25e-10 -0.3499 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic maculopathy (more controls excluded) AIRE 8.35e-10 0.6674 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic neuropathy PTPN22 2.72e-08 -0.3463 6.964e-06 -0.156 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Other diabetes, wide definition PTPN22 2.48e-12 -0.11 2.379e-09 -0.053 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Other diabetes, wide definition PPARG 2.4e-09 -0.0894 0.001518 -0.075 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Other diabetes, wide definition WFS1 1.28e-15 0.0957 8.137e-14 0.06 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Other diabetes, wide definition RFX6 9.92e-09 0.8819 rs770636874 6 116916217 TAC T 0.938397 0.00149433 0 367388 6:117237380 6:116916217:TAC:T pLoF "" "" "" recessive Other diabetes, wide definition TET1 1.34e-08 0.1212 rs142008363 10 68572720 G T 0.984565 0.0737776 2178 367388 10:70332477 10:68572720:G:T missense_variant "" "" "" unknown Other diabetes, wide definition RP11-366L20.2 9.64e-08 0.206 rs73119894 12 65866936 G A 0.993848 0.0219278 194 367388 12:66260716 12:65866936:G:A missense_variant "" "" "" unknown Other diabetes, wide definition HNF1A 5.87e-10 0.1703 0.003653 0.251 rs1800574 12 120979061 C T 0.998343 0.0427069 722 367388 12:121416864 12:120979061:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Other diabetes, wide definition HNF1A 1.33e-10 -0.0807 9.143e-07 -0.073 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Unspecified diabetic retinopathy PTPN22 4.39e-12 -0.3847 9.233e-10 -0.19 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Unspecified diabetic retinopathy INS 1.13e-09 0.3051 7.796e-12 0.201 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Proliferative diabetic retinopathy PTPN22 4.47e-17 -0.2173 3.131e-13 -0.106 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Proliferative diabetic retinopathy INS 1.19e-10 0.1492 5.473e-13 0.099 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Proliferative diabetic retinopathy INS 9.07e-08 -0.138 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic retinopathy PTPN22 6.79e-11 -0.1291 1.761e-08 -0.063 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic retinopathy CFH 6.39e-09 -0.09 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetic retinopathy ARMS2 3.92e-22 0.1596 1.057e-19 0.197 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Diabetic retinopathy INS 4.39e-07 0.0886 1.521e-08 0.059 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetic retinopathy (more controls excluded) PTPN22 1.65e-11 -0.1402 6.987e-09 -0.068 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic retinopathy (more controls excluded) CFH 9.84e-08 -0.0872 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetic retinopathy (more controls excluded) ARMS2 1.63e-20 0.1605 2.491e-18 0.196 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Diabetic retinopathy (more controls excluded) INS 1.15e-06 0.0899 5.558e-08 0.06 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetes, several complications PTPN22 6.24e-17 -0.2608 2.836e-13 -0.128 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Dry age-related macular degeneration (includes geographic atrophy) CFH 2.31e-50 -0.6014 2.8e-12 -0.324 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Dry age-related macular degeneration (includes geographic atrophy) CFH 5.18e-69 -0.6262 3.429e-29 -0.307 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Dry age-related macular degeneration (includes geographic atrophy) CFHR4 4.97e-25 0.535 3.507e-07 0.457 rs10494745 1 196918327 G A 0.982065 0.14476 7950 367388 1:196887457 1:196918327:G:A missense_variant "" "" "" unknown Dry age-related macular degeneration (includes geographic atrophy) CFHR5 2.57e-10 -0.5956 rs565457964 1 196994128 C CAA 0.986447 0.0401347 602 367388 1:196963258 1:196994128:C:CAA pLoF (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Dry age-related macular degeneration (includes geographic atrophy) ASPM 2.02e-10 -0.4955 rs12138336 1 197101391 C G 0.989019 0.0582545 1270 367388 1:197070521 1:197101391:C:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Dry age-related macular degeneration (includes geographic atrophy) TACC2 8.91e-08 0.2991 rs2295876 10 122211207 T A 0.992586 0.11177 4770 367388 10:123970722 10:122211207:T:A missense_variant "" "" "" unknown Dry age-related macular degeneration (includes geographic atrophy) PLEKHA1 2.15e-07 0.2008 1.363e-08 0.14 rs1045216 10 122429681 A G 0.999948 0.708717 184508 367388 10:124189197 10:122429681:A:G missense_variant "" "" "" unknown Dry age-related macular degeneration (includes geographic atrophy) ARMS2 7.12e-70 0.7636 1.065e-59 0.987 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Amyloidosis, other/unspecified CDK5RAP2 8.73e-16 4.3542 0.00093 11.132 rs41296081 9 120477365 A G 0.992096 0.0224776 214 367388 9:123239643 9:120477365:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Amyloidosis, other/unspecified C5 2.49e-18 4.5917 1.074e-06 18.474 rs34552775 9 121023460 G T 0.995191 0.0254472 260 367388 9:123785738 9:121023460:G:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Amyloidosis CDK5RAP2 8.21e-14 3.4881 0.001366 9.283 rs41296081 9 120477365 A G 0.992096 0.0224776 214 367388 9:123239643 9:120477365:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Amyloidosis C5 3.8e-17 3.8187 2.378e-06 15.214 rs34552775 9 121023460 G T 0.995191 0.0254472 260 367388 9:123785738 9:121023460:G:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Diabetes mellitus PTPN22 3.29e-13 -0.1072 5.867e-10 -0.052 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetes mellitus PPARG 1.39e-10 -0.0901 0.0006992 -0.075 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Diabetes mellitus WFS1 1.68e-14 0.086 7.257e-14 0.056 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetes mellitus RFX6 4.72e-08 0.7757 rs770636874 6 116916217 TAC T 0.938397 0.00149433 0 367388 6:117237380 6:116916217:TAC:T pLoF "" "" "" recessive Diabetes mellitus GPSM1 9.43e-12 -0.079 1.07e-07 -0.07 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Diabetes mellitus TET1 2.84e-08 0.1109 rs142008363 10 68572720 G T 0.984565 0.0737776 2178 367388 10:70332477 10:68572720:G:T missense_variant "" "" "" unknown Diabetes mellitus RP11-366L20.2 5.19e-08 0.1963 0.003879 0.471 rs73119894 12 65866936 G A 0.993848 0.0219278 194 367388 12:66260716 12:65866936:G:A missense_variant "" "" "" unknown Diabetes mellitus HNF1A 8.52e-09 0.1485 0.00179 0.255 rs1800574 12 120979061 C T 0.998343 0.0427069 722 367388 12:121416864 12:120979061:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetes mellitus HNF1A 3.51e-10 -0.0738 4.507e-06 -0.063 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 1 diabetes PTPN22 7.34e-45 -0.4512 7.181e-35 -0.224 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes DCLRE1B 1.26e-08 0.1646 8.907e-05 0.165 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type 1 diabetes SRPK1 2.18e-08 0.1353 0.0002103 0.093 rs662713 6 35920290 G C 0.995651 0.33739 42088 367388 6:35888067 6:35920290:G:C pLoF "" "" "" unknown Type 1 diabetes INS 2.53e-38 0.3889 1.252e-41 0.236 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes INS 9.25e-28 -0.3659 0.0008054 -0.189 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes AIRE 2.19e-10 0.381 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with coma PTPN22 7.61e-15 -0.5039 1.205e-10 -0.232 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes with coma INS 1.42e-18 0.5311 1.087e-20 0.325 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes with coma INS 9.83e-15 -0.5252 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with ketoacidosis PTPN22 1.7e-22 -0.6367 1.141e-19 -0.331 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes with ketoacidosis INS 2.43e-22 0.5916 3.637e-24 0.354 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes with ketoacidosis INS 2.47e-15 -0.5375 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with other specified/multiple/unspecified complications PTPN22 2.08e-37 -0.5353 2.653e-29 -0.264 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes with other specified/multiple/unspecified complications DCLRE1B 1.24e-09 0.2266 5.699e-05 0.219 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type 1 diabetes with other specified/multiple/unspecified complications INS 1.73e-33 0.4691 3.628e-37 0.287 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes with other specified/multiple/unspecified complications INS 5.42e-23 -0.4274 0.007929 -0.192 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with other specified/multiple/unspecified complications AIRE 4.95e-08 0.4216 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with neurological complications PTPN22 9.12e-08 -0.5168 2.193e-06 -0.254 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes with neurological complications INS 1.19e-06 0.4191 5.419e-08 0.275 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes without complications PTPN22 1.66e-50 -0.525 4.458e-40 -0.264 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes without complications DCLRE1B 4.78e-10 0.1971 2.505e-05 0.194 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type 1 diabetes without complications INS 2.08e-44 0.4652 1.58e-45 0.272 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes without complications INS 1.63e-31 -0.4337 4.414e-05 -0.259 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes without complications AIRE 1.02e-08 0.3738 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with ophthalmic complications PTPN22 4.29e-35 -0.5628 6.355e-29 -0.287 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes with ophthalmic complications DCLRE1B 1.46e-08 0.2302 8.976e-05 0.23 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type 1 diabetes with ophthalmic complications INS 1.73e-34 0.5251 4.809e-38 0.32 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes with ophthalmic complications INS 1.67e-24 -0.4889 0.004549 -0.227 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with ophthalmic complications AIRE 3e-11 0.57 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes with renal complications PTPN22 6.67e-12 -0.514 9.148e-09 -0.239 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes with renal complications INS 2.6e-07 0.3436 4.118e-09 0.23 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes, strict (exclude DM2) PTPN22 6.17e-36 -0.5846 1.089e-28 -0.291 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes, strict (exclude DM2) DCLRE1B 2.34e-10 0.2661 2.942e-06 0.293 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type 1 diabetes, strict (exclude DM2) INS 6.25e-36 0.5529 1.487e-36 0.32 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes, strict (exclude DM2) INS 5.73e-25 -0.5095 8.396e-05 -0.342 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 2 diabetes PPARG 1.64e-11 -0.101 0.0007442 -0.08 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Type 2 diabetes WFS1 3.6e-14 0.0907 1.156e-12 0.057 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes PAM 7.25e-08 0.1304 rs35658696 5 103003107 A G 0.994804 0.0571249 1340 367388 5:102338811 5:103003107:A:G missense_variant "" "" "" unknown Type 2 diabetes PPIP5K2 8.37e-08 0.1291 rs36046591 5 103201584 A G 0.996901 0.0577128 1340 367388 5:102537285 5:103201584:A:G missense_variant "" "" "" recessive Type 2 diabetes RFX6 7.29e-09 0.8795 rs770636874 6 116916217 TAC T 0.938397 0.00149433 0 367388 6:117237380 6:116916217:TAC:T pLoF "" "" "" recessive Type 2 diabetes GPSM1 1.91e-14 -0.0948 4.742e-09 -0.083 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Type 2 diabetes TET1 4.83e-08 0.1163 rs142008363 10 68572720 G T 0.984565 0.0737776 2178 367388 10:70332477 10:68572720:G:T missense_variant "" "" "" unknown Type 2 diabetes RP11-366L20.2 4.21e-09 0.2262 0.001413 0.549 rs73119894 12 65866936 G A 0.993848 0.0219278 194 367388 12:66260716 12:65866936:G:A missense_variant "" "" "" unknown Type 2 diabetes HNF1A 2.88e-12 -0.0877 1.51e-06 -0.071 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes with other specified/multiple/unspecified complications PPARG 2.33e-09 -0.101 0.006977 -0.072 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Type 2 diabetes with other specified/multiple/unspecified complications WFS1 3.9e-12 0.0937 3.937e-11 0.06 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes with other specified/multiple/unspecified complications RFX6 8.25e-08 0.9338 rs770636874 6 116916217 TAC T 0.938397 0.00149433 0 367388 6:117237380 6:116916217:TAC:T pLoF "" "" "" recessive Type 2 diabetes with other specified/multiple/unspecified complications HNF1A 6.92e-11 -0.0924 3.038e-06 -0.078 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes with other specified/multiple/unspecified complications TM6SF2 1.5e-09 0.1758 0.0005072 0.302 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Type 2 diabetes, strict (exclude DM1) PPARG 2.33e-11 -0.1049 0.0009128 -0.082 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Type 2 diabetes, strict (exclude DM1) WFS1 4.45e-14 0.0945 7.559e-13 0.06 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes, strict (exclude DM1) GPSM1 1.05e-13 -0.0963 8.132e-08 -0.079 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Type 2 diabetes, strict (exclude DM1) RP11-366L20.2 6.3e-10 0.249 0.001408 0.563 rs73119894 12 65866936 G A 0.993848 0.0219278 194 367388 12:66260716 12:65866936:G:A missense_variant "" "" "" unknown Type 2 diabetes, strict (exclude DM1) HNF1A 7.38e-11 -0.0855 1.235e-05 -0.067 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes, strict (exclude DM1) CRB3 8.92e-08 0.7756 0.003949 2.225 rs141345495 19 6466466 C T 0.978145 0.00166581 10 367388 19:6466477 19:6466466:C:T missense_variant "" "" "" unknown Type 2 diabetes, strict (exclude DM1) TM6SF2 6.12e-08 0.1459 0.0006524 0.273 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Unspecified diabetes INS 1.19e-11 0.241 1.918e-13 0.154 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Unspecified diabetes INS 2.93e-10 -0.25 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Endocrine, nutritional and metabolic diseases PTPN22 3.12e-43 -0.1571 1.688e-34 -0.079 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Endocrine, nutritional and metabolic diseases APOE 9.07e-09 -0.105 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Nontoxic multinodular goitre TG 7.52e-10 0.6194 rs114322847 8 132871426 C T 0.992458 0.0230846 228 367388 8:133883671 8:132871426:C:T missense_variant "" "" "" recessive Nontoxic multinodular goitre SECISBP2L 2.11e-32 0.3784 2.269e-16 0.308 rs34895054 15 48992804 G C 0.992667 0.298464 32760 367388 15:49285001 15:48992804:G:C missense_variant "" "" "" unknown Other and/or unspecified nontoxic goitre SECISBP2L 6.23e-11 0.3323 2.348e-06 0.282 rs34895054 15 48992804 G C 0.992667 0.298464 32760 367388 15:49285001 15:48992804:G:C missense_variant "" "" "" unknown Pure hypercholesterolaemia PCSK9 1.33e-16 -0.425 0.003733 -0.51 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Pure hypercholesterolaemia APOB 1.37e-08 0.1158 0.003386 0.07 rs1367117 2 21041028 G A 0.999383 0.28033 29396 367388 2:21263900 2:21041028:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Pure hypercholesterolaemia BUD13 7.61e-08 0.1956 0.003804 0.277 rs11820589 11 116763146 G A 0.99814 0.0699016 1840 367388 11:116633862 11:116763146:G:A missense_variant "" "" "" unknown Pure hypercholesterolaemia APOA5 7.92e-08 0.2027 0.0007672 0.347 rs3135506 11 116791691 G C 0.999267 0.0648824 1590 367388 11:116662407 11:116791691:G:C missense_variant risk factor risk factor no_Criteria dominant Pure hypercholesterolaemia APOE 6.98e-24 0.2483 2.91e-06 0.182 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Pure hypercholesterolaemia APOE 1.15e-22 -0.4164 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Hyperlipidaemia, other/unspecified PCSK9 6.62e-09 -0.3956 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Hyperlipidaemia, other/unspecified ZPR1 8.5e-08 0.2726 0.0001084 0.566 rs35120633 11 116784884 G A 0.999343 0.0635894 1528 367388 11:116655600 11:116784884:G:A missense_variant "" "" "" unknown Hyperlipidaemia, other/unspecified APOA5 6.49e-08 0.2732 8.942e-05 0.567 rs3135506 11 116791691 G C 0.999267 0.0648824 1590 367388 11:116662407 11:116791691:G:C missense_variant risk factor risk factor no_Criteria dominant Hyperlipidaemia, other/unspecified APOE 2.2e-14 -0.426 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Hypothyroidism,other/unspecified PTPN22 9.69e-78 -0.3172 7.353e-69 -0.168 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Hypothyroidism,other/unspecified DCLRE1B 3.57e-17 0.1284 5.255e-06 0.102 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Hypothyroidism,other/unspecified ZAP70 1.83e-08 0.2429 rs145955907 2 97725153 C T 0.99156 0.0193311 176 367388 2:98341616 2:97725153:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Hypothyroidism,other/unspecified IFIH1 8.88e-11 0.0788 1.966e-11 0.06 rs1990760 2 162267541 C T 0.998473 0.584121 125682 367388 2:163124051 2:162267541:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Hypothyroidism,other/unspecified SESN1 4.99e-09 0.0981 rs2273668 6 109002316 G T 0.999644 0.148938 8176 367388 6:109323519 6:109002316:G:T missense_variant "" "" "" unknown Hypothyroidism,other/unspecified TG 4.35e-08 1.0209 rs771807370 8 132887335 C T 0.968283 0.00112415 4 367388 8:133899580 8:132887335:C:T pLoF VUS Uncertain significance Criteria_oneSubmitter recessive Hypothyroidism,other/unspecified TRMO 4.11e-12 0.0888 5.354e-07 0.069 rs2282192 9 97910056 C T 0.993649 0.321551 38204 367388 9:100672338 9:97910056:C:T missense_variant "" "" "" unknown Hypothyroidism,other/unspecified PSMB7 1.74e-12 0.0856 4.358e-06 0.052 rs4574 9 124414882 A G 0.999715 0.407104 61368 367388 9:127177161 9:124414882:A:G missense_variant "" "" "" unknown Hypothyroidism,other/unspecified NFATC1 2.34e-07 0.0902 rs1051978 18 79410477 C A 0.996129 0.136191 6904 367388 18:77170477 18:79410477:C:A missense_variant "" "" "" unknown Hypothyroidism,other/unspecified TYK2 3.74e-07 -0.178 rs34536443 19 10352442 G C 0.994334 0.030657 348 367388 19:10463118 19:10352442:G:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Hypothyroidism,other/unspecified C1QTNF6 1.3e-09 0.0949 0.001656 0.075 rs229526 22 37185382 G C 0.99534 0.178248 11840 367388 22:37581422 22:37185382:G:C missense_variant "" "" "" unknown Lactose intolerance, other/unspecified CCNT2 1.16e-16 0.6892 1.336e-16 0.648 rs10166142 2 134952752 A G 0.996873 0.452075 75652 367388 2:135710322 2:134952752:A:G missense_variant "" "" "" unknown Lactose intolerance, other/unspecified MAP3K19 2.03e-10 1.2311 0.002434 1.809 rs16831256 2 135023465 C T 0.999386 0.0596998 1302 367388 2:135781035 2:135023465:C:T missense_variant "" "" "" unknown Lactose intolerance, other/unspecified ZRANB3 7.77e-11 1.1272 0.004547 1.242 rs59900519 2 135230557 T A 0.997503 0.0740389 2080 367388 2:135988127 2:135230557:T:A missense_variant "" "" "" unknown Lactose intolerance, other/unspecified ZRANB3 7.84e-11 1.1268 0.004577 1.24 rs935615 2 135230846 C T 0.997496 0.0740443 2082 367388 2:135988416 2:135230846:C:T missense_variant "" "" "" unknown Lactose intolerance, other/unspecified ZRANB3 3.44e-08 1.2062 0.001931 2.55 rs61744510 2 135350207 G A 0.997485 0.0454642 766 367388 2:136107777 2:135350207:G:A missense_variant "" "" "" unknown Lactose intolerance, other/unspecified R3HDM1 9.49e-08 0.5972 2.224e-05 0.804 rs961360 2 135636088 A G 0.996769 0.170855 11086 367388 2:136393658 2:135636088:A:G missense_variant "" "" "" unknown Lactose intolerance, other/unspecified R3HDM1 8.52e-13 1.0741 8.255e-05 1.362 rs2305165 2 135652004 A C 0.99535 0.100344 3772 367388 2:136409574 2:135652004:A:C missense_variant "" "" "" unknown Lactose intolerance CCNT2 2.24e-18 0.6752 1.721e-18 0.642 rs10166142 2 134952752 A G 0.996873 0.452075 75652 367388 2:135710322 2:134952752:A:G missense_variant "" "" "" unknown Lactose intolerance MAP3K19 2.2e-10 1.1397 0.00369 1.601 rs16831256 2 135023465 C T 0.999386 0.0596998 1302 367388 2:135781035 2:135023465:C:T missense_variant "" "" "" unknown Lactose intolerance ZRANB3 2.6e-10 1.0115 0.007472 1.071 rs59900519 2 135230557 T A 0.997503 0.0740389 2080 367388 2:135988127 2:135230557:T:A missense_variant "" "" "" unknown Lactose intolerance ZRANB3 2.62e-10 1.0112 0.007523 1.069 rs935615 2 135230846 C T 0.997496 0.0740443 2082 367388 2:135988416 2:135230846:C:T missense_variant "" "" "" unknown Lactose intolerance R3HDM1 5.57e-09 0.6102 3.016e-06 0.84 rs961360 2 135636088 A G 0.996769 0.170855 11086 367388 2:136393658 2:135636088:A:G missense_variant "" "" "" unknown Lactose intolerance R3HDM1 3.12e-14 1.0666 5.818e-05 1.31 rs2305165 2 135652004 A C 0.99535 0.100344 3772 367388 2:136409574 2:135652004:A:C missense_variant "" "" "" unknown Disorders of lipoprotein metabolism and other lipidaemias FAM151A 6.58e-08 -0.1439 rs373739034 1 54610464 CCACTCCACATTCAGACCGTCATCCCCAGG C 0.975519 0.087771 2946 367388 1:55076137 1:54610464:CCACTCCACATTCAGACCGTCATCCCCAGG:C pLoF (likely)Benign Benign Criteria_oneSubmitter unknown Disorders of lipoprotein metabolism and other lipidaemias PARS2 3.86e-08 -0.1627 0.005043 -0.199 rs116816976 1 54759100 A C 0.990908 0.0699342 1982 367388 1:55224773 1:54759100:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Disorders of lipoprotein metabolism and other lipidaemias PCSK9 2.22e-23 -0.4183 0.0009789 -0.48 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Disorders of lipoprotein metabolism and other lipidaemias PCSK9 2.07e-08 0.112 2.304e-07 0.059 rs540796 1 55058524 A G 0.999587 0.830493 253606 367388 1:55524197 1:55058524:A:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Disorders of lipoprotein metabolism and other lipidaemias PCSK9 2.18e-08 0.1118 2.369e-07 0.059 rs562556 1 55058564 G A 0.99985 0.83046 253582 367388 1:55524237 1:55058564:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Disorders of lipoprotein metabolism and other lipidaemias APOB 6.64e-12 0.1135 0.0002513 0.071 rs1367117 2 21041028 G A 0.999383 0.28033 29396 367388 2:21263900 2:21041028:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Disorders of lipoprotein metabolism and other lipidaemias ABCG5 1.79e-10 -0.173 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Disorders of lipoprotein metabolism and other lipidaemias ABCG8 6.43e-10 -0.1659 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Disorders of lipoprotein metabolism and other lipidaemias SLC22A1 1.11e-08 0.4511 rs2282143 6 160136611 C T 0.999447 0.0095131 42 367388 6:160557643 6:160136611:C:T missense_variant "" "" "" unknown Disorders of lipoprotein metabolism and other lipidaemias LPA 2.46e-10 0.4532 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Disorders of lipoprotein metabolism and other lipidaemias BUD13 1.08e-11 0.1999 2.308e-06 0.371 rs11820589 11 116763146 G A 0.99814 0.0699016 1840 367388 11:116633862 11:116763146:G:A missense_variant "" "" "" unknown Disorders of lipoprotein metabolism and other lipidaemias ZPR1 5.19e-12 0.2124 9.992e-06 0.375 rs35120633 11 116784884 G A 0.999343 0.0635894 1528 367388 11:116655600 11:116784884:G:A missense_variant "" "" "" unknown Disorders of lipoprotein metabolism and other lipidaemias APOA5 5.06e-13 0.2206 1.189e-07 0.448 rs3135506 11 116791691 G C 0.999267 0.0648824 1590 367388 11:116662407 11:116791691:G:C missense_variant risk factor risk factor no_Criteria dominant Disorders of lipoprotein metabolism and other lipidaemias BCAM 8.59e-08 -0.3357 rs28399654 19 44813331 G A 0.994023 0.0149134 92 367388 19:45316588 19:44813331:G:A missense_variant "" "" "" recessive Disorders of lipoprotein metabolism and other lipidaemias APOE 3.23e-26 0.2103 0.0003512 0.111 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Disorders of lipoprotein metabolism and other lipidaemias APOE 1.69e-32 -0.4094 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Other metabolic disorders SERPINA1 5.89e-21 1.6323 6.075e-34 17.346 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Metabolic disorders PCSK9 5.68e-15 -0.2539 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Metabolic disorders LPA 8.91e-08 0.303 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Metabolic disorders APOA5 8.29e-08 0.13 2.688e-05 0.275 rs3135506 11 116791691 G C 0.999267 0.0648824 1590 367388 11:116662407 11:116791691:G:C missense_variant risk factor risk factor no_Criteria dominant Metabolic disorders APOE 6.86e-19 0.1395 0.0002482 0.09 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Metabolic disorders APOE 4.16e-22 -0.2621 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Obesity BDNF 9.49e-08 -0.1408 0.00746 -0.118 rs6265 11 27658369 C T 0.999903 0.154651 8948 367388 11:27679916 11:27658369:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Obesity and other hyperalimentation BDNF 8.16e-08 -0.1404 0.005653 -0.121 rs6265 11 27658369 C T 0.999903 0.154651 8948 367388 11:27679916 11:27658369:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Polycystic ovarian syndrome CHEK2 8.92e-10 3.2612 8.44e-05 31.612 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Disorders of porphyrin and bilirubin metabolism UGT1A7 5.03e-07 0.7455 3.231e-08 0.537 rs17868323 2 233682324 T G 0.999577 0.686544 173700 367388 2:234590970 2:233682324:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Disorders of porphyrin and bilirubin metabolism UGT1A7 5.02e-07 0.746 3.193e-08 0.537 rs17868324 2 233682329 G A 0.999559 0.686664 173672 367388 2:234590975 2:233682329:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Disorders of porphyrin and bilirubin metabolism UGT1A7 3.41e-17 1.1933 1.126e-16 1.159 rs11692021 2 233682559 T C 0.999909 0.445175 73246 367388 2:234591205 2:233682559:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Disorders of porphyrin and bilirubin metabolism UGT1A6 2.21e-19 1.2661 3.818e-20 1.212 rs6759892 2 233693023 T G 0.999998 0.482354 86036 367388 2:234601669 2:233693023:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Disorders of porphyrin and bilirubin metabolism UGT1A6 2.21e-19 1.3078 1.318e-19 1.388 rs2070959 2 233693545 A G 0.999944 0.414061 63450 367388 2:234602191 2:233693545:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Disorders of porphyrin and bilirubin metabolism UGT1A6 1.22e-21 1.3686 2.541e-23 1.422 rs1105879 2 233693556 A C 0.999952 0.451147 75358 367388 2:234602202 2:233693556:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Disorders of porphyrin and bilirubin metabolism UGT1A3 7.48e-23 1.3979 2.199e-24 1.412 rs3821242 2 233729157 T C 0.999663 0.466956 80854 367388 2:234637803 2:233729157:T:C missense_variant "" "" "" unknown Disorders of porphyrin and bilirubin metabolism UGT1A3 8.81e-25 1.508 1.175e-26 1.667 rs6431625 2 233729266 T C 0.999406 0.420509 65620 367388 2:234637912 2:233729266:T:C missense_variant "" "" "" unknown Disorders of the thyroid gland PTPN22 1.68e-70 -0.2768 2.274e-62 -0.146 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Disorders of the thyroid gland DCLRE1B 1.84e-14 0.1073 0.0002741 0.075 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Disorders of the thyroid gland ZAP70 4.41e-08 0.2166 rs145955907 2 97725153 C T 0.99156 0.0193311 176 367388 2:98341616 2:97725153:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Disorders of the thyroid gland IFIH1 5.43e-09 0.0651 6.232e-10 0.051 rs1990760 2 162267541 C T 0.998473 0.584121 125682 367388 2:163124051 2:162267541:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Disorders of the thyroid gland SESN1 2.66e-10 0.0974 0.007391 0.07 rs2273668 6 109002316 G T 0.999644 0.148938 8176 367388 6:109323519 6:109002316:G:T missense_variant "" "" "" unknown Disorders of the thyroid gland TBC1D2 7.43e-09 0.0706 0.004806 0.04 rs879368 9 98233476 G T 0.999844 0.283033 29562 367388 9:100995758 9:98233476:G:T missense_variant "" "" "" unknown Disorders of the thyroid gland C1QTNF6 2.85e-09 0.0854 0.001381 0.071 rs229526 22 37185382 G C 0.99534 0.178248 11840 367388 22:37581422 22:37185382:G:C missense_variant "" "" "" unknown Thyrotoxicosis with diffuse goitr PTPN22 1.08e-15 -0.4133 3.623e-15 -0.225 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Thyrotoxicosis with toxic multinodular goitre SECISBP2L 8.67e-11 0.4211 3.1e-05 0.313 rs34895054 15 48992804 G C 0.992667 0.298464 32760 367388 15:49285001 15:48992804:G:C missense_variant "" "" "" unknown Thyrotoxicosis, other and/or unspecified PTPN22 1.54e-10 -0.2833 5.254e-09 -0.144 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Dementia in Alzheimer disease ZNF155 5.08e-09 0.6455 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Dementia in Alzheimer disease ZNF230 2.21e-09 0.6851 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Dementia in Alzheimer disease ZNF225 3.69e-10 0.6997 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Dementia in Alzheimer disease ZNF227 1.99e-10 0.7072 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Dementia in Alzheimer disease ZNF229 3.07e-10 0.723 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Dementia in Alzheimer disease APOE 4.7e-14 0.3102 4.786e-12 0.181 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Dementia in Alzheimer disease APOE 9.53e-08 1.3604 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Dementia in Alzheimer disease APOE 1.37e-156 1.5105 2.312e-76 2.056 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Dementia in Alzheimer disease APOE 4.67e-08 -0.4488 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Dementia in Alzheimer disease PPP1R37 1.72e-11 0.5684 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Dementia in Alzheimer disease EXOC3L2 1.28e-13 0.4873 0.006386 0.369 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Delirium, not induced by alcohol and other psychoactive substances APOE 2.11e-09 0.3898 0.000447 0.377 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Dementia ZNF155 6.66e-20 0.5742 0.0001484 0.961 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Dementia ZNF230 2.05e-19 0.5883 0.0009002 0.85 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Dementia ZNF225 8.17e-21 0.5967 0.0003764 0.858 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Dementia ZNF227 1.98e-21 0.6037 0.0003899 0.854 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Dementia ZNF229 2.6e-22 0.6388 0.003263 0.747 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Dementia APOE 7.67e-27 0.2589 3.933e-23 0.152 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Dementia APOE 1.17e-14 1.054 0.005535 1.999 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Dementia APOE 2.38e-266 1.0716 4.085e-135 1.346 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Dementia APOE 4.43e-15 -0.3795 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Dementia PPP1R37 4.34e-21 0.4525 0.0007757 0.428 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Dementia EXOC3L2 1.68e-08 0.4376 0.005678 0.885 rs189063316 19 45213106 C T 0.985129 0.0208744 168 367388 19:45716364 19:45213106:C:T missense_variant "" "" "" unknown Dementia EXOC3L2 4.16e-15 0.2941 0.001518 0.25 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Dementia DMPK 2.11e-09 0.4319 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Unspecified dementia ZNF155 1.29e-08 0.7106 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Unspecified dementia ZNF225 5.46e-08 0.6881 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Unspecified dementia ZNF227 6.54e-08 0.68 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Unspecified dementia APOE 8.54e-66 1.0626 4.993e-37 1.576 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Undefined dementia ZNF155 7.35e-08 0.6563 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Undefined dementia APOE 1.42e-59 0.9876 2.247e-34 1.453 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Undefined dementia (more controls excluded) ZNF155 2.63e-08 0.7149 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Undefined dementia (more controls excluded) ZNF225 6.85e-08 0.7032 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Undefined dementia (more controls excluded) APOE 5.32e-59 1.0086 2.601e-32 1.349 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Other mental disorders due to brain damage and dysfunction and to physical disease ARHGAP22 rs3827681 10 48451594 T C 0.991725 367388 10:49659637 10:48451594:T:C missense_variant "" "" "" unknown Other mental disorders due to brain damage and dysfunction and to physical disease APOE 6.67e-20 0.565 4.664e-09 0.624 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Organic, including symptomatic, mental disorders ZNF155 1.79e-15 0.4208 0.001053 0.728 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders ZNF230 3.47e-15 0.4309 0.008942 0.552 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders ZNF225 2.39e-16 0.4389 0.001985 0.624 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders ZNF227 8.8e-17 0.4433 0.002106 0.617 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders ZNF229 1.49e-16 0.453 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders APOE 2.03e-22 0.1994 4.061e-20 0.12 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Organic, including symptomatic, mental disorders APOE 1.32e-11 0.7757 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Organic, including symptomatic, mental disorders APOE 7.2e-220 0.8171 1.488e-109 1.001 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Organic, including symptomatic, mental disorders APOE 3.58e-12 -0.286 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Organic, including symptomatic, mental disorders PPP1R37 1.85e-07 0.4853 rs146723120 19 45144962 C T 0.980812 0.0107543 56 367388 19:45648220 19:45144962:C:T missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders PPP1R37 5.88e-18 0.3492 0.0005958 0.373 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders EXOC3L2 1.23e-11 0.2147 0.001785 0.211 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders DMPK 1.13e-10 0.3964 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Psychiatric diseases APOE 9.51e-39 0.153 1.5e-20 0.17 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Vascular dementia APOE 1.43e-23 0.8429 1.103e-09 1.019 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Falls/tendenct to fall PDCD6IP 1.5e-07 1.6419 rs200697599 3 33798742 T C 0.974216 0.00532679 26 367388 3:33840234 3:33798742:T:C missense_variant "" "" "" unknown Cardiomyopathy (excluding other) BAG3 1.47e-07 -0.2284 rs2234962 10 119670121 T C 0.99553 0.221823 18100 367388 10:121429633 10:119670121:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter dominant Cardiomyopathy (excluding other) MYBPC3 1.93e-09 7.0678 rs397516005 11 47333566 G A 0.827562 0.000315742 0 367388 11:47355117 11:47333566:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Cardiomyopathy (excluding other) OR4A47 3.13e-11 11.2142 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Cardiovascular diseases (excluding rheumatic etc) NPHS1 2.364e-13 4.95 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified (FINNGEN) PNO1 8.3e-09 0.0841 2.592e-08 0.053 rs2044693 2 68157965 A G 0.998143 0.698063 179452 367388 2:68385097 2:68157965:A:G missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified (FINNGEN) OBP2B 8.12e-09 0.1386 rs11244035 9 133205932 C T 0.969814 0.0871014 2788 367388 9:136081319 9:133205932:C:T missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified (FINNGEN) OR4C6 9.33e-08 0.7648 rs145608757 11 55666080 C G 0.922467 0.00227552 4 367388 11:55433556 11:55666080:C:G missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified (FINNGEN) PIEZO1 1.25e-10 -0.1219 9.166e-09 -0.062 rs7184427 16 88738326 A G 0.990994 0.857227 270348 367388 16:88804734 16:88738326:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter both Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified (FINNGEN) PIEZO1 3.87e-10 0.1308 0.002487 0.121 rs7404939 16 88741488 G A 0.993057 0.113833 5070 367388 16:88807896 16:88741488:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified (FINNGEN) PIEZO1 8.71e-11 -0.1317 5.187e-10 -0.07 rs6500495 16 88742335 A G 0.992311 0.878551 283850 367388 16:88808743 16:88742335:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Hypertensive diseases (excluding secondary) C1orf167 5.53e-09 -0.1046 rs41275456 1 11775499 C T 0.998016 0.113763 4696 367388 1:11835556 1:11775499:C:T missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) C1orf167 5.35e-09 -0.1046 rs56001051 1 11778784 A G 0.998335 0.113771 4698 367388 1:11838841 1:11778784:A:G missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) C1orf167 5.35e-09 -0.1046 rs55967531 1 11778977 G A 0.998337 0.113771 4698 367388 1:11839034 1:11778977:G:A missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) C1orf167 2.05e-10 -0.1074 rs12561919 1 11779866 C T 0.998026 0.13029 6142 367388 1:11839923 1:11779866:C:T missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) C1orf167 1.47e-08 -0.1012 rs55867221 1 11785165 T C 0.998181 0.114794 4782 367388 1:11845222 1:11785165:T:C missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) C1orf167 1.47e-08 -0.1012 rs1537514 1 11788011 G C 0.998178 0.114791 4782 367388 1:11848068 1:11788011:G:C missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Hypertensive diseases (excluding secondary) CLCN6 1.38e-12 -0.1417 rs55741089 1 11838802 G A 0.998557 0.0892299 2862 367388 1:11898859 1:11838802:G:A missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) DBH 3.81e-09 -0.1549 0.0002939 -0.289 rs77273740 9 133636606 C T 0.977463 0.0496668 970 367388 9:136501728 9:133636606:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Hypertensive diseases (excluding secondary) NPHS1 1.91e-20 28.798 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hypertensive diseases (excluding secondary) TUBB1 2.28e-08 0.1639 rs140943896 20 59024502 C T 0.990898 0.0381504 522 367388 20:57599557 20:59024502:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Hypertensive diseases (excluding secondary) ZNF831 4.31e-09 0.0764 0.0002627 0.06 rs56057707 20 59193688 C T 0.997045 0.249173 23224 367388 20:57768743 20:59193688:C:T missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) ZNF831 3.86e-09 0.0766 0.000235 0.06 rs55786258 20 59194085 G C 0.997155 0.249358 23250 367388 20:57769140 20:59194085:G:C missense_variant "" "" "" unknown Other heart diseases OR4A47 2.83e-09 1.9261 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Pulmonary heart disease FGA 2.11e-16 0.2367 1.334e-06 0.153 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Pulmonary heart disease CYP4V2 7.06e-09 0.1642 9.235e-08 0.101 rs13146272 4 186199057 C A 0.99987 0.667853 164276 367388 4:187120211 4:186199057:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Alzheimer's disease, wide definition ARHGAP45 8.39e-08 0.236 0.0009105 0.327 rs36084354 19 1079960 G A 0.990202 0.0847388 2778 367388 19:1079959 19:1079960:G:A missense_variant "" "" "" unknown Alzheimer's disease, wide definition ZNF155 2.61e-14 0.5338 0.003457 0.771 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition ZNF230 4.14e-15 0.5733 0.005084 0.768 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Alzheimer's disease, wide definition ZNF225 6.17e-18 0.6181 0.00155 0.834 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition ZNF227 1.6e-18 0.6267 0.001601 0.829 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Alzheimer's disease, wide definition ZNF229 8.99e-20 0.6737 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition APOE 4.17e-25 0.2817 5.633e-20 0.158 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Alzheimer's disease, wide definition APOE 5.04e-15 1.2218 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Alzheimer's disease, wide definition APOE 3.04e-283 1.2587 7.698e-147 1.617 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease, wide definition APOE 4.48e-16 -0.4456 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Alzheimer's disease, wide definition APOC4-APOC2 2.52e-32 0.2929 1.13e-19 0.212 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Alzheimer's disease, wide definition CLPTM1 1.19e-07 0.1955 5.105e-08 0.111 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Alzheimer's disease, wide definition PPP1R37 2.43e-26 0.5798 1.1e-05 0.657 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Alzheimer's disease, wide definition EXOC3L2 7.62e-11 0.5747 0.008209 0.904 rs189063316 19 45213106 C T 0.985129 0.0208744 168 367388 19:45716364 19:45213106:C:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition EXOC3L2 3.75e-20 0.3918 2.826e-05 0.376 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Alzheimer's disease, wide definition DMPK 1.63e-10 0.5224 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Alzheimer's disease, wide definition (more controls excluded) ZNF155 7.49e-15 0.5854 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) ZNF230 3.5e-15 0.6133 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) ZNF225 9.18e-18 0.6533 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) ZNF227 4.71e-18 0.6552 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) ZNF229 2.55e-19 0.7033 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) APOE 1.69e-22 0.2907 8.051e-19 0.167 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Alzheimer's disease, wide definition (more controls excluded) APOE 2.97e-13 1.1336 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Alzheimer's disease, wide definition (more controls excluded) APOE 3.64e-252 1.2158 1.34e-128 1.395 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer's disease, wide definition (more controls excluded) APOE 1.77e-16 -0.496 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Alzheimer's disease, wide definition (more controls excluded) APOC4-APOC2 1.97e-13 0.1969 2.899e-12 0.142 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) PPP1R37 6.44e-24 0.5811 2.435e-05 0.642 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) EXOC3L2 7.43e-11 0.604 rs189063316 19 45213106 C T 0.985129 0.0208744 168 367388 19:45716364 19:45213106:C:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) EXOC3L2 2.39e-18 0.3985 1.919e-05 0.414 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) DMPK 9.25e-11 0.5655 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Alzheimer disease ZNF155 2.47e-09 0.4888 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Alzheimer disease ZNF230 4.88e-10 0.5319 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Alzheimer disease ZNF225 1.09e-11 0.5696 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Alzheimer disease ZNF227 6.72e-12 0.573 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Alzheimer disease ZNF229 6.31e-13 0.6238 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Alzheimer disease APOE 2e-18 0.2791 2.521e-14 0.154 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Alzheimer disease APOE 4.93e-13 1.3455 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Alzheimer disease APOE 3.28e-210 1.286 3.396e-111 1.701 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer disease APOE 4.36e-12 -0.4452 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Alzheimer disease CLPTM1 6.53e-08 0.2344 2.473e-08 0.134 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Alzheimer disease PPP1R37 2.67e-18 0.5592 0.0002511 0.631 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Alzheimer disease EXOC3L2 1.3e-08 0.5905 rs189063316 19 45213106 C T 0.985129 0.0208744 168 367388 19:45716364 19:45213106:C:T missense_variant "" "" "" unknown Alzheimer disease EXOC3L2 1.43e-16 0.4143 0.004307 0.293 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Alzheimer disease DMPK 7.68e-09 0.5559 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Alzheimer disease (more controls excluded) ZNF155 3.04e-11 0.5958 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) ZNF230 2.76e-11 0.6142 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) ZNF225 3.75e-13 0.6559 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) ZNF227 3.55e-13 0.6525 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) ZNF229 5.22e-14 0.6982 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) APOE 1.77e-18 0.305 2.186e-15 0.174 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Alzheimer disease (more controls excluded) APOE 1.11e-11 1.2539 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Alzheimer disease (more controls excluded) APOE 8.77e-207 1.3156 1.638e-108 1.596 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Alzheimer disease (more controls excluded) APOE 9.43e-14 -0.5201 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Alzheimer disease (more controls excluded) CLPTM1 3.75e-08 0.2581 2.382e-08 0.145 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) PPP1R37 1.22e-18 0.5983 0.001019 0.56 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) EXOC3L2 2.54e-09 0.6555 rs189063316 19 45213106 C T 0.985129 0.0208744 168 367388 19:45716364 19:45213106:C:T missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) EXOC3L2 1.35e-15 0.4269 0.005054 0.314 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Alzheimer disease (more controls excluded) DMPK 1.09e-09 0.6301 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant Carpal tunnel syndrome THBS3 2.04e-09 1.8309 rs199935580 1 155200601 G A 0.935788 0.00087918 0 367388 1:155170392 1:155200601:G:A missense_variant "" "" "" unknown Carpal tunnel syndrome CBFA2T3 3.21e-08 0.2439 rs532600051 16 88877002 C T 0.955635 0.0374209 612 367388 16:88943410 16:88877002:C:T missense_variant "" "" "" unknown Diabethic neuropathy PTPN22 3.4e-08 -0.3384 5.779e-06 -0.156 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Other degenerative diseases of the nervous system ZNF230 2.11e-08 0.4278 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Other degenerative diseases of the nervous system ZNF225 1.02e-09 0.4574 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Other degenerative diseases of the nervous system ZNF227 7.78e-10 0.4585 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Other degenerative diseases of the nervous system ZNF229 2.54e-11 0.5169 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Other degenerative diseases of the nervous system APOE 2.62e-16 0.2362 5.577e-13 0.132 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Other degenerative diseases of the nervous system APOE 6.7e-13 1.2022 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Other degenerative diseases of the nervous system APOE 4.8e-185 1.0808 9.801e-100 1.425 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Other degenerative diseases of the nervous system APOE 1.82e-10 -0.3705 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Other degenerative diseases of the nervous system CLPTM1 1.68e-08 0.2226 5.112e-09 0.127 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Other degenerative diseases of the nervous system PPP1R37 4.9e-15 0.4499 0.0005653 0.534 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Other degenerative diseases of the nervous system EXOC3L2 4.26e-16 0.3689 0.002095 0.289 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Any gastric operation ABCG5 2.02e-18 0.1176 0.002557 0.095 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Any gastric operation ABCG8 1.56e-19 0.1203 0.0005629 0.106 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Gout, FINNGEN SLC2A9 2.6e-20 -0.3746 4.987e-07 -0.33 rs16890979 4 9920543 C T 0.999171 0.174763 11710 367388 4:9922167 4:9920543:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Gout, FINNGEN ZNF518B 7.67e-08 -0.1717 0.0003314 -0.128 rs66538112 4 10445544 C G 0.99801 0.306668 34634 367388 4:10447168 4:10445544:C:G missense_variant "" "" "" unknown Gout, FINNGEN ABCG2 4.85e-35 0.7437 6.662e-08 0.885 rs2231142 4 88131171 G T 0.999142 0.074801 1936 367388 4:89052323 4:88131171:G:T missense_variant drug response drug response Criteria_multSubmitter dominant Gout, FINNGEN ALDH16A1 9.83e-43 2.597 rs150414818 19 49465749 C G 0.943671 0.00927085 44 367388 19:49969006 19:49465749:C:G missense_variant "" "" "" unknown Gout, FINNGEN SIGLEC11 2.26e-11 0.7951 rs144427989 19 49960404 C G 0.98434 0.0171236 130 367388 19:50463661 19:49960404:C:G missense_variant "" "" "" unknown Idiopathic gout ABCG2 1.34e-08 0.6797 0.007565 0.819 rs2231142 4 88131171 G T 0.999142 0.074801 1936 367388 4:89052323 4:88131171:G:T missense_variant drug response drug response Criteria_multSubmitter dominant Idiopathic gout ALDH16A1 7.18e-20 4.0256 rs150414818 19 49465749 C G 0.943671 0.00927085 44 367388 19:49969006 19:49465749:C:G missense_variant "" "" "" unknown Gout, unspecified SLC2A9 1.1e-13 -0.3888 1.22e-05 -0.369 rs16890979 4 9920543 C T 0.999171 0.174763 11710 367388 4:9922167 4:9920543:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Gout, unspecified ABCG2 1.48e-21 0.7517 1.336e-05 0.951 rs2231142 4 88131171 G T 0.999142 0.074801 1936 367388 4:89052323 4:88131171:G:T missense_variant drug response drug response Criteria_multSubmitter dominant Gout, unspecified ALDH16A1 6.04e-15 1.8962 rs150414818 19 49465749 C G 0.943671 0.00927085 44 367388 19:49969006 19:49465749:C:G missense_variant "" "" "" unknown Gout, strict definition SLC2A9 1.37e-14 -0.4454 6.423e-06 -0.426 rs16890979 4 9920543 C T 0.999171 0.174763 11710 367388 4:9922167 4:9920543:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Gout, strict definition ABCG2 2.58e-23 0.8636 5.665e-05 0.933 rs2231142 4 88131171 G T 0.999142 0.074801 1936 367388 4:89052323 4:88131171:G:T missense_variant drug response drug response Criteria_multSubmitter dominant Gout, strict definition ALDH16A1 6.21e-26 2.9578 rs150414818 19 49465749 C G 0.943671 0.00927085 44 367388 19:49969006 19:49465749:C:G missense_variant "" "" "" unknown Age-related macular degeneration (whether dry or wet) CFH 6.52e-65 -0.5725 9.573e-17 -0.325 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Age-related macular degeneration (whether dry or wet) CFH 3.72e-93 -0.6101 1.221e-43 -0.319 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Age-related macular degeneration (whether dry or wet) CFHR4 3.11e-09 0.2158 4.888e-09 0.128 rs7417769 1 196907328 A G 0.984743 0.797636 235198 367388 1:196876458 1:196907328:A:G missense_variant "" "" "" unknown Age-related macular degeneration (whether dry or wet) CFHR4 9.88e-26 0.4496 4.145e-08 0.408 rs10494745 1 196918327 G A 0.982065 0.14476 7950 367388 1:196887457 1:196918327:G:A missense_variant "" "" "" unknown Age-related macular degeneration (whether dry or wet) CFHR5 6.39e-14 -0.595 rs565457964 1 196994128 C CAA 0.986447 0.0401347 602 367388 1:196963258 1:196994128:C:CAA pLoF (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Age-related macular degeneration (whether dry or wet) ASPM 1.6e-11 -0.4371 rs12138336 1 197101391 C G 0.989019 0.0582545 1270 367388 1:197070521 1:197101391:C:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Age-related macular degeneration (whether dry or wet) TACC2 8.95e-10 0.2873 rs2295876 10 122211207 T A 0.992586 0.11177 4770 367388 10:123970722 10:122211207:T:A missense_variant "" "" "" unknown Age-related macular degeneration (whether dry or wet) PLEKHA1 1.53e-14 0.2509 7.096e-16 0.167 rs1045216 10 122429681 A G 0.999948 0.708717 184508 367388 10:124189197 10:122429681:A:G missense_variant "" "" "" unknown Age-related macular degeneration (whether dry or wet) ARMS2 6.25e-118 0.8342 1.186e-102 1.083 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Age-related macular degeneration (whether dry or wet) C3 7.43e-08 0.2051 0.009741 0.148 rs2230199 19 6718376 G C 0.992747 0.181606 12230 367388 19:6718387 19:6718376:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter both Other cataract CASP7 3.04e-07 0.4321 2.469e-16 4.768 rs141266925 10 113725526 T C 0.995973 0.0150468 90 367388 10:115485285 10:113725526:T:C missense_variant "" "" "" unknown Senile cataract CASP7 4.98e-06 0.2494 2.32e-12 2.078 rs141266925 10 113725526 T C 0.995973 0.0150468 90 367388 10:115485285 10:113725526:T:C missense_variant "" "" "" unknown Senile cataract UBE3B 1.6e-10 0.0928 0.0001115 0.065 rs12303137 12 109533676 C G 0.99824 0.287135 30342 367388 12:109971481 12:109533676:C:G missense_variant "" "" "" recessive Senile cataract MMAB 1.16e-10 0.0924 0.0002529 0.06 rs10774775 12 109573425 C T 0.998186 0.298562 32718 367388 12:110011230 12:109573425:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Senile cataract LOXL1 6.16e-08 -0.0944 0.003918 -0.079 rs3825942 15 73927241 G A 0.998932 0.169233 10454 367388 15:74219582 15:73927241:G:A missense_variant risk factor risk factor no_Criteria dominant Disorders of choroid and retina CFH 8.96e-15 -0.117 0.0002613 -0.063 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Disorders of choroid and retina PLEKHA1 3.55e-08 0.0831 3.996e-08 0.053 rs1045216 10 122429681 A G 0.999948 0.708717 184508 367388 10:124189197 10:122429681:A:G missense_variant "" "" "" unknown Disorders of choroid and retina ARMS2 1.67e-37 0.2067 3.498e-36 0.27 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Disorders of choroid and retina INS 2.95e-07 0.0871 2.643e-08 0.056 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Corneal ulcer COL4A3 6.3e-08 0.312 rs57611801 2 227298737 C A 0.996557 0.0844448 2868 367388 2:228163453 2:227298737:C:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Glaucoma ANGPTL7 1.95e-12 -0.3457 rs147660927 1 11193760 C T 0.996496 0.0409621 704 367388 1:11253817 1:11193760:C:T missense_variant "" "" "" unknown Glaucoma DISP3 3.77e-08 -0.159 rs2072993 1 11519447 G C 0.99558 0.124699 5900 367388 1:11579504 1:11519447:G:C missense_variant "" "" "" unknown Glaucoma MGST3 8.16e-09 -0.1155 1.453e-07 -0.071 rs6667681 1 165661461 A G 0.996561 0.658867 159398 367388 1:165630698 1:165661461:A:G missense_variant "" "" "" unknown Glaucoma MYOC 8.22e-16 1.6399 rs74315329 1 171636338 G A 0.996943 0.00279541 4 367388 1:171605478 1:171636338:G:A pLoF (likely)Pathogenic Likely pathogenic Criteria_multSubmitter dominant Glaucoma LOXL1 7.8e-08 -0.1096 0.0004248 -0.079 rs1048661 15 73927205 G T 0.998416 0.314662 36626 367388 15:74219546 15:73927205:G:T missense_variant risk factor risk factor no_Criteria dominant Glaucoma LOXL1 1.19e-17 -0.2197 rs3825942 15 73927241 G A 0.998932 0.169233 10454 367388 15:74219582 15:73927241:G:A missense_variant risk factor risk factor no_Criteria dominant Use of antiglaucoma preparations and miotics LOXL1 1.58e-09 -0.2982 0.0008901 -0.179 rs1048661 15 73927205 G T 0.998416 0.314662 36626 367388 15:74219546 15:73927205:G:T missense_variant risk factor risk factor no_Criteria dominant Use of antiglaucoma preparations and miotics LOXL1 5.22e-10 -0.3878 rs3825942 15 73927241 G A 0.998932 0.169233 10454 367388 15:74219582 15:73927241:G:A missense_variant risk factor risk factor no_Criteria dominant Normotensive glaucoma SIX6 1.18e-08 -0.3609 8.887e-08 -0.216 rs33912345 14 60509819 C A 0.998812 0.709283 185600 367388 14:60976537 14:60509819:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Primary open-angle glaucoma, strict MYOC 1.82e-12 2.3823 rs74315329 1 171636338 G A 0.996943 0.00279541 4 367388 1:171605478 1:171636338:G:A pLoF (likely)Pathogenic Likely pathogenic Criteria_multSubmitter dominant Glaucoma, exfoliation LOXL1 8.71e-41 -0.6363 7.597e-13 -0.388 rs1048661 15 73927205 G T 0.998416 0.314662 36626 367388 15:74219546 15:73927205:G:T missense_variant risk factor risk factor no_Criteria dominant Glaucoma, exfoliation LOXL1 1.08e-52 -0.9598 7.169e-06 -0.437 rs3825942 15 73927241 G A 0.998932 0.169233 10454 367388 15:74219582 15:73927241:G:A missense_variant risk factor risk factor no_Criteria dominant Glaucoma, exfoliation RP11-247C2.2 4.5e-08 -0.3148 0.0006833 -0.314 rs2279379 15 74128669 C G 0.985753 0.177826 11624 367388 15:74421010 15:74128669:C:G missense_variant "" "" "" unknown Glaucoma, exfoliation STRA6 2.42e-08 0.274 1.713e-05 0.265 rs971756 15 74195628 A T 0.998982 0.261946 24978 367388 15:74487969 15:74195628:A:T missense_variant "" "" "" recessive Primary open-angle glaucoma ANGPTL7 1.35e-08 -0.3816 rs147660927 1 11193760 C T 0.996496 0.0409621 704 367388 1:11253817 1:11193760:C:T missense_variant "" "" "" unknown Primary open-angle glaucoma MYOC 2.61e-15 2.3522 rs74315329 1 171636338 G A 0.996943 0.00279541 4 367388 1:171605478 1:171636338:G:A pLoF (likely)Pathogenic Likely pathogenic Criteria_multSubmitter dominant Primary open-angle glaucoma LOXL1 9.57e-11 -0.1818 0.0003243 -0.111 rs1048661 15 73927205 G T 0.998416 0.314662 36626 367388 15:74219546 15:73927205:G:T missense_variant risk factor risk factor no_Criteria dominant Primary open-angle glaucoma LOXL1 1.13e-21 -0.3427 rs3825942 15 73927241 G A 0.998932 0.169233 10454 367388 15:74219582 15:73927241:G:A missense_variant risk factor risk factor no_Criteria dominant Glaucoma suspect MYOC 3.12e-10 1.7081 rs74315329 1 171636338 G A 0.996943 0.00279541 4 367388 1:171605478 1:171636338:G:A pLoF (likely)Pathogenic Likely pathogenic Criteria_multSubmitter dominant Glaucoma suspect LOXL1 3.42e-11 -0.2209 rs3825942 15 73927241 G A 0.998932 0.169233 10454 367388 15:74219582 15:73927241:G:A missense_variant risk factor risk factor no_Criteria dominant Hereditary retinal dystrophy CERKL 1.24e-12 8.4423 1.319e-16 210.807 rs200711686 2 181603943 G C 0.994958 0.00563165 20 367388 2:182468670 2:181603943:G:C missense_variant "" "" "" unknown Acute and subacute iridocyclitis CAST 4.66e-11 -0.2082 2.528e-06 -0.16 rs754615 5 96750630 G C 0.997304 0.334039 41514 367388 5:96086334 5:96750630:G:C missense_variant "" "" "" recessive Acute and subacute iridocyclitis ERAP1 2.36e-08 -0.2116 0.002377 -0.168 rs17482078 5 96783162 C T 0.997576 0.195752 14312 367388 5:96118866 5:96783162:C:T missense_variant "" "" "" unknown Acute and subacute iridocyclitis ERAP1 1.15e-08 -0.2157 0.001563 -0.174 rs10050860 5 96786506 C T 0.998006 0.197285 14534 367388 5:96122210 5:96786506:C:T missense_variant "" "" "" unknown Acute and subacute iridocyclitis ERAP1 1.45e-08 -0.214 0.001506 -0.174 rs2287987 5 96793832 T C 0.99893 0.197489 14586 367388 5:96129535 5:96793832:T:C missense_variant "" "" "" unknown Iridocyclitis CAST 3.67e-11 -0.195 2.747e-06 -0.148 rs754615 5 96750630 G C 0.997304 0.334039 41514 367388 5:96086334 5:96750630:G:C missense_variant "" "" "" recessive Iridocyclitis ERAP1 9.42e-08 -0.188 0.008422 -0.135 rs17482078 5 96783162 C T 0.997576 0.195752 14312 367388 5:96118866 5:96783162:C:T missense_variant "" "" "" unknown Iridocyclitis ERAP1 4.18e-08 -0.1926 0.005594 -0.141 rs10050860 5 96786506 C T 0.998006 0.197285 14534 367388 5:96122210 5:96786506:C:T missense_variant "" "" "" unknown Iridocyclitis ERAP1 4.55e-07 -0.1465 9.673e-08 -0.106 rs30187 5 96788627 T C 0.998908 0.648385 154384 367388 5:96124330 5:96788627:T:C missense_variant "" "" "" unknown Iridocyclitis ERAP1 6.1e-08 -0.1901 0.005354 -0.141 rs2287987 5 96793832 T C 0.99893 0.197489 14586 367388 5:96129535 5:96793832:T:C missense_variant "" "" "" unknown Disorders of lens ZNF800 5.25e-09 0.1782 rs62621812 7 127375029 G A 0.982132 0.0427396 702 367388 7:127015083 7:127375029:G:A missense_variant "" "" "" unknown Disorders of lens CASP7 2.68e-07 0.2625 6.377e-16 2.239 rs141266925 10 113725526 T C 0.995973 0.0150468 90 367388 10:115485285 10:113725526:T:C missense_variant "" "" "" unknown Disorders of lens UBE3B 6.38e-10 0.0839 0.000118 0.061 rs12303137 12 109533676 C G 0.99824 0.287135 30342 367388 12:109971481 12:109533676:C:G missense_variant "" "" "" recessive Disorders of lens MMAB 1.9e-10 0.0854 0.0002499 0.056 rs10774775 12 109573425 C T 0.998186 0.298562 32718 367388 12:110011230 12:109573425:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Degeneration of macula and posterior pole CFH 1.35e-39 -0.3272 6.947e-11 -0.187 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Degeneration of macula and posterior pole CFHR4 2.37e-13 0.2318 3.336e-07 0.282 rs10494745 1 196918327 G A 0.982065 0.14476 7950 367388 1:196887457 1:196918327:G:A missense_variant "" "" "" unknown Degeneration of macula and posterior pole CFHR5 2.81e-11 -0.3891 rs565457964 1 196994128 C CAA 0.986447 0.0401347 602 367388 1:196963258 1:196994128:C:CAA pLoF (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Degeneration of macula and posterior pole PLEKHA1 8.24e-11 0.1583 2.295e-10 0.099 rs1045216 10 122429681 A G 0.999948 0.708717 184508 367388 10:124189197 10:122429681:A:G missense_variant "" "" "" unknown Degeneration of macula and posterior pole ARMS2 3.34e-73 0.4815 6.061e-68 0.634 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Diabetic maculopathy PTPN22 6.86e-11 -0.3602 4.064e-10 -0.194 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic maculopathy INS 8.66e-11 0.3252 1.134e-12 0.209 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetic maculopathy INS 2.11e-09 -0.3352 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic maculopathy AIRE 2.2e-09 0.6426 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Retinal breaks without detachment FAT3 1.83e-16 -0.314 0.0001833 -0.147 rs10765565 11 92840745 G T 0.997165 0.348876 44932 367388 11:92573911 11:92840745:G:T missense_variant "" "" "" unknown Retinal detachments and breaks FAT3 3.73e-08 -0.129 rs10765565 11 92840745 G T 0.997165 0.348876 44932 367388 11:92573911 11:92840745:G:T missense_variant "" "" "" unknown Other retinal disorders PTPN22 7.87e-09 -0.1302 5.054e-07 -0.064 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Other retinal disorders CFH 2.91e-22 -0.173 5.77e-05 -0.082 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Other retinal disorders PLEKHA1 3.6e-09 0.1047 1.765e-08 0.064 rs1045216 10 122429681 A G 0.999948 0.708717 184508 367388 10:124189197 10:122429681:A:G missense_variant "" "" "" unknown Other retinal disorders ARMS2 1.78e-46 0.2738 3.202e-44 0.359 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Other retinal disorders INS 4.43e-10 0.125 1.294e-11 0.081 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Other retinal disorders INS 4.31e-08 -0.1225 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic retinopathy PTPN22 2.6e-19 -0.3535 8.548e-16 -0.178 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic retinopathy INS 5.55e-19 0.3219 2.828e-21 0.2 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetic retinopathy INS 5.35e-15 -0.3154 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic retinopathy AIRE 9.48e-11 0.4844 0.005215 0.667 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Diabetic background retinopathy PTPN22 1.77e-15 -0.4121 1.892e-12 -0.204 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetic background retinopathy INS 2.42e-12 0.3284 2.491e-15 0.217 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetic background retinopathy INS 7.72e-10 -0.3205 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Other diabetic retinopathy PTPN22 1.71e-09 -0.4339 7.359e-07 -0.2 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Other diabetic retinopathy INS 3.72e-08 0.3661 6.248e-09 0.225 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Proliferative diabetic retinopathy PTPN22 1.12e-11 -0.4285 5.695e-10 -0.219 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Proliferative diabetic retinopathy INS 8.4e-09 0.3314 3.643e-10 0.211 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Proliferative diabetic retinopathy INS 8.13e-08 -0.3455 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Conductive and sensorineural hearing loss MYH14 1.38e-11 2.6128 rs371254530 19 50276163 G A 0.834815 0.000440951 0 367388 19:50779420 19:50276163:G:A missense_variant "" "" "" dominant Conductive hearing loss, unspecified LRBA 1.65e-07 5.8295 rs145709687 4 150265730 G A 0.962385 0.000871014 4 367388 4:151186882 4:150265730:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Sudden idiopathic hearing loss TUBA1C 1.05e-11 4.6907 rs200317762 12 49272869 C T 0.89128 0.00210132 0 367388 12:49666652 12:49272869:C:T missense_variant "" "" "" unknown Sensorineural hearing loss MYH14 5.43e-12 2.8285 rs371254530 19 50276163 G A 0.834815 0.000440951 0 367388 19:50779420 19:50276163:G:A missense_variant "" "" "" dominant Diseases of middle ear and mastoid CDHR3 8.88e-09 0.0995 rs6967330 7 106018005 G A 0.982788 0.26628 26022 367388 7:105658451 7:106018005:G:A missense_variant "" "" "" unknown Other disorders of ear C10orf90 5.87e-05 0.2601 4.82e-11 4.744 rs139123090 10 126459169 G A 0.962755 0.00847333 26 367388 10:128147738 10:126459169:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Other disorders of ear MYH14 3.18e-10 2.0811 rs371254530 19 50276163 G A 0.834815 0.000440951 0 367388 19:50779420 19:50276163:G:A missense_variant "" "" "" dominant Other hearing loss TUBA1C 2.3e-08 2.0583 rs200317762 12 49272869 C T 0.89128 0.00210132 0 367388 12:49666652 12:49272869:C:T missense_variant "" "" "" unknown Vestibular neuronitis TUBA1C 2.48e-08 3.9485 rs200317762 12 49272869 C T 0.89128 0.00210132 0 367388 12:49666652 12:49272869:C:T missense_variant "" "" "" unknown Hypothyroidism (congenital or acquired) PTPN22 1.34e-50 -0.3071 9.381e-46 -0.166 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Hypothyroidism (congenital or acquired) DCLRE1B 3.41e-10 0.1189 4.074e-05 0.114 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Hypothyroidism (congenital or acquired) IFIH1 1.24e-07 0.0806 6.856e-09 0.065 rs1990760 2 162267541 C T 0.998473 0.584121 125682 367388 2:163124051 2:162267541:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Hypothyroidism, levothyroxin purchases PTPN22 7.13e-51 -0.309 5.05e-46 -0.168 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Hypothyroidism, levothyroxin purchases DCLRE1B 4.53e-10 0.1184 2.625e-05 0.117 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Hypothyroidism, levothyroxin purchases IFIH1 9.32e-08 0.0817 3.765e-09 0.066 rs1990760 2 162267541 C T 0.998473 0.584121 125682 367388 2:163124051 2:162267541:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Hypothyroidism, levothyroxin purchases C1QTNF6 6.34e-08 0.1057 0.0009863 0.098 rs229526 22 37185382 G C 0.99534 0.178248 11840 367388 22:37581422 22:37185382:G:C missense_variant "" "" "" unknown Hypothyroidism and >3 levothyroxin purchases PTPN22 9.79e-51 -0.3089 7.093e-46 -0.167 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Hypothyroidism and >3 levothyroxin purchases DCLRE1B 4.05e-10 0.1188 2.812e-05 0.116 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Hypothyroidism and >3 levothyroxin purchases IFIH1 1e-07 0.0815 4.843e-09 0.066 rs1990760 2 162267541 C T 0.998473 0.584121 125682 367388 2:163124051 2:162267541:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Hypothyroidism and >3 levothyroxin purchases C1QTNF6 7.37e-08 0.1053 0.001063 0.098 rs229526 22 37185382 G C 0.99534 0.178248 11840 367388 22:37581422 22:37185382:G:C missense_variant "" "" "" unknown Hypothyroidism, drug reimbursement PTPN22 1.01e-44 -0.4593 2.48e-37 -0.237 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Hypothyroidism, drug reimbursement DCLRE1B 2.31e-12 0.2075 7.79e-06 0.194 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Atrial fibrillation and flutter PLEKHA3 4.16e-08 0.1152 rs967507 2 178502359 A G 0.991476 0.175311 11362 367388 2:179367086 2:178502359:A:G missense_variant "" "" "" unknown Atrial fibrillation and flutter TTN 1.33e-08 0.1253 rs3829747 2 178532834 C T 0.997778 0.152806 8782 367388 2:179397561 2:178532834:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 1.15e-08 0.1258 rs3731749 2 178541464 C T 0.997761 0.152735 8770 367388 2:179406191 2:178541464:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 9.15e-10 0.1096 0.004783 0.059 rs9808377 2 178556967 A G 0.997814 0.27606 28118 367388 2:179421694 2:178556967:A:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 1.21e-09 0.1088 0.003519 0.061 rs3829746 2 178562809 T C 0.997256 0.276525 28192 367388 2:179427536 2:178562809:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 1.43e-09 0.129 rs3731746 2 178566270 G A 0.997177 0.167319 10538 367388 2:179430997 2:178566270:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 1.18e-08 0.1258 rs744426 2 178571293 G A 0.997151 0.152757 8782 367388 2:179436020 2:178571293:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 1.27e-09 0.1292 rs2303838 2 178580212 C T 0.997149 0.16813 10646 367388 2:179444939 2:178580212:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 6.82e-10 0.1105 0.004713 0.059 rs2042996 2 178586693 G A 0.997769 0.275681 28028 367388 2:179451420 2:178586693:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 8.05e-09 0.1273 rs16866406 2 178592420 G A 0.997261 0.152417 8750 367388 2:179457147 2:178592420:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 1.03e-09 0.1091 0.003331 0.061 rs1001238 2 178599800 T C 0.997761 0.277598 28424 367388 2:179464527 2:178599800:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter TTN 4.58e-08 0.101 0.002879 0.069 rs2042995 2 178693639 T C 0.996896 0.251633 23328 367388 2:179558366 2:178693639:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter CAND2 3.22e-09 0.0985 1.562e-09 0.071 rs11718898 3 12807323 T C 0.998826 0.615325 139138 367388 3:12848822 3:12807323:T:C missense_variant "" "" "" unknown Atrial fibrillation and flutter CAND2 1.23e-08 0.0922 4.671e-10 0.08 rs2305397 3 12815994 C T 0.997961 0.516266 97996 367388 3:12857493 3:12815994:C:T missense_variant "" "" "" unknown Atrial fibrillation and flutter CAND2 7.49e-08 0.0875 2.234e-09 0.074 rs3732675 3 12816529 T C 0.996645 0.548502 110458 367388 3:12858028 3:12816529:T:C missense_variant "" "" "" unknown Atrial fibrillation and flutter CAND2 4.84e-08 0.0894 9.256e-10 0.076 rs3732678 3 12817505 A C 0.984711 0.556491 113762 367388 3:12859004 3:12817505:A:C missense_variant "" "" "" unknown Atrial fibrillation and flutter PITX2 5.62e-08 0.4126 rs143452464 4 110622340 G A 0.995482 0.0099976 42 367388 4:111543496 4:110622340:G:A missense_variant "" "" "" dominant Atrial fibrillation and flutter RPL3L 6.23e-11 0.4541 0.003358 0.959 rs147972626 16 1947063 G A 0.985314 0.0128475 78 367388 16:1997064 16:1947063:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Atrial fibrillation and flutter RPL3L 9.73e-08 0.4027 rs201864074 16 1954141 C T 0.985791 0.0108142 76 367388 16:2004142 16:1954141:C:T missense_variant "" "" "" unknown Atrial fibrillation and flutter MYH14 5.45e-09 0.3329 rs199600574 19 50301724 C T 0.992516 0.0188357 116 367388 19:50804981 19:50301724:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Atrial fibrillation and flutter with reimbursement TTN 6.62e-09 0.1339 rs9808377 2 178556967 A G 0.997814 0.27606 28118 367388 2:179421694 2:178556967:A:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement TTN 7.78e-09 0.1333 rs3829746 2 178562809 T C 0.997256 0.276525 28192 367388 2:179427536 2:178562809:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement TTN 4.22e-08 0.1509 rs3731746 2 178566270 G A 0.997177 0.167319 10538 367388 2:179430997 2:178566270:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement TTN 4.31e-08 0.1505 rs2303838 2 178580212 C T 0.997149 0.16813 10646 367388 2:179444939 2:178580212:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement TTN 4.84e-09 0.1352 rs2042996 2 178586693 G A 0.997769 0.275681 28028 367388 2:179451420 2:178586693:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement TTN 7.09e-08 0.1534 rs16866406 2 178592420 G A 0.997261 0.152417 8750 367388 2:179457147 2:178592420:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement TTN 4.7e-09 0.1351 rs1001238 2 178599800 T C 0.997761 0.277598 28424 367388 2:179464527 2:178599800:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement TTN 3.31e-08 0.1318 rs2042995 2 178693639 T C 0.996896 0.251633 23328 367388 2:179558366 2:178693639:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Atrial fibrillation and flutter with reimbursement CAND2 3.91e-08 0.1181 6.707e-08 0.082 rs11718898 3 12807323 T C 0.998826 0.615325 139138 367388 3:12848822 3:12807323:T:C missense_variant "" "" "" unknown Atrial fibrillation and flutter with reimbursement CAND2 1.32e-07 0.1118 3.589e-08 0.088 rs3732678 3 12817505 A C 0.984711 0.556491 113762 367388 3:12859004 3:12817505:A:C missense_variant "" "" "" unknown Atrial fibrillation and flutter with reimbursement RPL3L 1.74e-11 0.6055 3.467e-05 1.47 rs147972626 16 1947063 G A 0.985314 0.0128475 78 367388 16:1997064 16:1947063:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Angina pectoris PCSK9 8.92e-09 -0.2323 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Angina pectoris LPA 1.17e-09 0.4396 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Angina pectoris HHIPL1 7.18e-08 0.3931 0.0004641 1.212 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Angina pectoris ADAMTS7 2.57e-11 -0.1049 5.473e-10 -0.068 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Angina pectoris ADAMTS7 3.22e-10 -0.1006 1.114e-09 -0.066 rs2929155 15 78765671 C T 0.997093 0.662722 161412 367388 15:79058013 15:78765671:C:T missense_variant "" "" "" unknown Angina pectoris ADAMTS7 1.21e-10 0.1009 9.095e-06 0.069 rs2127898 15 78790778 G A 0.998281 0.366991 49614 367388 15:79083120 15:78790778:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Angina pectoris ADAMTS7 6.73e-09 -0.0921 0.0005259 -0.057 rs3825807 15 78796769 A G 0.993652 0.346846 44336 367388 15:79089111 15:78796769:A:G missense_variant (likely)Benign Benign no_Criteria unknown Angina pectoris MFGE8 1.11e-08 -0.2586 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Angina pectoris APOE 3.61e-10 -0.2111 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Coronary angiopasty LPA 7.3e-11 0.6613 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown AV-block TTN 4.97e-08 0.4599 0.0003225 0.996 rs72648257 2 178546284 T C 0.997867 0.0513218 1056 367388 2:179411011 2:178546284:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both AV-block TTN 4.54e-08 0.4615 0.0003037 1.003 rs3731745 2 178566867 A G 0.998783 0.0512973 1048 367388 2:179431594 2:178566867:A:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both AV-block TTN 4.68e-08 0.4609 0.0002889 1.01 rs56018860 2 178568494 T C 0.999977 0.0513163 1044 367388 2:179433221 2:178568494:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both AV-block TTN 4.54e-08 0.4615 0.0003037 1.003 rs3813246 2 178568853 T C 0.998783 0.0512973 1048 367388 2:179433580 2:178568853:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both AV-block TTN 4.54e-08 0.4615 0.0003037 1.003 rs3813245 2 178569412 A G 0.998784 0.0513 1048 367388 2:179434139 2:178569412:A:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both AV-block TTN 4.02e-08 0.4593 0.0004724 0.939 rs2303832 2 178607565 T A 0.998666 0.0521084 1090 367388 2:179472292 2:178607565:T:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both AV-block TTN 4.07e-08 0.459 0.0005004 0.931 rs2288563 2 178634803 T C 0.998703 0.0521574 1126 367388 2:179499530 2:178634803:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Coronary artery bypass grafting PCSK9 2.14e-09 -0.4072 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Coronary artery bypass grafting WDR12 6.15e-11 0.257 6.863e-08 0.449 rs35212307 2 202901033 T C 0.999968 0.113398 4708 367388 2:203765756 2:202901033:T:C missense_variant "" "" "" unknown Coronary artery bypass grafting CARF 5.18e-11 0.2578 1.438e-07 0.436 rs72932557 2 202982094 A T 0.999969 0.113825 4706 367388 2:203846817 2:202982094:A:T missense_variant "" "" "" unknown Coronary artery bypass grafting ADAMTS7 1.06e-12 -0.1835 2.203e-10 -0.115 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Coronary artery bypass grafting ADAMTS7 3.18e-11 -0.1741 1.649e-10 -0.114 rs2929155 15 78765671 C T 0.997093 0.662722 161412 367388 15:79058013 15:78765671:C:T missense_variant "" "" "" unknown Coronary artery bypass grafting ADAMTS7 2.3e-06 0.2304 rs189146505 15 78766388 A G 0.989541 0.0678683 1692 367388 15:79058730 15:78766388:A:G missense_variant "" "" "" unknown Coronary artery bypass grafting ADAMTS7 4.84e-11 0.1687 4.14e-06 0.117 rs2127898 15 78790778 G A 0.998281 0.366991 49614 367388 15:79083120 15:78790778:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Coronary artery bypass grafting MFGE8 8.01e-08 -0.4044 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Coronary artery bypass grafting FANCI 8.92e-08 -0.4631 rs139814895 15 89292706 A G 0.999691 0.0217672 206 367388 15:89835937 15:89292706:A:G missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Coronary artery bypass grafting FANCI 2.29e-07 -0.448 rs151178507 15 89293988 C G 0.999248 0.0217699 204 367388 15:89837219 15:89293988:C:G missense_variant "" "" "" recessive Coronary artery bypass grafting FANCI 1.64e-07 -0.4554 rs118031800 15 89295062 A C 0.999247 0.0215903 202 367388 15:89838293 15:89295062:A:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Cardiomyopathies, Primary/intrinsic BAG3 2.5e-08 -0.247 rs2234962 10 119670121 T C 0.99553 0.221823 18100 367388 10:121429633 10:119670121:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter dominant Cardiomyopathies, Primary/intrinsic MYBPC3 1.04e-08 6.8876 rs397516005 11 47333566 G A 0.827562 0.000315742 0 367388 11:47355117 11:47333566:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Cardiomyopathies, Primary/intrinsic OR4A47 1.46e-10 11.4481 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Cardiomyopathy MYBPC3 6.37e-15 8.5363 rs397516005 11 47333566 G A 0.827562 0.000315742 0 367388 11:47355117 11:47333566:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Cardiomyopathy OR4A47 2.62e-18 13.5825 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Cardiomyopathy, Hypertrophic obstructive MYBPC3 1.5e-15 34.5367 rs397516005 11 47333566 G A 0.827562 0.000315742 0 367388 11:47355117 11:47333566:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Cardiomyopathy, Hypertrophic obstructive OR4A47 4.47e-16 48.9426 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Major coronary heart disease event PCSK9 7.38e-10 -0.239 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Major coronary heart disease event WDR12 4.57e-10 0.1422 1.68e-06 0.22 rs35212307 2 202901033 T C 0.999968 0.113398 4708 367388 2:203765756 2:202901033:T:C missense_variant "" "" "" unknown Major coronary heart disease event CARF 2.53e-10 0.1441 2.043e-06 0.218 rs72932557 2 202982094 A T 0.999969 0.113825 4706 367388 2:203846817 2:202982094:A:T missense_variant "" "" "" unknown Major coronary heart disease event EDNRA 9.16e-08 -0.2502 rs192190120 4 147485937 A G 0.997989 0.0238957 240 367388 4:148407089 4:147485937:A:G missense_variant "" "" "" dominant Major coronary heart disease event SLC22A1 4.7e-08 0.4132 rs2282143 6 160136611 C T 0.999447 0.0095131 42 367388 6:160557643 6:160136611:C:T missense_variant "" "" "" unknown Major coronary heart disease event LPA 9.61e-15 0.5372 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Major coronary heart disease event HHIPL1 1.13e-09 0.4282 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Major coronary heart disease event ADAMTS7 4.55e-10 -0.0937 1.241e-09 -0.064 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Major coronary heart disease event ADAMTS7 2.7e-08 -0.085 9.465e-09 -0.059 rs2929155 15 78765671 C T 0.997093 0.662722 161412 367388 15:79058013 15:78765671:C:T missense_variant "" "" "" unknown Major coronary heart disease event ADAMTS7 1.67e-08 0.0845 0.0002466 0.054 rs2127898 15 78790778 G A 0.998281 0.366991 49614 367388 15:79083120 15:78790778:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Major coronary heart disease event MFGE8 1.05e-07 -0.2294 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Major coronary heart disease event APOE 3.07e-10 -0.2032 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Major coronary heart disease event excluding revascularizations PCSK9 3.61e-08 -0.2278 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Major coronary heart disease event excluding revascularizations LPA 2.1e-08 0.4151 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Major coronary heart disease event excluding revascularizations HHIPL1 8.59e-09 0.4397 0.008091 1.001 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Major coronary heart disease event excluding revascularizations APOE 4.98e-09 -0.2015 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Coronary atherosclerosis PCSK9 4.59e-09 -0.2185 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Coronary atherosclerosis LPA 5.03e-15 0.5225 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Coronary atherosclerosis HHIPL1 8.44e-08 0.3616 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Coronary atherosclerosis ADAMTS7 2.04e-11 -0.097 4.486e-10 -0.063 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Coronary atherosclerosis ADAMTS7 2.16e-09 -0.0881 9.528e-09 -0.057 rs2929155 15 78765671 C T 0.997093 0.662722 161412 367388 15:79058013 15:78765671:C:T missense_variant "" "" "" unknown Coronary atherosclerosis ADAMTS7 8e-08 -0.0784 0.001148 -0.049 rs3825807 15 78796769 A G 0.993652 0.346846 44336 367388 15:79089111 15:78796769:A:G missense_variant (likely)Benign Benign no_Criteria unknown Coronary atherosclerosis MFGE8 2.81e-12 -0.2933 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Coronary atherosclerosis FANCI 1.26e-07 -0.2522 rs151178507 15 89293988 C G 0.999248 0.0217699 204 367388 15:89837219 15:89293988:C:G missense_variant "" "" "" recessive Coronary atherosclerosis APOE 6.35e-16 -0.2524 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Cardiovascular diseases OR4A47 2.88e-08 1.4778 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Cardiovascular diseases NPHS1 3.42e-12 4.083 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hard cardiovascular diseases LPA 5.97e-08 0.314 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Hard cardiovascular diseases HHIPL1 1.77e-12 0.4267 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Hard cardiovascular diseases APOE 1.06e-07 -0.1453 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified PNO1 9.69e-12 0.084 1.221e-10 0.052 rs2044693 2 68157965 A G 0.998143 0.698063 179452 367388 2:68385097 2:68157965:A:G missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified STAB2 7.24e-08 0.2465 0.001931 0.715 rs142351376 12 103742510 C T 0.989115 0.0158116 110 367388 12:104136288 12:103742510:C:T missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified MVD 2.74e-11 0.1119 0.0006529 0.102 rs6500486 16 88657221 C T 0.990479 0.131172 6566 367388 16:88723629 16:88657221:C:T missense_variant "" "" "" dominant Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified CTU2 7.15e-10 -0.0958 rs4782321 16 88713767 G A 0.996047 0.157232 9178 367388 16:88780175 16:88713767:G:A missense_variant "" "" "" recessive Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified CTU2 4.24e-10 -0.0971 rs11549835 16 88714665 G A 0.995763 0.157006 9248 367388 16:88781073 16:88714665:G:A missense_variant "" "" "" recessive Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified PIEZO1 8.33e-11 -0.1012 rs35265318 16 88734377 C T 0.990556 0.156998 9242 367388 16:88800785 16:88734377:C:T missense_variant "" "" "" both Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified PIEZO1 9.24e-17 -0.1343 2.068e-14 -0.07 rs7184427 16 88738326 A G 0.990994 0.857227 270348 367388 16:88804734 16:88738326:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter both Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified PIEZO1 3.51e-14 0.1349 0.001607 0.107 rs7404939 16 88741488 G A 0.993057 0.113833 5070 367388 16:88807896 16:88741488:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified PIEZO1 2.9e-15 -0.1366 1.85e-14 -0.073 rs6500495 16 88742335 A G 0.992311 0.878551 283850 367388 16:88808743 16:88742335:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified CDT1 9.28e-08 0.1434 rs561655241 16 88804016 C T 0.98579 0.0472226 966 367388 16:88870424 16:88804016:C:T missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified PABPN1L 5.46e-08 -0.124 0.00243 -0.173 rs76267236 16 88864866 C T 0.983154 0.0667414 1800 367388 16:88931274 16:88864866:C:T missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified GJD3 1.42e-09 -0.3044 rs201955556 17 40363641 G T 0.983118 0.0135198 76 367388 17:38519893 17:40363641:G:T missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified KLF2 3.34e-07 -0.0706 1.632e-08 -0.047 rs3745318 19 16325451 T C 0.98401 0.785997 227290 367388 19:16436262 19:16325451:T:C missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism F5 2.78e-11 -0.1548 8.184e-05 -0.124 rs6032 1 169542317 T C 0.999844 0.222971 18406 367388 1:169511555 1:169542317:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both DVT of lower extremities and pulmonary embolism F5 2.49e-11 -0.1553 0.0001054 -0.122 rs4525 1 169542496 T C 0.999415 0.222694 18342 367388 1:169511734 1:169542496:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both DVT of lower extremities and pulmonary embolism F5 1.95e-11 -0.156 7.933e-05 -0.124 rs4524 1 169542517 T C 0.999979 0.223143 18404 367388 1:169511755 1:169542517:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both DVT of lower extremities and pulmonary embolism KIFAP3 1.64e-10 0.5833 0.009466 1.42 rs200944427 1 169961073 C T 0.989982 0.0122867 84 367388 1:169930214 1:169961073:C:T missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism FGA 3.08e-20 0.1913 2.071e-10 0.146 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both DVT of lower extremities and pulmonary embolism CYP4V2 1.83e-10 0.1304 3.98e-10 0.086 rs13146272 4 186199057 C A 0.99987 0.667853 164276 367388 4:187120211 4:186199057:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive DVT of lower extremities and pulmonary embolism OBP2B 1.14e-12 0.2499 rs11244035 9 133205932 C T 0.969814 0.0871014 2788 367388 9:136081319 9:133205932:C:T missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism STKLD1 5.21e-12 0.2389 0.005976 0.212 rs41302673 9 133405414 T G 0.988635 0.0881656 2996 367388 9:136270538 9:133405414:T:G missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism CREB3L1 1.61e-10 1.0443 rs187725533 11 46311035 A T 0.991819 0.00412915 12 367388 11:46332586 11:46311035:A:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter recessive DVT of lower extremities and pulmonary embolism MYBPC3 1.16e-07 1.0285 rs370890951 11 47332912 A G 0.984542 0.0029179 6 367388 11:47354463 11:47332912:A:G missense_variant (likely)Benign Likely benign Criteria_multSubmitter dominant DVT of lower extremities and pulmonary embolism STAB2 9.46e-12 0.5622 0.001073 1.474 rs142351376 12 103742510 C T 0.989115 0.0158116 110 367388 12:104136288 12:103742510:C:T missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism MYH7B 8.98e-10 0.1711 0.0001776 0.183 rs11906160 20 34977952 G A 0.99573 0.139482 7290 367388 20:33565755 20:34977952:G:A missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism PROCR 2.93e-10 0.1803 0.000761 0.173 rs867186 20 35176751 A G 0.997985 0.131999 6442 367388 20:33764554 20:35176751:A:G missense_variant "" "" "" unknown Hypertensive diseases AGTRAP 8.59e-08 -0.0838 rs17875987 1 11744533 T G 0.977673 0.114261 4894 367388 1:11804590 1:11744533:T:G missense_variant "" "" "" unknown Hypertensive diseases C1orf167 5.69e-15 -0.1218 rs41275456 1 11775499 C T 0.998016 0.113763 4696 367388 1:11835556 1:11775499:C:T missense_variant "" "" "" unknown Hypertensive diseases C1orf167 5.63e-15 -0.1217 rs56001051 1 11778784 A G 0.998335 0.113771 4698 367388 1:11838841 1:11778784:A:G missense_variant "" "" "" unknown Hypertensive diseases C1orf167 5.63e-15 -0.1217 rs55967531 1 11778977 G A 0.998337 0.113771 4698 367388 1:11839034 1:11778977:G:A missense_variant "" "" "" unknown Hypertensive diseases C1orf167 2.65e-15 -0.1163 0.002353 -0.083 rs12561919 1 11779866 C T 0.998026 0.13029 6142 367388 1:11839923 1:11779866:C:T missense_variant "" "" "" unknown Hypertensive diseases C1orf167 1.27e-14 -0.1197 0.004973 -0.086 rs55867221 1 11785165 T C 0.998181 0.114794 4782 367388 1:11845222 1:11785165:T:C missense_variant "" "" "" unknown Hypertensive diseases C1orf167 1.26e-14 -0.1197 0.004997 -0.086 rs1537514 1 11788011 G C 0.998178 0.114791 4782 367388 1:11848068 1:11788011:G:C missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Hypertensive diseases CLCN6 1.28e-18 -0.1532 0.004854 -0.11 rs55741089 1 11838802 G A 0.998557 0.0892299 2862 367388 1:11898859 1:11838802:G:A missense_variant "" "" "" unknown Hypertensive diseases DBH 6.16e-13 -0.1642 2.029e-05 -0.289 rs77273740 9 133636606 C T 0.977463 0.0496668 970 367388 9:136501728 9:133636606:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Hypertensive diseases FAM109A 1.62e-07 -0.0624 rs779454863 12 111363022 TGCCACCCCC T 0.995756 0.218706 18132 367388 12:111800826 12:111363022:TGCCACCCCC:T inframe_indel "" "" "" unknown Hypertensive diseases ACE 9.73e-07 -0.0839 rs4298 17 63479839 C T 0.991668 0.0922104 3160 367388 17:61557200 17:63479839:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Hypertensive diseases TUBB1 1.11e-09 0.1569 rs140943896 20 59024502 C T 0.990898 0.0381504 522 367388 20:57599557 20:59024502:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Hypertensive diseases ZNF831 1.29e-09 0.069 0.0002385 0.053 rs56057707 20 59193688 C T 0.997045 0.249173 23224 367388 20:57768743 20:59193688:C:T missense_variant "" "" "" unknown Hypertensive diseases ZNF831 9.99e-10 0.0695 0.0001918 0.053 rs55786258 20 59194085 G C 0.997155 0.249358 23250 367388 20:57769140 20:59194085:G:C missense_variant "" "" "" unknown Hypertrophic cardiomyopathy MYBPC3 5.45e-27 56.065 rs397516005 11 47333566 G A 0.827562 0.000315742 0 367388 11:47355117 11:47333566:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Hypertrophic cardiomyopathy OR4A47 4.53e-27 70.1223 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Hypertension AGTRAP 7.94e-08 -0.0846 rs17875987 1 11744533 T G 0.977673 0.114261 4894 367388 1:11804590 1:11744533:T:G missense_variant "" "" "" unknown Hypertension C1orf167 3.77e-15 -0.1233 0.009388 -0.081 rs41275456 1 11775499 C T 0.998016 0.113763 4696 367388 1:11835556 1:11775499:C:T missense_variant "" "" "" unknown Hypertension C1orf167 3.73e-15 -0.1233 0.008657 -0.082 rs56001051 1 11778784 A G 0.998335 0.113771 4698 367388 1:11838841 1:11778784:A:G missense_variant "" "" "" unknown Hypertension C1orf167 3.73e-15 -0.1233 0.00865 -0.082 rs55967531 1 11778977 G A 0.998337 0.113771 4698 367388 1:11839034 1:11778977:G:A missense_variant "" "" "" unknown Hypertension C1orf167 1.69e-15 -0.1178 0.00196 -0.085 rs12561919 1 11779866 C T 0.998026 0.13029 6142 367388 1:11839923 1:11779866:C:T missense_variant "" "" "" unknown Hypertension C1orf167 8.53e-15 -0.1212 0.003968 -0.089 rs55867221 1 11785165 T C 0.998181 0.114794 4782 367388 1:11845222 1:11785165:T:C missense_variant "" "" "" unknown Hypertension C1orf167 8.51e-15 -0.1212 0.003988 -0.089 rs1537514 1 11788011 G C 0.998178 0.114791 4782 367388 1:11848068 1:11788011:G:C missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Hypertension CLCN6 7.93e-19 -0.1551 0.004062 -0.113 rs55741089 1 11838802 G A 0.998557 0.0892299 2862 367388 1:11898859 1:11838802:G:A missense_variant "" "" "" unknown Hypertension DBH 5.17e-13 -0.1657 1.969e-05 -0.292 rs77273740 9 133636606 C T 0.977463 0.0496668 970 367388 9:136501728 9:133636606:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Hypertension FAM109A 1.41e-07 -0.0631 rs779454863 12 111363022 TGCCACCCCC T 0.995756 0.218706 18132 367388 12:111800826 12:111363022:TGCCACCCCC:T inframe_indel "" "" "" unknown Hypertension ACE 8.17e-07 -0.085 rs4298 17 63479839 C T 0.991668 0.0922104 3160 367388 17:61557200 17:63479839:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Hypertension TUBB1 9.83e-10 0.1583 rs140943896 20 59024502 C T 0.990898 0.0381504 522 367388 20:57599557 20:59024502:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Hypertension ZNF831 1.09e-09 0.0698 0.0002659 0.052 rs56057707 20 59193688 C T 0.997045 0.249173 23224 367388 20:57768743 20:59193688:C:T missense_variant "" "" "" unknown Hypertension ZNF831 8.48e-10 0.0702 0.000214 0.053 rs55786258 20 59194085 G C 0.997155 0.249358 23250 367388 20:57769140 20:59194085:G:C missense_variant "" "" "" unknown Hypertension, essential C1orf167 4.69e-13 -0.1229 rs41275456 1 11775499 C T 0.998016 0.113763 4696 367388 1:11835556 1:11775499:C:T missense_variant "" "" "" unknown Hypertension, essential C1orf167 4.64e-13 -0.1229 rs56001051 1 11778784 A G 0.998335 0.113771 4698 367388 1:11838841 1:11778784:A:G missense_variant "" "" "" unknown Hypertension, essential C1orf167 4.64e-13 -0.1229 rs55967531 1 11778977 G A 0.998337 0.113771 4698 367388 1:11839034 1:11778977:G:A missense_variant "" "" "" unknown Hypertension, essential C1orf167 1.67e-14 -0.1231 0.005366 -0.083 rs12561919 1 11779866 C T 0.998026 0.13029 6142 367388 1:11839923 1:11779866:C:T missense_variant "" "" "" unknown Hypertension, essential C1orf167 9.35e-13 -0.1208 rs55867221 1 11785165 T C 0.998181 0.114794 4782 367388 1:11845222 1:11785165:T:C missense_variant "" "" "" unknown Hypertension, essential C1orf167 9.34e-13 -0.1208 rs1537514 1 11788011 G C 0.998178 0.114791 4782 367388 1:11848068 1:11788011:G:C missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Hypertension, essential CLCN6 1.2e-16 -0.1571 rs55741089 1 11838802 G A 0.998557 0.0892299 2862 367388 1:11898859 1:11838802:G:A missense_variant "" "" "" unknown Hypertension, essential DBH 3e-09 -0.1467 0.0001379 -0.276 rs77273740 9 133636606 C T 0.977463 0.0496668 970 367388 9:136501728 9:133636606:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Ischaemic heart disease, wide definition PARS2 6.2e-09 -0.1368 rs116816976 1 54759100 A C 0.990908 0.0699342 1982 367388 1:55224773 1:54759100:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Ischaemic heart disease, wide definition PCSK9 9.29e-12 -0.2196 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Ischaemic heart disease, wide definition LPA 4.41e-15 0.4498 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Ischaemic heart disease, wide definition HHIPL1 2.76e-08 0.3232 0.005683 0.74 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Ischaemic heart disease, wide definition HHIPL1 6.23e-08 0.3741 3.727e-05 2.041 rs201483470 14 99668272 G A 0.997367 0.00740362 30 367388 14:100134609 14:99668272:G:A missense_variant "" "" "" unknown Ischaemic heart disease, wide definition ADAMTS7 3.08e-12 -0.0873 4.566e-11 -0.057 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Ischaemic heart disease, wide definition ADAMTS7 3.78e-10 -0.0798 7.119e-10 -0.053 rs2929155 15 78765671 C T 0.997093 0.662722 161412 367388 15:79058013 15:78765671:C:T missense_variant "" "" "" unknown Ischaemic heart disease, wide definition ADAMTS7 1.81e-10 0.0796 2.294e-05 0.052 rs2127898 15 78790778 G A 0.998281 0.366991 49614 367388 15:79083120 15:78790778:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Ischaemic heart disease, wide definition ADAMTS7 5.42e-10 -0.0784 0.0004205 -0.046 rs3825807 15 78796769 A G 0.993652 0.346846 44336 367388 15:79089111 15:78796769:A:G missense_variant (likely)Benign Benign no_Criteria unknown Ischaemic heart disease, wide definition MFGE8 8.19e-11 -0.2344 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Ischaemic heart disease, wide definition APOE 1.39e-15 -0.2155 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Ischemic heart diseases PARS2 7.31e-08 -0.1282 rs116816976 1 54759100 A C 0.990908 0.0699342 1982 367388 1:55224773 1:54759100:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Ischemic heart diseases PCSK9 5.32e-10 -0.2022 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Ischemic heart diseases LPA 9.76e-15 0.4496 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Ischemic heart diseases HHIPL1 6.01e-08 0.3193 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Ischemic heart diseases ADAMTS7 1.7e-11 -0.0852 1.579e-10 -0.056 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Ischemic heart diseases ADAMTS7 1.82e-09 -0.0775 2.148e-09 -0.052 rs2929155 15 78765671 C T 0.997093 0.662722 161412 367388 15:79058013 15:78765671:C:T missense_variant "" "" "" unknown Ischemic heart diseases ADAMTS7 9.13e-10 0.0773 2.861e-05 0.052 rs2127898 15 78790778 G A 0.998281 0.366991 49614 367388 15:79083120 15:78790778:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Ischemic heart diseases ADAMTS7 6.84e-09 -0.074 0.0007289 -0.045 rs3825807 15 78796769 A G 0.993652 0.346846 44336 367388 15:79089111 15:78796769:A:G missense_variant (likely)Benign Benign no_Criteria unknown Ischemic heart diseases MFGE8 9.47e-11 -0.2363 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Ischemic heart diseases APOE 5.37e-16 -0.2212 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Myocardial infarction PCSK9 1.48e-11 -0.3241 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Myocardial infarction ADAMTS7 9.6e-08 -0.0982 1.09e-07 -0.068 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Myocardial infarction APOE 5.29e-10 -0.2429 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Myocardial infarction, strict PCSK9 3.95e-10 -0.3107 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Myocardial infarction, strict MFGE8 7.88e-09 -0.3196 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Myocardial infarction, strict APOE 1.37e-10 -0.2611 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Nonischemic cardiomyopathy BAG3 9e-09 -0.4003 rs2234962 10 119670121 T C 0.99553 0.221823 18100 367388 10:121429633 10:119670121:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter dominant Other heart diseases OR4A47 5.74e-10 1.8365 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Phlebitis and thrombophlebitis (not including DVT) FGA 1.07e-14 0.2425 1.335e-09 0.213 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Phlebitis and thrombophlebitis (not including DVT) OBP2B 1.54e-08 0.3026 rs11244035 9 133205932 C T 0.969814 0.0871014 2788 367388 9:136081319 9:133205932:C:T missense_variant "" "" "" unknown DVT of lower extremities F5 7.8e-08 0.2385 rs6027 1 169514323 T C 0.999839 0.0853675 2676 367388 1:169483561 1:169514323:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both DVT of lower extremities F5 1.98e-07 0.2346 rs1800595 1 169541110 T C 0.99086 0.0834077 2564 367388 1:169510348 1:169541110:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both DVT of lower extremities F5 1.29e-07 0.2358 rs6018 1 169542640 T G 0.999328 0.0841154 2624 367388 1:169511878 1:169542640:T:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both DVT of lower extremities KIFAP3 4.55e-15 0.9505 rs200944427 1 169961073 C T 0.989982 0.0122867 84 367388 1:169930214 1:169961073:C:T missense_variant "" "" "" unknown DVT of lower extremities OBP2B 2.97e-12 0.3159 rs11244035 9 133205932 C T 0.969814 0.0871014 2788 367388 9:136081319 9:133205932:C:T missense_variant "" "" "" unknown DVT of lower extremities STKLD1 1.98e-13 0.3293 0.001349 0.321 rs41302673 9 133405414 T G 0.988635 0.0881656 2996 367388 9:136270538 9:133405414:T:G missense_variant "" "" "" unknown DVT of lower extremities CREB3L1 4.1e-09 1.2568 rs187725533 11 46311035 A T 0.991819 0.00412915 12 367388 11:46332586 11:46311035:A:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter recessive DVT of lower extremities ZNF408 2.27e-08 0.1749 0.004016 0.115 rs747265231 11 46703166 CAGTGGTGACAGA C 0.996895 0.22176 18330 367388 11:46724716 11:46703166:CAGTGGTGACAGA:C inframe_indel (likely)Benign Benign Criteria_multSubmitter both DVT of lower extremities F2 1.68e-08 0.1764 0.003264 0.118 rs5896 11 46723453 C T 0.999769 0.222163 18348 367388 11:46745003 11:46723453:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both DVT of lower extremities LRP4 2.72e-08 0.174 0.005316 0.112 rs2306033 11 46875895 G A 0.999798 0.220753 18174 367388 11:46897446 11:46875895:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter both DVT of lower extremities OR4C6 4.8e-08 1.6569 rs145608757 11 55666080 C G 0.922467 0.00227552 4 367388 11:55433556 11:55666080:C:G missense_variant "" "" "" unknown DVT of lower extremities STAB2 1.5e-08 0.5997 3.562e-05 2.745 rs142351376 12 103742510 C T 0.989115 0.0158116 110 367388 12:104136288 12:103742510:C:T missense_variant "" "" "" unknown DVT of lower extremities MYH7B 3.64e-09 0.2114 rs11906160 20 34977952 G A 0.99573 0.139482 7290 367388 20:33565755 20:34977952:G:A missense_variant "" "" "" unknown DVT of lower extremities PROCR 1.26e-10 0.2364 0.001365 0.21 rs867186 20 35176751 A G 0.997985 0.131999 6442 367388 20:33764554 20:35176751:A:G missense_variant "" "" "" unknown Pulmonary embolism FGA 2.37e-16 0.2367 1.42e-06 0.153 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Pulmonary embolism CYP4V2 8.16e-09 0.1639 1.042e-07 0.101 rs13146272 4 186199057 C A 0.99987 0.667853 164276 367388 4:187120211 4:186199057:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Pulmonary heart disease, diseases of pulmonary circulation FGA 1.39e-14 0.2114 1.145e-05 0.132 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Coronary revascularization (ANGIO or CABG) PCSK9 1.1e-12 -0.3555 0.009734 -0.432 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Coronary revascularization (ANGIO or CABG) WDR12 2.21e-09 0.1731 0.0001914 0.217 rs35212307 2 202901033 T C 0.999968 0.113398 4708 367388 2:203765756 2:202901033:T:C missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) CARF 1.81e-09 0.1739 0.0002254 0.214 rs72932557 2 202982094 A T 0.999969 0.113825 4706 367388 2:203846817 2:202982094:A:T missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) EDNRA 1.94e-08 -0.3365 rs192190120 4 147485937 A G 0.997989 0.0238957 240 367388 4:148407089 4:147485937:A:G missense_variant "" "" "" dominant Coronary revascularization (ANGIO or CABG) SLC22A1 1.86e-08 0.5403 rs2282143 6 160136611 C T 0.999447 0.0095131 42 367388 6:160557643 6:160136611:C:T missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) LPA 1.39e-14 0.6856 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) HHIPL1 4.55e-08 0.4862 0.006762 1.042 rs781635564 14 99659451 T TGC 0.97431 0.010444 76 367388 14:100125788 14:99659451:T:TGC pLoF "" "" "" unknown Coronary revascularization (ANGIO or CABG) HHIPL1 5.69e-09 0.6185 1.056e-07 4.998 rs201483470 14 99668272 G A 0.997367 0.00740362 30 367388 14:100134609 14:99668272:G:A missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) ADAMTS7 5.3e-16 -0.1546 5.76e-13 -0.096 rs7495616 15 78762558 C G 0.996881 0.635483 148590 367388 15:79054900 15:78762558:C:G missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) ADAMTS7 3.94e-14 -0.1468 1.988e-13 -0.097 rs2929155 15 78765671 C T 0.997093 0.662722 161412 367388 15:79058013 15:78765671:C:T missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) ADAMTS7 9.07e-13 0.1358 4.982e-07 0.095 rs2127898 15 78790778 G A 0.998281 0.366991 49614 367388 15:79083120 15:78790778:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Coronary revascularization (ANGIO or CABG) MFGE8 4.35e-11 -0.3675 rs534125149 15 88901702 C CTGT 0.986263 0.0285638 320 367388 15:89444933 15:88901702:C:CTGT inframe_indel "" "" "" unknown Coronary revascularization (ANGIO or CABG) APOE 2.48e-11 -0.273 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Other embolism and thrombosis KIFAP3 1.05e-10 1.2595 rs200944427 1 169961073 C T 0.989982 0.0122867 84 367388 1:169930214 1:169961073:C:T missense_variant "" "" "" unknown Valvular operations OR4A47 8.51e-09 2.3678 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Varicose veins ADAM15 6.45e-08 -0.1231 4.491e-07 -0.063 rs6427128 1 155054466 A C 0.986458 0.883894 287020 367388 1:155026942 1:155054466:A:C missense_variant "" "" "" unknown Varicose veins PNO1 4.47e-12 0.1094 2.605e-10 0.065 rs2044693 2 68157965 A G 0.998143 0.698063 179452 367388 2:68385097 2:68157965:A:G missense_variant "" "" "" unknown Varicose veins TMEM87B 1.43e-08 -0.0931 rs748302198 2 112074958 CAAT C 0.996199 0.26778 26572 367388 2:112832535 2:112074958:CAAT:C inframe_indel "" "" "" unknown Varicose veins MVD 3.78e-11 0.142 0.0008496 0.127 rs6500486 16 88657221 C T 0.990479 0.131172 6566 367388 16:88723629 16:88657221:C:T missense_variant "" "" "" dominant Varicose veins CTU2 1.72e-15 -0.1596 6.222e-05 -0.133 rs4782321 16 88713767 G A 0.996047 0.157232 9178 367388 16:88780175 16:88713767:G:A missense_variant "" "" "" recessive Varicose veins CTU2 1.17e-15 -0.1606 3.919e-05 -0.136 rs11549835 16 88714665 G A 0.995763 0.157006 9248 367388 16:88781073 16:88714665:G:A missense_variant "" "" "" recessive Varicose veins PIEZO1 1.9e-08 -0.2007 rs188337046 16 88723279 C T 0.981076 0.045192 800 367388 16:88789687 16:88723279:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter both Varicose veins PIEZO1 1.88e-15 -0.1598 0.0001093 -0.129 rs35265318 16 88734377 C T 0.990556 0.156998 9242 367388 16:88800785 16:88734377:C:T missense_variant "" "" "" both Varicose veins PIEZO1 1.45e-19 -0.1874 3.668e-16 -0.095 rs7184427 16 88738326 A G 0.990994 0.857227 270348 367388 16:88804734 16:88738326:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter both Varicose veins PIEZO1 1.56e-18 0.2005 4.432e-06 0.199 rs7404939 16 88741488 G A 0.993057 0.113833 5070 367388 16:88807896 16:88741488:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter both Varicose veins PIEZO1 1.05e-19 -0.2016 5.366e-18 -0.106 rs6500495 16 88742335 A G 0.992311 0.878551 283850 367388 16:88808743 16:88742335:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Varicose veins CDT1 3.75e-08 0.1887 rs561655241 16 88804016 C T 0.98579 0.0472226 966 367388 16:88870424 16:88804016:C:T missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Varicose veins PABPN1L 1.99e-09 -0.1764 0.0009427 -0.246 rs76267236 16 88864866 C T 0.983154 0.0667414 1800 367388 16:88931274 16:88864866:C:T missense_variant "" "" "" unknown Varicose veins ERBB2 2.69e-07 -0.2898 rs55943169 17 39727923 C A 0.993745 0.0170637 114 367388 17:37884176 17:39727923:C:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Varicose veins GJD3 3.8e-12 -0.4547 rs201955556 17 40363641 G T 0.983118 0.0135198 76 367388 17:38519893 17:40363641:G:T missense_variant "" "" "" unknown Varicose veins KLF2 5.49e-09 -0.1033 1.126e-09 -0.065 rs3745318 19 16325451 T C 0.98401 0.785997 227290 367388 19:16436262 19:16325451:T:C missense_variant "" "" "" unknown Oesophageal varices PNPLA3 2.32e-16 0.8109 1.319e-11 0.991 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Oesophageal varices SAMM50 3.15e-10 0.6075 2.606e-07 0.723 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown Vascular dementia APOE 7.19e-24 0.8637 3.106e-10 1.086 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Valvular heart disease including rheumatic fever OR4A47 2.31e-08 2.2423 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Venous thromboembolism F5 1.25e-11 -0.1477 8.889e-05 -0.115 rs6032 1 169542317 T C 0.999844 0.222971 18406 367388 1:169511555 1:169542317:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Venous thromboembolism F5 1.01e-11 -0.1485 0.000116 -0.114 rs4525 1 169542496 T C 0.999415 0.222694 18342 367388 1:169511734 1:169542496:T:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Venous thromboembolism F5 8e-12 -0.1491 8.615e-05 -0.116 rs4524 1 169542517 T C 0.999979 0.223143 18404 367388 1:169511755 1:169542517:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Venous thromboembolism KIFAP3 4.55e-10 0.5302 rs200944427 1 169961073 C T 0.989982 0.0122867 84 367388 1:169930214 1:169961073:C:T missense_variant "" "" "" unknown Venous thromboembolism FGA 2.78e-23 0.1937 2.006e-13 0.159 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Venous thromboembolism CYP4V2 2.66e-10 0.1212 2.455e-09 0.077 rs13146272 4 186199057 C A 0.99987 0.667853 164276 367388 4:187120211 4:186199057:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Venous thromboembolism KLKB1 6.26e-10 0.1217 4.896e-08 0.07 rs925453 4 186258056 T C 0.999836 0.698319 179464 367388 4:187179210 4:186258056:T:C missense_variant "" "" "" recessive Venous thromboembolism OBP2B 4.76e-16 0.2687 rs11244035 9 133205932 C T 0.969814 0.0871014 2788 367388 9:136081319 9:133205932:C:T missense_variant "" "" "" unknown Venous thromboembolism STKLD1 1.42e-13 0.2403 0.00779 0.192 rs41302673 9 133405414 T G 0.988635 0.0881656 2996 367388 9:136270538 9:133405414:T:G missense_variant "" "" "" unknown Venous thromboembolism CREB3L1 9.72e-13 1.1013 rs187725533 11 46311035 A T 0.991819 0.00412915 12 367388 11:46332586 11:46311035:A:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter recessive Venous thromboembolism MYBPC3 7.91e-10 1.1359 rs370890951 11 47332912 A G 0.984542 0.0029179 6 367388 11:47354463 11:47332912:A:G missense_variant (likely)Benign Likely benign Criteria_multSubmitter dominant Venous thromboembolism OR4C6 8.07e-09 1.2359 rs145608757 11 55666080 C G 0.922467 0.00227552 4 367388 11:55433556 11:55666080:C:G missense_variant "" "" "" unknown Venous thromboembolism STAB2 4.27e-11 0.5065 0.002452 1.232 rs142351376 12 103742510 C T 0.989115 0.0158116 110 367388 12:104136288 12:103742510:C:T missense_variant "" "" "" unknown Venous thromboembolism MYH7B 1.52e-10 0.1678 0.000143 0.174 rs11906160 20 34977952 G A 0.99573 0.139482 7290 367388 20:33565755 20:34977952:G:A missense_variant "" "" "" unknown Venous thromboembolism PROCR 6.95e-11 0.175 0.0004089 0.171 rs867186 20 35176751 A G 0.997985 0.131999 6442 367388 20:33764554 20:35176751:A:G missense_variant "" "" "" unknown Interstitial lung disease SPDL1 8.54e-12 0.7888 1.947e-05 1.963 rs116483731 5 169588475 G A 0.99787 0.0301289 382 367388 5:169015479 5:169588475:G:A missense_variant "" "" "" unknown Interstitial lung disease MUC6 3.65e-16 1.357 rs148815783 11 1013992 C T 0.982418 0.0159722 124 367388 11:1013992 11:1013992:C:T missense_variant "" "" "" unknown Interstitial lung disease MUC5AC 1.36e-08 0.7048 rs55846509 11 1160678 G A 0.953404 0.0261876 248 367388 11:1154294 11:1160678:G:A missense_variant "" "" "" unknown Interstitial lung disease MUC5B 1.45e-26 0.5388 4.112e-12 0.529 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant ILD Co-morbidites, CVD and metabolic diseases PTPN22 3.51e-12 -0.0889 1.903e-09 -0.043 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Interstitial lung disease endpoints PTPN22 1.28e-09 -0.1032 2.615e-10 -0.061 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Interstitial lung disease endpoints TNRC18 1.63e-10 0.396 0.005529 1.153 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Interstitial lung disease endpoints ZKSCAN2 rs2112811 16 25251957 G A 0.99786 0.178307 11948 367388 16:25263278 16:25251957:G:A missense_variant "" "" "" unknown ILD, hospital admissions SPDL1 5.9e-12 0.7999 9.611e-06 2.169 rs116483731 5 169588475 G A 0.99787 0.0301289 382 367388 5:169015479 5:169588475:G:A missense_variant "" "" "" unknown ILD, hospital admissions MUC6 8.4e-16 1.3569 rs148815783 11 1013992 C T 0.982418 0.0159722 124 367388 11:1013992 11:1013992:C:T missense_variant "" "" "" unknown ILD, hospital admissions MUC5AC 4.18e-08 0.6816 rs55846509 11 1160678 G A 0.953404 0.0261876 248 367388 11:1154294 11:1160678:G:A missense_variant "" "" "" unknown ILD, hospital admissions MUC5B 6.15e-25 0.524 4.649e-12 0.533 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant ILD, hospital admissions 1, main diag only SPDL1 3.3e-13 0.9045 3.405e-06 2.486 rs116483731 5 169588475 G A 0.99787 0.0301289 382 367388 5:169015479 5:169588475:G:A missense_variant "" "" "" unknown ILD, hospital admissions 1, main diag only MUC6 4.59e-15 1.401 rs148815783 11 1013992 C T 0.982418 0.0159722 124 367388 11:1013992 11:1013992:C:T missense_variant "" "" "" unknown ILD, hospital admissions 1, main diag only MUC5B 1.76e-21 0.51 2.047e-09 0.481 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant ILD, hospital admissions 1, main diag only KRTAP5-4 2.51e-08 0.8331 rs181332597 11 1622057 C T 0.980051 0.0212527 166 367388 11:1643287 11:1622057:C:T missense_variant "" "" "" unknown ILD, hospital admissions 3, with pneumonia sepsis MUC5B 1.08e-13 0.5344 4.861e-07 0.55 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant ILD, hospital admission 2, with pulmonary infections MUC6 2.52e-08 1.1895 rs148815783 11 1013992 C T 0.982418 0.0159722 124 367388 11:1013992 11:1013992:C:T missense_variant "" "" "" unknown ILD, hospital admission 2, with pulmonary infections MUC5B 2.66e-16 0.5403 5.724e-07 0.497 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant ILD, hospital admission 2, with pulmonary infections MUC5B 5.84e-09 -0.2948 0.002017 -0.129 rs60787297 11 1244556 C T 0.97166 0.490296 88638 367388 11:1265786 11:1244556:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant ILD, hospital admission 2, with pulmonary infections MUC5B 1.83e-08 -0.2818 0.004359 -0.119 rs2943521 11 1248605 G A 0.994036 0.482027 85684 367388 11:1269835 11:1248605:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant ILD, hospital admission 2, with pulmonary infections MUC5B 1.21e-08 -0.2863 0.002759 -0.125 rs2943517 11 1250091 C G 0.987023 0.485051 86748 367388 11:1271321 11:1250091:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Autoimmune diseases related-to ILD PTPN22 5.11e-10 -0.1092 1.071e-10 -0.064 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Autoimmune diseases related-to ILD TNRC18 1.57e-10 0.4105 0.003755 1.274 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Autoimmune diseases related-to ILD GRID2IP 9.23e-08 0.1444 rs184043502 7 6508277 G T 0.982421 0.0575658 1270 367388 7:6547908 7:6508277:G:T missense_variant "" "" "" unknown Autoimmune diseases related-to ILD ZKSCAN2 rs2112811 16 25251957 G A 0.99786 0.178307 11948 367388 16:25263278 16:25251957:G:A missense_variant "" "" "" unknown Idiopathic pulmonary fibrosis (attempt to specificity) SPDL1 3.24e-12 1.1025 6.591e-06 3.06 rs116483731 5 169588475 G A 0.99787 0.0301289 382 367388 5:169015479 5:169588475:G:A missense_variant "" "" "" unknown Idiopathic pulmonary fibrosis (attempt to specificity) MUC6 1.82e-18 2.004 rs148815783 11 1013992 C T 0.982418 0.0159722 124 367388 11:1013992 11:1013992:C:T missense_variant "" "" "" unknown Idiopathic pulmonary fibrosis (attempt to specificity) MUC5AC 1.68e-09 1.0313 rs55846509 11 1160678 G A 0.953404 0.0261876 248 367388 11:1154294 11:1160678:G:A missense_variant "" "" "" unknown Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 3.32e-26 0.7364 1.655e-10 0.662 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 2.78e-08 0.8838 rs2943496 11 1244706 T C 0.980835 0.0299112 310 367388 11:1265936 11:1244706:T:C missense_variant (likely)Benign Likely benign Criteria_oneSubmitter dominant Idiopathic pulmonary fibrosis (attempt to specificity) KRTAP5-4 1.72e-09 1.1747 rs181332597 11 1622057 C T 0.980051 0.0212527 166 367388 11:1643287 11:1622057:C:T missense_variant "" "" "" unknown Asthma IL1RL1 4.06e-09 -0.0936 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Asthma BCL2L11 6.85e-10 0.1289 3.575e-06 0.198 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma SLC22A4 2.86e-12 -0.0969 1.666e-07 -0.08 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Asthma IL4R 6.34e-11 -0.1581 rs144651842 16 27344903 G A 0.989332 0.0774985 2290 367388 16:27356224 16:27344903:G:A missense_variant "" "" "" dominant Asthma GSDMB 3.81e-12 -0.0893 0.0003737 -0.037 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Asthma GSDMB 4.15e-12 -0.0892 0.0002959 -0.038 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Asthma/COPD (KELA code 203) IL1RL1 1.64e-08 -0.0906 0.00911 -0.059 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) BCL2L11 2.6e-15 0.167 6.722e-09 0.254 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) CCNI2 3.46e-08 0.0884 rs803056 5 132747766 G C 0.994028 0.204881 15700 367388 5:132083458 5:132747766:G:C missense_variant "" "" "" unknown Asthma (more controls excluded) IL1RL1 9.46e-09 -0.0918 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Asthma (more controls excluded) BCL2L11 3.69e-10 0.1316 1.381e-06 0.209 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma (more controls excluded) SLC22A4 3.08e-12 -0.0971 1.315e-07 -0.081 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Asthma (more controls excluded) IL4R 1.91e-10 -0.1548 rs144651842 16 27344903 G A 0.989332 0.0774985 2290 367388 16:27356224 16:27344903:G:A missense_variant "" "" "" dominant Asthma (more controls excluded) GSDMB 1.37e-12 -0.0916 0.0002818 -0.038 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Asthma (more controls excluded) GSDMB 1.57e-12 -0.0914 0.0002318 -0.039 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Asthma (only as main-diagnosis) IL1RL1 2.68e-08 -0.0942 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) BCL2L11 2.04e-09 0.1335 7.908e-06 0.205 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma (only as main-diagnosis) IL4R 4.92e-11 -0.1694 rs144651842 16 27344903 G A 0.989332 0.0774985 2290 367388 16:27356224 16:27344903:G:A missense_variant "" "" "" dominant Asthma (only as main-diagnosis) GSDMB 8.03e-13 -0.0981 0.0002099 -0.041 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) GSDMB 9.63e-13 -0.0978 0.0001616 -0.042 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) IL1RL1 5.43e-08 -0.0922 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) BCL2L11 1.29e-09 0.1355 3.607e-06 0.214 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) IL4R 1.37e-10 -0.1658 rs144651842 16 27344903 G A 0.989332 0.0774985 2290 367388 16:27356224 16:27344903:G:A missense_variant "" "" "" dominant Asthma (only as main-diagnosis) (more controls excluded) GSDMB 3.21e-13 -0.0999 0.0001594 -0.042 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) GSDMB 4.03e-13 -0.0996 0.0001271 -0.043 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Chronic sinusitis GAS2L2 5.02e-07 -0.1104 rs3744374 17 35745536 G A 0.990526 0.229792 19742 367388 17:34072555 17:35745536:G:A missense_variant "" "" "" recessive Chronic diseases of tonsils and adenoids TNFRSF13B 2.87e-17 0.3401 rs72553883 17 16940415 G T 0.951214 0.0238576 216 367388 17:16843729 17:16940415:G:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl both COPD SERPINA1 1.72e-07 0.4067 8.371e-17 4.591 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive COPD CHRNA5 2.09e-19 0.2022 3.528e-11 0.16 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Other chronic obstructive pulmonary disease CHRNA5 2.78e-19 0.2066 9.362e-12 0.169 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Other respiratory diseases principally affecting the interstitium SPDL1 6.95e-11 0.6693 1.079e-05 1.897 rs116483731 5 169588475 G A 0.99787 0.0301289 382 367388 5:169015479 5:169588475:G:A missense_variant "" "" "" unknown Other respiratory diseases principally affecting the interstitium MUC6 8.83e-14 1.1064 rs148815783 11 1013992 C T 0.982418 0.0159722 124 367388 11:1013992 11:1013992:C:T missense_variant "" "" "" unknown Other respiratory diseases principally affecting the interstitium MUC5B 6.69e-24 0.4534 1.713e-12 0.484 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant Chronic lower respiratory diseases IL1RL1 2.79e-08 -0.0719 0.005365 -0.051 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Chronic lower respiratory diseases BCL2L11 8.99e-11 0.11 1.068e-07 0.185 rs113135335 2 111130177 T G 0.981981 0.108041 4360 367388 2:111887754 2:111130177:T:G missense_variant "" "" "" unknown Chronic lower respiratory diseases SLC22A4 5.47e-13 -0.0812 3.884e-08 -0.068 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Chronic lower respiratory diseases CCNI2 2.04e-09 0.0775 rs803056 5 132747766 G C 0.994028 0.204881 15700 367388 5:132083458 5:132747766:G:C missense_variant "" "" "" unknown Chronic lower respiratory diseases SERPINA1 2.73e-05 0.1568 2.719e-10 1.271 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Chronic lower respiratory diseases IL4R 2.36e-09 -0.1169 rs144651842 16 27344903 G A 0.989332 0.0774985 2290 367388 16:27356224 16:27344903:G:A missense_variant "" "" "" dominant Chronic lower respiratory diseases GSDMB 3.83e-12 -0.0726 0.000143 -0.032 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Chronic lower respiratory diseases GSDMB 3.63e-12 -0.0727 0.0001164 -0.033 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Other insterstitial pulmonary diseases SPDL1 1.56e-11 0.7745 1.147e-05 2.115 rs116483731 5 169588475 G A 0.99787 0.0301289 382 367388 5:169015479 5:169588475:G:A missense_variant "" "" "" unknown Other insterstitial pulmonary diseases MUC6 2.8e-16 1.3665 rs148815783 11 1013992 C T 0.982418 0.0159722 124 367388 11:1013992 11:1013992:C:T missense_variant "" "" "" unknown Other insterstitial pulmonary diseases MUC5AC 1.85e-08 0.6951 rs55846509 11 1160678 G A 0.953404 0.0261876 248 367388 11:1154294 11:1160678:G:A missense_variant "" "" "" unknown Other insterstitial pulmonary diseases MUC5B 2.27e-26 0.5359 4.14e-12 0.529 rs199749553 11 1244192 G A 0.993576 0.188809 13246 367388 11:1265422 11:1244192:G:A missense_variant "" "" "" dominant Diseases of the respiratory system IL1RL1 3.66e-09 -0.0497 8.736e-05 -0.047 rs1041973 2 102339008 C A 0.998917 0.204729 15478 367388 2:102955468 2:102339008:C:A missense_variant "" "" "" unknown Other diseases of upper respiratory tract TNFRSF13B 4.22e-10 0.1792 rs72553883 17 16940415 G T 0.951214 0.0238576 216 367388 17:16843729 17:16940415:G:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl both Acute pancreatitis ABCG8 6.87e-08 0.3057 0.002143 0.408 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Acute pancreatitis SPINK1 8.85e-15 1.0274 0.00326 2.158 rs17107315 5 147828115 T C 0.9984 0.0162226 122 367388 5:147207678 5:147828115:T:C missense_variant risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter both Alcoholic liver disease PNPLA3 2.39e-12 0.3779 1.287e-07 0.398 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Alcoholic liver disease SAMM50 1.48e-10 0.3437 1.178e-07 0.4 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown Acute appendicitis HLX 8.57e-08 0.0768 0.0003758 0.057 rs12141189 1 220880203 T C 0.996665 0.302002 33816 367388 1:221053545 1:220880203:T:C missense_variant "" "" "" unknown Acute appendicitis HLX 4.44e-08 -0.0754 0.001616 -0.044 rs2247213 1 220882121 G A 0.999026 0.352491 45824 367388 1:221055463 1:220882121:G:A missense_variant "" "" "" unknown Acute appendicitis HLX 3.55e-08 -0.0759 0.0009031 -0.047 rs2738755 1 220884304 C T 0.999729 0.352001 45652 367388 1:221057646 1:220884304:C:T missense_variant "" "" "" unknown Diseases of appendix HLX 9.49e-08 -0.0708 0.006962 -0.037 rs2247213 1 220882121 G A 0.999026 0.352491 45824 367388 1:221055463 1:220882121:G:A missense_variant "" "" "" unknown Diseases of appendix HLX 8.48e-08 -0.0711 0.004492 -0.039 rs2738755 1 220884304 C T 0.999729 0.352001 45652 367388 1:221057646 1:220884304:C:T missense_variant "" "" "" unknown Crohn disease (strict definition, require KELA) NOD2 1.51e-09 1.6446 1.112e-05 9.334 rs199883290 16 50729867 G GC 0.977701 0.0152346 88 367388 16:50763778 16:50729867:G:GC pLoF risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter dominant Crohn disease ( strict definition, require KELA, min 2 HDR) NOD2 2.96e-09 1.7107 0.0001971 7.866 rs199883290 16 50729867 G GC 0.977701 0.0152346 88 367388 16:50763778 16:50729867:G:GC pLoF risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter dominant Chlocystitis ABCG5 1.27e-07 0.3658 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Chlocystitis ABCG8 2.94e-08 0.3815 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Cholelithiasis ZFP36L2 4.75e-48 0.6605 rs538857577 2 43224855 C T 0.99412 0.0244592 284 367388 2:43451994 2:43224855:C:T missense_variant "" "" "" unknown Cholelithiasis ZFP36L2 3.55e-12 -0.1826 0.0002667 -0.245 rs11675632 2 43225479 C T 0.997748 0.0723513 1912 367388 2:43452618 2:43225479:C:T missense_variant "" "" "" unknown Cholelithiasis THADA 1.05e-48 0.5981 rs958225355 2 43428137 CAGA C 0.999594 0.0296499 386 367388 2:43655276 2:43428137:CAGA:C inframe_indel "" "" "" unknown Cholelithiasis THADA 1.57e-11 -0.11 7.448e-05 -0.09 rs17031056 2 43570480 C T 0.997164 0.213809 17062 367388 2:43797619 2:43570480:C:T missense_variant "" "" "" unknown Cholelithiasis THADA 1.86e-15 0.9813 rs111983293 2 43575014 T C 0.9868 0.00319281 0 367388 2:43802153 2:43575014:T:C missense_variant "" "" "" unknown Cholelithiasis DYNC2LI1 7.02e-38 -0.2058 6.264e-12 -0.146 rs11556157 2 43800874 A T 0.995673 0.233704 19912 367388 2:44028013 2:43800874:A:T missense_variant "" "" "" recessive Cholelithiasis ABCG5 1.22e-38 0.2556 5.43e-12 0.244 rs6720173 2 43813262 G C 0.998145 0.135973 6958 367388 2:44040401 2:43813262:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Cholelithiasis ABCG5 9.57e-08 -0.8477 rs141828689 2 43828024 C T 0.994913 0.00191351 0 367388 2:44055163 2:43828024:C:T missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Cholelithiasis ABCG5 3.83e-225 0.8144 9.933e-25 0.614 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Cholelithiasis ABCG8 2.48e-236 0.8264 8.346e-28 0.641 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Cholelithiasis PREPL 3.23e-09 1.2375 rs745462411 2 44344565 A C 0.975366 0.00103433 0 367388 2:44571704 2:44344565:A:C missense_variant "" "" "" recessive Cholelithiasis UGT1A6 3.4e-08 0.0739 4.074e-11 0.077 rs1105879 2 233693556 A C 0.999952 0.451147 75358 367388 2:234602202 2:233693556:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Cholelithiasis LRBA 1.31e-13 0.1184 1.515e-06 0.104 rs2290846 4 150277928 G A 0.99993 0.221648 18096 367388 4:151199080 4:150277928:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Cholelithiasis LRBA 1.16e-11 0.1062 2.695e-06 0.096 rs3749574 4 150285975 C T 0.999017 0.234828 20356 367388 4:151207127 4:150285975:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Cholelithiasis MARCH8 7.71e-11 0.0962 2.129e-06 0.082 rs2291428 10 45463408 G C 0.997674 0.280243 29026 367388 10:45958856 10:45463408:G:C missense_variant "" "" "" unknown Cholelithiasis MARCH8 9.23e-11 0.1019 4.877e-06 0.091 rs2291429 10 45463433 A C 0.935118 0.269916 26882 367388 10:45958881 10:45463433:A:C missense_variant "" "" "" unknown Cholelithiasis SERPINA1 4.74e-16 0.3911 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Cholelithiasis BHMG1 5.69e-08 0.079 0.004275 0.047 rs725660 19 45759028 C A 0.997054 0.300396 33628 367388 19:46262286 19:45759028:C:A missense_variant "" "" "" unknown Cholelithiasis SIX5 6.73e-08 0.0785 0.005274 0.046 rs2341097 19 45765644 C T 0.997588 0.300456 33680 367388 19:46268902 19:45765644:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Cholelithiasis HNF4A 1.27e-30 0.3783 0.002799 0.31 rs1800961 20 44413724 C T 0.995363 0.0450614 752 367388 20:43042364 20:44413724:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Chronic gastritis FAM184A 4.61e-08 0.7137 rs41292558 6 118975978 T A 0.947581 0.00847877 44 367388 6:119297143 6:118975978:T:A missense_variant "" "" "" unknown Chronic pancreatitis SPINK1 1.97e-11 1.1801 rs17107315 5 147828115 T C 0.9984 0.0162226 122 367388 5:147207678 5:147828115:T:C missense_variant risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter both Other diseases of liver PRKCSH 3.47e-15 8.8051 rs371330547 19 11449175 CGT C 0.97776 0.000590656 0 367388 19:11559990 19:11449175:CGT:C pLoF (likely)Pathogenic Pathogenic no_Criteria dominant Other diseases of liver PNPLA3 3.49e-14 0.3189 7.029e-12 0.411 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Other diseases of liver SAMM50 7.99e-09 0.2403 3.32e-05 0.236 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown Diverticular disease of intestine HMCN2 1.82e-08 0.2113 rs143378550 9 130307462 C A 0.98031 0.0439971 752 367388 9:133069741 9:130307462:C:A pLoF "" "" "" unknown Noninfective enteritis and colitis TNRC18 6.43e-11 0.6339 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas ZFP36L2 1.23e-41 0.5482 rs538857577 2 43224855 C T 0.99412 0.0244592 284 367388 2:43451994 2:43224855:C:T missense_variant "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas ZFP36L2 1.34e-10 -0.1511 0.0001459 -0.229 rs11675632 2 43225479 C T 0.997748 0.0723513 1912 367388 2:43452618 2:43225479:C:T missense_variant "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas THADA 1.52e-42 0.4996 rs958225355 2 43428137 CAGA C 0.999594 0.0296499 386 367388 2:43655276 2:43428137:CAGA:C inframe_indel "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas THADA 5.09e-14 0.8315 rs111983293 2 43575014 T C 0.9868 0.00319281 0 367388 2:43802153 2:43575014:T:C missense_variant "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas DYNC2LI1 2.83e-31 -0.1669 4.957e-10 -0.118 rs11556157 2 43800874 A T 0.995673 0.233704 19912 367388 2:44028013 2:43800874:A:T missense_variant "" "" "" recessive Disorders of gallbladder, biliary tract and pancreas ABCG5 4.76e-30 0.201 6.096e-12 0.219 rs6720173 2 43813262 G C 0.998145 0.135973 6958 367388 2:44040401 2:43813262:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas ABCG5 3.11e-08 -0.7983 rs141828689 2 43828024 C T 0.994913 0.00191351 0 367388 2:44055163 2:43828024:C:T missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas ABCG5 2.92e-190 0.6691 3.325e-19 0.479 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas ABCG8 1.38e-199 0.6789 4.006e-22 0.508 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas PREPL 3.95e-08 1.0404 rs745462411 2 44344565 A C 0.975366 0.00103433 0 367388 2:44571704 2:44344565:A:C missense_variant "" "" "" recessive Disorders of gallbladder, biliary tract and pancreas LRBA 2.19e-12 0.1012 3.298e-05 0.081 rs2290846 4 150277928 G A 0.99993 0.221648 18096 367388 4:151199080 4:150277928:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Disorders of gallbladder, biliary tract and pancreas LRBA 4.73e-10 0.0879 7.206e-05 0.073 rs3749574 4 150285975 C T 0.999017 0.234828 20356 367388 4:151207127 4:150285975:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Disorders of gallbladder, biliary tract and pancreas MARCH8 4.63e-11 0.0877 1.232e-06 0.076 rs2291428 10 45463408 G C 0.997674 0.280243 29026 367388 10:45958856 10:45463408:G:C missense_variant "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas MARCH8 1.7e-10 0.0905 5.958e-06 0.081 rs2291429 10 45463433 A C 0.935118 0.269916 26882 367388 10:45958881 10:45463433:A:C missense_variant "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas SERPINA1 1.02e-13 0.3217 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas HNF4A 3.82e-25 0.3051 0.003236 0.273 rs1800961 20 44413724 C T 0.995363 0.0450614 752 367388 20:43042364 20:44413724:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Gastrointestinal diseases ZFP36L2 1.79e-10 0.1445 rs538857577 2 43224855 C T 0.99412 0.0244592 284 367388 2:43451994 2:43224855:C:T missense_variant "" "" "" unknown Gastrointestinal diseases THADA 7.71e-11 0.1336 rs958225355 2 43428137 CAGA C 0.999594 0.0296499 386 367388 2:43655276 2:43428137:CAGA:C inframe_indel "" "" "" unknown Gastrointestinal diseases ABCG5 7.11e-25 0.1305 0.0009035 0.099 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Gastrointestinal diseases ABCG8 2.36e-26 0.1332 0.0004203 0.103 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Gastrointestinal diseases SERPINA1 7.37e-08 0.1339 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Inguinal hernia ELN 1.28e-08 -0.1812 rs17855988 7 74060495 G C 0.97594 0.054011 1148 367388 7:73474825 7:74060495:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter dominant Inguinal hernia CDCA2 3.47e-11 0.1114 1.836e-06 0.107 rs3829009 8 25507318 A T 0.997457 0.225663 18808 367388 8:25364834 8:25507318:A:T missense_variant "" "" "" unknown Inguinal hernia SMARCC2 5.45e-09 0.7646 rs201829738 12 56173736 G A 0.996998 0.00303222 2 367388 12:56567520 12:56173736:G:A missense_variant "" "" "" dominant Inguinal hernia LRRK1 2.43e-10 0.525 rs41531245 15 101029169 C T 0.975161 0.00764042 8 367388 15:101569374 15:101029169:C:T missense_variant "" "" "" unknown Hernia LRRK1 9.84e-14 0.4841 0.00536 2.004 rs41531245 15 101029169 C T 0.975161 0.00764042 8 367388 15:101569374 15:101029169:C:T missense_variant "" "" "" unknown Inflammatory bowel disease IL23R 9.12e-08 -0.2908 rs11209026 1 67240275 G A 0.998806 0.0462835 888 367388 1:67705958 1:67240275:G:A missense_variant protective protective no_Criteria unknown Inflammatory bowel disease TNRC18 3.77e-12 0.8318 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Inflammatory bowel disease, strict (require KELA) IL23R 2.15e-08 -0.3893 rs11209026 1 67240275 G A 0.998806 0.0462835 888 367388 1:67705958 1:67240275:G:A missense_variant protective protective no_Criteria unknown Inflammatory bowel disease, strict (require KELA) TNRC18 3.8e-10 0.9505 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Crohn's disease patients in KELA-register (KELA code 209, or 208 with ICD K50) NOD2 1.58e-09 1.5335 1.883e-05 8.302 rs199883290 16 50729867 G GC 0.977701 0.0152346 88 367388 16:50763778 16:50729867:G:GC pLoF risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter dominant IBD patients in KELA-register IL23R 1.01e-08 -0.3837 rs11209026 1 67240275 G A 0.998806 0.0462835 888 367388 1:67705958 1:67240275:G:A missense_variant protective protective no_Criteria unknown IBD patients in KELA-register TNRC18 7.45e-12 1.0058 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown UC patients in KELA-register ( KELA 208 prior to 1994, or ICD K51) TNRC18 3.78e-09 0.9832 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Diseases of liver PRKCSH 5.4e-10 3.7786 rs371330547 19 11449175 CGT C 0.97776 0.000590656 0 367388 19:11559990 19:11449175:CGT:C pLoF (likely)Pathogenic Pathogenic no_Criteria dominant Diseases of liver PNPLA3 9.51e-21 0.2616 1.679e-17 0.336 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Diseases of liver SAMM50 2.33e-13 0.2039 7.418e-11 0.252 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown KELA_REIMBURSEMENT_202 PTPN22 5.25e-26 -0.2562 6.328e-22 -0.131 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both KELA_REIMBURSEMENT_202 DCLRE1B 1.34e-08 0.124 4.871e-05 0.131 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown KELA_REIMBURSEMENT_202 SH2B3 1.02e-10 -0.1126 8.497e-10 -0.078 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown KELA_REIMBURSEMENT_202 TYK2 6.09e-09 -0.2954 rs34536443 19 10352442 G C 0.994334 0.030657 348 367388 19:10463118 19:10352442:G:C missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Ulcerative colitis ( strict definition, require KELA) TNRC18 6.39e-08 0.9525 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Ulcerative colitis (strict definition, require KELA, min 2 HDR) TNRC18 5.11e-08 1.0288 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Ulcerative colitis TNRC18 5.41e-11 0.9057 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Umbilical hernia LRRK1 1.98e-11 1.1142 0.009793 11.533 rs41531245 15 101029169 C T 0.975161 0.00764042 8 367388 15:101569374 15:101029169:C:T missense_variant "" "" "" unknown Diabetes, insuline treatment (Kela reimbursement) PTPN22 1.8e-13 -0.1165 7.175e-10 -0.055 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetes, insuline treatment (Kela reimbursement) PPARG 5.75e-08 -0.082 0.005146 -0.067 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Diabetes, insuline treatment (Kela reimbursement) WFS1 4.05e-12 0.0837 6.524e-12 0.055 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetes, insuline treatment (Kela reimbursement) TM6SF2 6.34e-10 0.1605 0.005651 0.211 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) PTPN22 1.25e-13 -0.1194 4.595e-10 -0.057 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) PPARG 1.26e-08 -0.0876 0.002494 -0.073 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) WFS1 1.65e-12 0.0868 3.054e-12 0.057 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) RFX6 4.84e-08 0.8597 rs770636874 6 116916217 TAC T 0.938397 0.00149433 0 367388 6:117237380 6:116916217:TAC:T pLoF "" "" "" recessive Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) HNF1A 3.16e-08 -0.0714 3.088e-05 -0.063 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) TM6SF2 1.69e-09 0.1593 0.003846 0.225 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Any mental disorder APOE 6.27e-30 0.1355 2.485e-16 0.152 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Any mental disorder, or suicide (or attempt), or psychic disorders complicating pregnancy, partum or puerperum or nerve system disorders APOE 6.3e-30 0.1353 2.27e-16 0.152 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Any dementia ZNF155 4.46e-15 0.5285 0.001 0.885 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Any dementia ZNF230 1.09e-14 0.5408 0.005565 0.744 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Any dementia ZNF225 1.25e-15 0.5467 0.005813 0.684 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Any dementia ZNF227 1.68e-16 0.5614 0.00589 0.682 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Any dementia ZNF229 6.34e-16 0.5681 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Any dementia APOE 3.15e-21 0.2445 5.343e-18 0.142 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Any dementia APOE 5.52e-12 1.0072 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Any dementia APOE 6.06e-209 1.0176 1.209e-109 1.305 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Any dementia APOE 2.56e-11 -0.3446 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Any dementia PPP1R37 6.56e-15 0.3993 0.003216 0.401 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Any dementia EXOC3L2 2.17e-12 0.2818 0.006535 0.229 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Any dementia (more controls excluded) ZNF155 3.96e-15 0.5394 0.0005884 0.957 rs58537897 19 43996549 C T 0.991515 0.0339695 354 367388 19:44500701 19:43996549:C:T missense_variant "" "" "" unknown Any dementia (more controls excluded) ZNF230 9.97e-15 0.5511 0.005747 0.74 rs76261208 19 44010922 C A 0.995232 0.0315906 388 367388 19:44515074 19:44010922:C:A missense_variant "" "" "" unknown Any dementia (more controls excluded) ZNF225 9e-16 0.5596 0.006826 0.662 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Any dementia (more controls excluded) ZNF227 1.75e-16 0.5707 0.006894 0.66 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Any dementia (more controls excluded) ZNF229 1.9e-16 0.5911 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Any dementia (more controls excluded) APOE 7.63e-21 0.2465 8.812e-18 0.144 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Any dementia (more controls excluded) APOE 2.68e-11 0.9683 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Any dementia (more controls excluded) APOE 4.33e-202 1.0095 4.962e-106 1.271 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Any dementia (more controls excluded) APOE 9.62e-12 -0.3584 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Any dementia (more controls excluded) PPP1R37 2.06e-15 0.4146 0.003085 0.407 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Any dementia (more controls excluded) EXOC3L2 9.02e-13 0.2923 0.004932 0.242 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Actinic keratosis SEPN1 8.5e-08 -0.1574 4.212e-06 -0.084 rs2294228 1 25814082 C A 0.998378 0.746682 204924 367388 1:26140573 1:25814082:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Actinic keratosis TYR 2.8e-09 0.1995 9.292e-06 0.228 rs1126809 11 89284793 G A 0.998018 0.178944 11978 367388 11:89017961 11:89284793:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl both Actinic keratosis OCA2 3.51e-38 0.8602 1.375e-10 1.415 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Actinic keratosis OCA2 4.46e-08 0.3475 0.005145 0.563 rs1800407 15 27985172 C T 0.980961 0.0451648 766 367388 15:28230318 15:27985172:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Actinic keratosis GOLGA8M 2.06e-12 0.327 0.0001592 0.401 rs531763484 15 28702279 G A 0.96956 0.0889359 3026 367388 15:28947425 15:28702279:G:A missense_variant "" "" "" unknown Actinic keratosis GOLGA8M 1.87e-11 0.305 0.0001318 0.389 rs78557271 15 28702280 A G 0.96098 0.0930814 3298 367388 15:28947426 15:28702280:A:G missense_variant "" "" "" unknown Actinic keratosis GOLGA8M 2.45e-11 0.3042 0.0001229 0.393 rs2003233 15 28702528 G A 0.964317 0.0925561 3288 367388 15:28947674 15:28702528:G:A missense_variant "" "" "" unknown Actinic keratosis GOLGA8M 5.72e-10 0.2925 0.001238 0.353 rs200180898 15 28705604 T C 0.945257 0.0893878 3032 367388 15:28950750 15:28705604:T:C missense_variant "" "" "" unknown Actinic keratosis GOLGA8M 2.7e-11 0.3038 0.0001948 0.38 rs28623038 15 28708257 G A 0.975447 0.0913095 3216 367388 15:28953403 15:28708257:G:A missense_variant "" "" "" unknown Actinic keratosis GOLGA8M 2.69e-11 0.3038 0.000194 0.381 rs28418661 15 28708266 C T 0.975453 0.0913122 3216 367388 15:28953412 15:28708266:C:T missense_variant "" "" "" unknown Actinic keratosis SPATA33 8.97e-14 0.2999 1.138e-05 0.346 rs35415928 16 89657860 C T 0.996679 0.117334 5112 367388 16:89724268 16:89657860:C:T missense_variant "" "" "" unknown Actinic keratosis FANCA 1.56e-08 0.2618 1.503e-05 0.478 rs1800282 16 89816599 A T 0.980732 0.0843686 2698 367388 16:89883007 16:89816599:A:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Actinic keratosis MC1R 4.77e-31 0.6207 7.55e-08 0.802 rs1805007 16 89919709 C T 0.989317 0.0670055 1688 367388 16:89986117 16:89919709:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Actinic keratosis MC1R 1.24e-13 0.3808 1.313e-05 0.597 rs1805008 16 89919736 C T 0.995937 0.0685896 1760 367388 16:89986144 16:89919736:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Actinic keratosis TUBB3 1.26e-09 0.2837 0.009088 0.279 rs77681059 16 89933636 C T 0.995589 0.0827381 2522 367388 16:90000044 16:89933636:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Actinic keratosis PRDM7 1.19e-10 0.322 0.003022 0.374 rs150196149 16 90060585 A G 0.982595 0.0728467 1960 367388 16:90126993 16:90060585:A:G missense_variant "" "" "" unknown Atopic dermatitis FLG 3.47e-15 1.0228 0.0003139 5.936 rs138726443 1 152307547 G A 0.989584 0.00736551 16 367388 1:152280023 1:152307547:G:A LC (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Atopic dermatitis FLG 1.36e-21 0.9411 0.001563 1.78 rs138381300 1 152312600 CACTG C 0.906426 0.0134898 86 367388 1:152285076 1:152312600:CACTG:C LC Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Atopic dermatitis FLG 2.21e-09 1.2865 rs61816761 1 152313385 G A 0.949337 0.00285801 0 367388 1:152285861 1:152313385:G:A LC (likely)Pathogenic Pathogenic/Likely pathogenic Criteria_multSubmitter dominant Atopic dermatitis DSC1 1.67e-07 0.4972 rs200047736 18 31134724 G C 0.984951 0.0122241 82 367388 18:28714687 18:31134724:G:C missense_variant "" "" "" unknown Atopic dermatitis RTEL1-TNFRSF6B 2.69e-10 0.1485 4.283e-08 0.08 rs41309367 20 63678201 C T 0.995562 0.735231 199070 367388 20:62309554 20:63678201:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Atopic dermatitis RTEL1-TNFRSF6B 2.38e-12 0.1844 2.401e-10 0.097 rs2236506 20 63690302 G A 0.993536 0.804966 238564 367388 20:62321655 20:63690302:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Atopic dermatitis RTEL1 7.43e-12 0.178 1.096e-10 0.099 rs3208008 20 63694757 A C 0.99444 0.799357 235198 367388 20:62326110 20:63694757:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Atopic dermatitis RTEL1-TNFRSF6B 7.37e-12 -0.1781 5.16e-05 -0.152 rs2257440 20 63696914 C T 0.993832 0.200586 15238 367388 20:62328267 20:63696914:C:T missense_variant "" "" "" unknown Atopic dermatitis ARFRP1 1.13e-11 0.1767 1.532e-10 0.098 rs367993153 20 63701286 A AC 0.994044 0.800462 235864 367388 20:62332638 20:63701286:A:AC pLoF "" "" "" unknown Atopic dermatitis SLC2A4RG 2.55e-09 0.1449 1.592e-08 0.084 rs8957 20 63742354 G T 0.999204 0.761252 213182 367388 20:62373707 20:63742354:G:T missense_variant "" "" "" unknown Dermatitis and eczema FLG 1.5e-08 0.3184 0.002897 0.964 rs138381300 1 152312600 CACTG C 0.906426 0.0134898 86 367388 1:152285076 1:152312600:CACTG:C LC Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Dermatitis and eczema RTEL1-TNFRSF6B 7.9e-09 0.0914 1.155e-08 0.053 rs2236506 20 63690302 G A 0.993536 0.804966 238564 367388 20:62321655 20:63690302:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter unknown Dermatitis and eczema RTEL1 7.33e-10 0.0966 1.919e-10 0.059 rs3208008 20 63694757 A C 0.99444 0.799357 235198 367388 20:62326110 20:63694757:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Dermatitis and eczema RTEL1-TNFRSF6B 7.92e-10 -0.0964 rs2257440 20 63696914 C T 0.993832 0.200586 15238 367388 20:62328267 20:63696914:C:T missense_variant "" "" "" unknown Dermatitis and eczema ARFRP1 1.66e-09 0.0947 4.006e-10 0.058 rs367993153 20 63701286 A AC 0.994044 0.800462 235864 367388 20:62332638 20:63701286:A:AC pLoF "" "" "" unknown Disorders of skin appendages PLCD1 1.31e-11 0.4211 rs75495843 3 38009720 G A 0.978452 0.0252322 292 367388 3:38051211 3:38009720:G:A missense_variant "" "" "" both Follicular cysts of skin and subcutaneous tissue PLCD1 4.5e-23 1.0923 rs75495843 3 38009720 G A 0.978452 0.0252322 292 367388 3:38051211 3:38009720:G:A missense_variant "" "" "" both Lichen simplex chronicus and prurigo HTT 7.09e-09 5.1183 rs1065746 4 3146897 G C 0.985732 0.00200061 2 367388 4:3148624 4:3146897:G:C missense_variant "" "" "" both Skin changes due to chronic exposure to nonionizing radiation TYR 4.45e-09 0.1923 1.038e-05 0.221 rs1126809 11 89284793 G A 0.998018 0.178944 11978 367388 11:89017961 11:89284793:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl both Skin changes due to chronic exposure to nonionizing radiation OCA2 5.48e-39 0.8508 1.744e-11 1.466 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Skin changes due to chronic exposure to nonionizing radiation OCA2 4.87e-08 0.3382 0.007999 0.516 rs1800407 15 27985172 C T 0.980961 0.0451648 766 367388 15:28230318 15:27985172:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Skin changes due to chronic exposure to nonionizing radiation GOLGA8M 5.66e-13 0.3281 2.764e-05 0.443 rs531763484 15 28702279 G A 0.96956 0.0889359 3026 367388 15:28947425 15:28702279:G:A missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation GOLGA8M 7.7e-12 0.304 2.664e-05 0.424 rs78557271 15 28702280 A G 0.96098 0.0930814 3298 367388 15:28947426 15:28702280:A:G missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation GOLGA8M 9.22e-12 0.3039 2.498e-05 0.428 rs2003233 15 28702528 G A 0.964317 0.0925561 3288 367388 15:28947674 15:28702528:G:A missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation GOLGA8M 1.52e-10 0.2958 0.0002519 0.398 rs200180898 15 28705604 T C 0.945257 0.0893878 3032 367388 15:28950750 15:28705604:T:C missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation GOLGA8M 9.18e-12 0.3042 3.865e-05 0.418 rs28623038 15 28708257 G A 0.975447 0.0913095 3216 367388 15:28953403 15:28708257:G:A missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation GOLGA8M 9.15e-12 0.3042 3.848e-05 0.418 rs28418661 15 28708266 C T 0.975453 0.0913122 3216 367388 15:28953412 15:28708266:C:T missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation SPATA33 1.87e-14 0.3015 5.526e-06 0.351 rs35415928 16 89657860 C T 0.996679 0.117334 5112 367388 16:89724268 16:89657860:C:T missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation FANCA 4.3e-09 0.2661 2.252e-05 0.455 rs1800282 16 89816599 A T 0.980732 0.0843686 2698 367388 16:89883007 16:89816599:A:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Skin changes due to chronic exposure to nonionizing radiation MC1R 1.73e-31 0.6111 9.545e-08 0.775 rs1805007 16 89919709 C T 0.989317 0.0670055 1688 367388 16:89986117 16:89919709:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Skin changes due to chronic exposure to nonionizing radiation MC1R 1.61e-14 0.3862 3.298e-05 0.55 rs1805008 16 89919736 C T 0.995937 0.0685896 1760 367388 16:89986144 16:89919736:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Skin changes due to chronic exposure to nonionizing radiation TUBB3 3.92e-10 0.2861 rs77681059 16 89933636 C T 0.995589 0.0827381 2522 367388 16:90000044 16:89933636:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Skin changes due to chronic exposure to nonionizing radiation PRDM7 7.61e-11 0.3181 0.00644 0.333 rs150196149 16 90060585 A G 0.982595 0.0728467 1960 367388 16:90126993 16:90060585:A:G missense_variant "" "" "" unknown Psoriasis GRID2IP 9.3e-08 0.2964 0.002189 0.488 rs184043502 7 6508277 G T 0.982421 0.0575658 1270 367388 7:6547908 7:6508277:G:T missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue TYR 4.58e-08 0.1691 6.14e-05 0.189 rs1126809 11 89284793 G A 0.998018 0.178944 11978 367388 11:89017961 11:89284793:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl both Radiation-related disorders of the skin and subcutaneous tissue OCA2 3.45e-37 0.7809 6.443e-11 1.343 rs74653330 15 27983407 C T 0.998927 0.0441359 812 367388 15:28228553 15:27983407:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Radiation-related disorders of the skin and subcutaneous tissue GOLGA8M 7.41e-12 0.2932 7.98e-05 0.389 rs531763484 15 28702279 G A 0.96956 0.0889359 3026 367388 15:28947425 15:28702279:G:A missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue GOLGA8M 1.27e-10 0.2687 9.571e-05 0.367 rs78557271 15 28702280 A G 0.96098 0.0930814 3298 367388 15:28947426 15:28702280:A:G missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue GOLGA8M 1.13e-10 0.2703 9.025e-05 0.37 rs2003233 15 28702528 G A 0.964317 0.0925561 3288 367388 15:28947674 15:28702528:G:A missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue GOLGA8M 1.21e-09 0.2643 0.0006605 0.346 rs200180898 15 28705604 T C 0.945257 0.0893878 3032 367388 15:28950750 15:28705604:T:C missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue GOLGA8M 1.47e-10 0.2688 0.0001201 0.364 rs28623038 15 28708257 G A 0.975447 0.0913095 3216 367388 15:28953403 15:28708257:G:A missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue GOLGA8M 1.47e-10 0.2688 0.0001196 0.364 rs28418661 15 28708266 C T 0.975453 0.0913122 3216 367388 15:28953412 15:28708266:C:T missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue SPATA33 3.9e-15 0.2921 7.387e-06 0.326 rs35415928 16 89657860 C T 0.996679 0.117334 5112 367388 16:89724268 16:89657860:C:T missense_variant "" "" "" unknown Radiation-related disorders of the skin and subcutaneous tissue FANCA 3.93e-08 0.2346 0.0001227 0.383 rs1800282 16 89816599 A T 0.980732 0.0843686 2698 367388 16:89883007 16:89816599:A:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Radiation-related disorders of the skin and subcutaneous tissue MC1R 3.12e-29 0.5528 1.458e-06 0.646 rs1805007 16 89919709 C T 0.989317 0.0670055 1688 367388 16:89986117 16:89919709:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Radiation-related disorders of the skin and subcutaneous tissue MC1R 2.91e-12 0.3297 0.0002901 0.441 rs1805008 16 89919736 C T 0.995937 0.0685896 1760 367388 16:89986144 16:89919736:C:T missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Radiation-related disorders of the skin and subcutaneous tissue TUBB3 8.91e-09 0.2474 rs77681059 16 89933636 C T 0.995589 0.0827381 2522 367388 16:90000044 16:89933636:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Radiation-related disorders of the skin and subcutaneous tissue PRDM7 1.25e-09 0.2793 rs150196149 16 90060585 A G 0.982595 0.0728467 1960 367388 16:90126993 16:90060585:A:G missense_variant "" "" "" unknown Urticaria GCSAML 6.35e-08 0.2786 rs56043070 1 247556467 G A 0.995762 0.0544492 1076 367388 1:247719769 1:247556467:G:A LC "" "" "" unknown Ankylosing spondylitis TNRC18 6.3e-10 1.5101 0.007229 3.803 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Ohter specific/unspecified arthritis KATNAL2 2.08e-08 0.3818 0.002045 0.683 rs145956232 18 47098283 GGAA G 0.998984 0.0390078 666 367388 18:44624654 18:47098283:GGAA:G inframe_indel "" "" "" unknown Palmar fascial fibromatosis [Dupuytren] MMP14 5.07e-08 0.2231 8.432e-05 0.228 rs1042704 14 22843385 G A 0.987987 0.208597 16228 367388 14:23312594 14:22843385:G:A missense_variant "" "" "" unknown Palmar fascial fibromatosis [Dupuytren] LRRK1 7.7e-10 1.2855 rs41531245 15 101029169 C T 0.975161 0.00764042 8 367388 15:101569374 15:101029169:C:T missense_variant "" "" "" unknown Gout SLC2A9 4.2e-20 -0.377 4.502e-07 -0.335 rs16890979 4 9920543 C T 0.999171 0.174763 11710 367388 4:9922167 4:9920543:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Gout ZNF518B 4.22e-08 -0.177 0.0001884 -0.135 rs66538112 4 10445544 C G 0.99801 0.306668 34634 367388 4:10447168 4:10445544:C:G missense_variant "" "" "" unknown Gout ABCG2 6.19e-35 0.7472 3.607e-08 0.915 rs2231142 4 88131171 G T 0.999142 0.074801 1936 367388 4:89052323 4:88131171:G:T missense_variant drug response drug response Criteria_multSubmitter dominant Gout ALDH16A1 8.05e-42 2.5123 rs150414818 19 49465749 C G 0.943671 0.00927085 44 367388 19:49969006 19:49465749:C:G missense_variant "" "" "" unknown Gout SIGLEC11 2.56e-11 0.7957 rs144427989 19 49960404 C G 0.98434 0.0171236 130 367388 19:50463661 19:49960404:C:G missense_variant "" "" "" unknown Polyarthropathies PTPN22 3.51e-21 -0.1965 1.548e-18 -0.103 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Polyarthropathies ABCG2 6.29e-10 0.1747 2.419e-05 0.311 rs2231142 4 88131171 G T 0.999142 0.074801 1936 367388 4:89052323 4:88131171:G:T missense_variant drug response drug response Criteria_multSubmitter dominant Polyarthropathies ALDH16A1 1.86e-16 0.6681 rs150414818 19 49465749 C G 0.943671 0.00927085 44 367388 19:49969006 19:49465749:C:G missense_variant "" "" "" unknown Rheumatoid arthritis PTPN22 6.31e-32 -0.3735 1.718e-27 -0.194 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Rheumatoid arthritis DCLRE1B 1.65e-12 0.2007 2.079e-06 0.2 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Systemic lupus erythematosus NCF2 7.98e-08 1.0852 2.237e-08 5.652 rs17849502 1 183563445 G T 0.992467 0.0378918 642 367388 1:183532580 1:183563445:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Memory loss APOE 3.05e-13 0.444 3.486e-08 0.605 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Migraine, single triptan purchase ok & required. ICD-code if available is included FHL5 4e-12 0.1224 5.707e-07 0.099 rs2273621 6 96610677 A G 0.999862 0.302794 33738 367388 6:97058553 6:96610677:A:G missense_variant "" "" "" unknown Migraine, single triptan purchase ok & required. ICD-code if available is included FHL5 6.26e-12 0.1215 9.75e-07 0.097 rs9373985 6 96615646 C G 0.998388 0.301523 33450 367388 6:97063522 6:96615646:C:G missense_variant "" "" "" unknown Myeloproliferative diseases JAK2 3.52e-124 52.0336 5.836e-21 43.208 rs77375493 9 5073770 G T 0.875366 0.000593378 24 367388 9:5073770 9:5073770:G:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Myeloproliferative diseases CHEK2 8.33e-08 2.1705 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Myeloproliferative diseases (CML excluded) JAK2 2.09e-122 46.5534 4.021e-20 34.652 rs77375493 9 5073770 G T 0.875366 0.000593378 24 367388 9:5073770 9:5073770:G:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Myeloproliferative diseases (CML excluded) CHEK2 1.98e-08 2.4855 rs555607708 22 28695868 AG A 0.982805 0.00733557 32 367388 22:29091856 22:28695868:AG:A pLoF Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl dominant Acute renal failure RP5-862P8.2 5.72e-09 1.6426 rs776921086 1 233328172 C G 0.933914 0.00579496 14 367388 1:233463918 1:233328172:C:G missense_variant "" "" "" unknown Disorders of breast KCNU1 6.16e-09 -0.1548 0.009976 -0.123 rs16885577 8 36930961 A G 0.999761 0.133026 6628 367388 8:36788479 8:36930961:A:G missense_variant "" "" "" unknown Dialysis NPHS1 3.66e-12 2.9077 1.085e-15 12.552 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Endometriosis AKAP12 1.79e-11 0.2704 0.009988 0.277 rs61748676 6 151351050 A T 0.955475 0.064044 1542 367388 6:151672185 6:151351050:A:T missense_variant "" "" "" unknown Endometriosis of ovary PPP1R26 1.17e-07 0.6323 rs199680517 9 135486839 G A 0.97936 0.0172597 68 367388 9:138378685 9:135486839:G:A missense_variant "" "" "" unknown Endometriosis of rectovaginal septum and vagina AKAP12 1.24e-09 0.591 0.004681 0.733 rs61748676 6 151351050 A T 0.955475 0.064044 1542 367388 6:151672185 6:151351050:A:T missense_variant "" "" "" unknown Noninflammatory disorders of female genital tract SEMA3F 2.09e-07 -0.0554 5.696e-08 -0.036 rs1046956 3 50185493 T A 0.998442 0.743263 202970 367388 3:50222926 3:50185493:T:A missense_variant "" "" "" unknown Hypertrophy of breast KCNU1 5.15e-13 -0.3809 0.0001258 -0.37 rs16885577 8 36930961 A G 0.999761 0.133026 6628 367388 8:36788479 8:36930961:A:G missense_variant "" "" "" unknown Nephrotic syndrome FFAR3 3.28e-07 1.1459 1.471e-08 6.75 rs4806132 19 35358981 C G 0.968878 0.0354829 496 367388 19:35849883 19:35358981:C:G missense_variant "" "" "" unknown Nephrotic syndrome NPHS1 1.29e-14 4.042 6.207e-22 33.507 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Postmenopausal atrophic vaginitsi FGD6 1.12e-08 11.0043 rs150803698 12 95210691 T C 0.95033 0.000770303 0 367388 12:95604467 12:95210691:T:C missense_variant "" "" "" unknown Hyperplasia of prostate SLC25A37 2.39e-08 -0.1174 0.0008076 -0.089 rs2942194 8 23566156 A G 0.990837 0.258811 24654 367388 8:23423669 8:23566156:A:G missense_variant "" "" "" unknown Nonalcoholic fatty liver disease PNPLA3 3.78e-20 0.6505 6.213e-14 0.776 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Nonalcoholic fatty liver disease SAMM50 1.39e-16 0.5822 1.521e-08 0.565 rs3761472 22 43972242 A G 0.999887 0.224272 18756 367388 22:44368122 22:43972242:A:G missense_variant "" "" "" unknown Other degenerative diseases of the nervous system ZNF225 5.48e-08 0.3515 rs16978738 19 44132649 A T 0.995306 0.0330005 432 367388 19:44636802 19:44132649:A:T missense_variant "" "" "" unknown Other degenerative diseases of the nervous system ZNF227 5.06e-08 0.3503 rs922063 19 44228505 C G 0.997738 0.0332183 432 367388 19:44732658 19:44228505:C:G missense_variant "" "" "" unknown Other degenerative diseases of the nervous system ZNF229 5.16e-09 0.3868 rs141069725 19 44428551 C T 0.99554 0.0316096 382 367388 19:44932726 19:44428551:C:T missense_variant "" "" "" unknown Other degenerative diseases of the nervous system APOE 2.01e-13 0.1867 4.692e-11 0.106 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Other degenerative diseases of the nervous system APOE 2.8e-08 0.7488 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Other degenerative diseases of the nervous system APOE 6.81e-127 0.7467 9.444e-65 0.882 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Other degenerative diseases of the nervous system CLPTM1 1.24e-07 0.1826 8.199e-08 0.102 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Other degenerative diseases of the nervous system PPP1R37 3.46e-13 0.3603 rs549046469 19 45145480 C A 0.984526 0.0584205 1350 367388 19:45648738 19:45145480:C:A missense_variant "" "" "" unknown Other degenerative diseases of the nervous system EXOC3L2 1.4e-12 0.2777 0.002314 0.253 rs10411314 19 45224801 T C 0.993517 0.0939252 3270 367388 19:45728059 19:45224801:T:C missense_variant "" "" "" unknown Intrahepatic Cholestasis of Pregnancy (ICP) GCKR 3.98e-08 0.3067 8.337e-08 0.204 rs1260326 2 27508073 T C 0.995194 0.648905 154626 367388 2:27730940 2:27508073:T:C missense_variant association association no_Criteria unknown Intrahepatic Cholestasis of Pregnancy (ICP) ABCG8 1.23e-10 0.4263 2.91e-05 0.388 rs4148217 2 43872294 C A 0.983786 0.216158 17372 367388 2:44099433 2:43872294:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Intrahepatic Cholestasis of Pregnancy (ICP) ABCB11 4.15e-08 0.2902 6.385e-09 0.252 rs2287622 2 168973818 A G 0.999486 0.509943 95854 367388 2:169830328 2:168973818:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Intrahepatic Cholestasis of Pregnancy (ICP) PPP4R4 1.74e-08 7.1343 rs202012355 14 94208483 G C 0.966445 0.00109693 2 367388 14:94674820 14:94208483:G:C missense_variant "" "" "" unknown Intrahepatic Cholestasis of Pregnancy (ICP) SERPINA1 8.09e-17 1.8298 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Intrahepatic Cholestasis of Pregnancy (ICP) HNF4A 2.43e-09 0.815 rs1800961 20 44413724 C T 0.995363 0.0450614 752 367388 20:43042364 20:44413724:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Colectomy operation ALDH4A1 4.27e-07 0.5378 rs61757683 1 18872954 G T 0.984029 0.0360028 490 367388 1:19199448 1:18872954:G:T missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Other ILD-related CVD-co-morbidities FGA 4.11e-14 0.2148 1.752e-05 0.133 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Parkinson's disease, strict definition (more controls excluded) GBA 2.56e-07 0.514 rs2230288 1 155236376 C T 0.997941 0.0415229 612 367388 1:155206167 1:155236376:C:T missense_variant risk factor Conflicting interpretations of pathogenicity, risk factor Criteria_multSubmitter both Polycythaemia vera JAK2 2.82e-115 101.1283 1.286e-24 93.672 rs77375493 9 5073770 G T 0.875366 0.000593378 24 367388 9:5073770 9:5073770:G:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Immune disease comorbidities PTPN22 2.61e-19 -0.176 2.357e-17 -0.094 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Medication related adverse effects (Asthma/COPD) CASP7 5.51e-05 0.178 9.843e-11 1.539 rs141266925 10 113725526 T C 0.995973 0.0150468 90 367388 10:115485285 10:113725526:T:C missense_variant "" "" "" unknown Cleft lip and cleft palate SERTAD4 6.65e-11 3.5248 0.001043 10.085 rs138733991 1 210242225 C T 0.992738 0.0234765 230 367388 1:210415570 1:210242225:C:T missense_variant "" "" "" unknown Other congenital malformations of the digestive system PRKCSH 5.68e-31 45.1912 rs371330547 19 11449175 CGT C 0.97776 0.000590656 0 367388 19:11559990 19:11449175:CGT:C pLoF (likely)Pathogenic Pathogenic no_Criteria dominant Abdominal and pelvic pain ABCG5 6.8e-08 0.0809 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Abdominal and pelvic pain ABCG8 1.27e-08 0.0845 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Abnormal findings on examination of blood, without diagnosis KLK3 3.9e-08 -0.2289 rs17632542 19 50858501 T C 0.998998 0.0671307 1736 367388 19:51361757 19:50858501:T:C missense_variant "" "" "" unknown Abnormal serum enzyme levels HOXB13 6.39e-10 1.0538 0.0003819 5.418 rs138213197 17 48728343 C T 0.99205 0.00755332 28 367388 17:46805705 17:48728343:C:T missense_variant risk factor Pathogenic/Likely pathogenic, risk factor Criteria_multSubmitter unknown Abnormal serum enzyme levels KLK3 1.94e-11 -0.3783 0.008431 -0.379 rs17632542 19 50858501 T C 0.998998 0.0671307 1736 367388 19:51361757 19:50858501:T:C missense_variant "" "" "" unknown Malaise and fatigue TTC8 3.51e-08 0.5833 rs142938748 14 88872358 A G 0.995673 0.00998944 22 367388 14:89338702 14:88872358:A:G missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Other general symptoms and signs TTC39B 1.16e-07 2.5335 rs74561491 9 15187994 A T 0.952119 0.00980435 50 367388 9:15187992 9:15187994:A:T missense_variant "" "" "" unknown Other symptoms and signs involving cognitive functions and awareness APOE 1.22e-30 0.3081 1.795e-13 0.317 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Rash and other nonspecific skin eruption NELL1 1.02e-07 2.8213 rs146222427 11 20919317 G T 0.994765 0.00221564 6 367388 11:20940863 11:20919317:G:T missense_variant "" "" "" unknown Symptoms and signs involving cognition, perception, emotional state and behaviour APOE 3.11e-10 0.0947 0.0002481 0.086 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Symptoms and signs involving the digestive system and abdomen ABCG8 7.89e-08 0.0759 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Unspecified urinary incontinence MIRLET7BHG 6.7e-08 0.7427 rs78060012 22 46103226 C T 0.913534 0.03235 340 367388 22:46499106 22:46103226:C:T LC "" "" "" unknown Other/unspecified rheumatoid arthritis PTPN22 6.62e-17 -0.4544 1.966e-16 -0.249 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Other/unspecified rheumatoid arthritis DCLRE1B 1.05e-09 0.2946 3.865e-05 0.3 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Other (seronegative) rheumatoid arthritis, wide PTPN22 1.57e-17 -0.3764 2.082e-15 -0.196 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Seronegative rheumatoid arthritis PTPN22 2.57e-08 -0.3029 5.485e-06 -0.138 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Seropositive rheumatoid arthritis PTPN22 5.91e-34 -0.4461 1.397e-28 -0.228 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Seropositive rheumatoid arthritis DCLRE1B 1.37e-15 0.2618 9.056e-08 0.262 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Other/unspecified seropositiverheumatoid arthritis PTPN22 1.87e-34 -0.4502 1.669e-28 -0.227 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Other/unspecified seropositiverheumatoid arthritis DCLRE1B 2.78e-15 0.2586 2.291e-08 0.277 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Seropositive rheumatoid arthritis, strict definition PTPN22 7.08e-14 -0.5628 2.438e-12 -0.292 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Seropositive rheumatoid arthritis, wide PTPN22 4.99e-34 -0.4439 4.236e-28 -0.224 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Seropositive rheumatoid arthritis, wide DCLRE1B 2.55e-15 0.257 3.41e-08 0.271 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Other arthritis (FG) KATNAL2 2.84e-08 0.3422 0.006035 0.548 rs145956232 18 47098283 GGAA G 0.998984 0.0390078 666 367388 18:44624654 18:47098283:GGAA:G inframe_indel "" "" "" unknown Statin medication FAM151A 6.74e-25 -0.1782 0.0005772 -0.132 rs373739034 1 54610464 CCACTCCACATTCAGACCGTCATCCCCAGG C 0.975519 0.087771 2946 367388 1:55076137 1:54610464:CCACTCCACATTCAGACCGTCATCCCCAGG:C pLoF (likely)Benign Benign Criteria_oneSubmitter unknown Statin medication MROH7 6.74e-12 0.0898 3.149e-11 0.05 rs646356 1 54702100 T A 0.97752 0.833133 255218 367388 1:55167773 1:54702100:T:A missense_variant "" "" "" unknown Statin medication PARS2 3.61e-29 -0.2142 3.746e-06 -0.212 rs116816976 1 54759100 A C 0.990908 0.0699342 1982 367388 1:55224773 1:54759100:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Statin medication PCSK9 5.26e-119 -0.6135 2.95e-10 -0.577 rs11591147 1 55039974 G T 0.997581 0.0362532 510 367388 1:55505647 1:55039974:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Statin medication PCSK9 3.26e-33 0.1553 1.509e-29 0.084 rs540796 1 55058524 A G 0.999587 0.830493 253606 367388 1:55524197 1:55058524:A:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Statin medication PCSK9 3.98e-33 0.1551 1.604e-29 0.084 rs562556 1 55058564 G A 0.99985 0.83046 253582 367388 1:55524237 1:55058564:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter unknown Statin medication DAB1 1.14e-17 -0.3042 0.0001391 -0.599 rs34341631 1 57023566 C T 0.996817 0.0191188 166 367388 1:57489239 1:57023566:C:T missense_variant "" "" "" dominant Statin medication CELSR2 1.21e-08 -0.2071 rs72703203 1 109267578 G A 0.996253 0.0182205 168 367388 1:109810200 1:109267578:G:A missense_variant "" "" "" unknown Statin medication CELSR2 1.44e-09 -0.2385 rs77619489 1 109273244 C T 0.995787 0.015798 68 367388 1:109815866 1:109273244:C:T missense_variant "" "" "" unknown Statin medication SYPL2 1.05e-11 -0.1285 0.009882 -0.126 rs62623713 1 109476817 A G 0.996119 0.0713306 1868 367388 1:110019439 1:109476817:A:G missense_variant "" "" "" unknown Statin medication APOB 1.09e-24 0.1128 6.581e-23 0.068 rs1042034 2 21002409 C T 0.999921 0.733192 197602 367388 2:21225281 2:21002409:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Statin medication APOB 2.76e-25 -0.1142 3.965e-09 -0.079 rs676210 2 21008652 G A 0.999962 0.266408 26266 367388 2:21231524 2:21008652:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Statin medication APOB 3.91e-37 -0.2483 0.0001071 -0.201 rs533617 2 21011100 T C 0.998319 0.0668612 1708 367388 2:21233972 2:21011100:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Statin medication APOB 1.18e-63 0.1813 3.53e-31 0.146 rs1367117 2 21041028 G A 0.999383 0.28033 29396 367388 2:21263900 2:21041028:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Statin medication GCKR 8.84e-16 -0.082 8.883e-14 -0.052 rs1260326 2 27508073 T C 0.995194 0.648905 154626 367388 2:27730940 2:27508073:T:C missense_variant association association no_Criteria unknown Statin medication ZFP36L2 3.74e-08 -0.1741 rs538857577 2 43224855 C T 0.99412 0.0244592 284 367388 2:43451994 2:43224855:C:T missense_variant "" "" "" unknown Statin medication ABCG5 8.15e-34 -0.2138 6.66e-05 -0.164 rs6756629 2 43837951 G A 0.997274 0.082877 2548 367388 2:44065090 2:43837951:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Statin medication ABCG8 1.59e-33 -0.2107 2.655e-05 -0.169 rs11887534 2 43839108 G C 0.998408 0.0844584 2646 367388 2:44066247 2:43839108:G:C missense_variant risk factor Benign/Likely benign, risk factor Criteria_multSubmitter recessive Statin medication ANKRD31 8.79e-17 0.0985 1.903e-07 0.086 rs56174528 5 75104691 G C 0.999852 0.213393 16780 367388 5:74400516 5:75104691:G:C missense_variant "" "" "" unknown Statin medication ANKRD31 6.35e-11 0.0901 6.7e-05 0.096 rs6893216 5 75147139 T C 0.999139 0.144776 7716 367388 5:74442964 5:75147139:T:C missense_variant "" "" "" unknown Statin medication ANKRD31 2.54e-17 0.0849 8.244e-08 0.053 rs1422698 5 75147307 C T 0.999966 0.372565 51006 367388 5:74443132 5:75147307:C:T missense_variant "" "" "" unknown Statin medication ANKRD31 2.12e-17 0.0851 6.01e-08 0.054 rs10563854 5 75195890 TTCA T 0.999602 0.372481 50996 367388 5:74491715 5:75195890:TTCA:T inframe_indel "" "" "" unknown Statin medication POLK 2.09e-11 0.0973 7.318e-07 0.133 rs5744694 5 75590468 GTTT G 0.998667 0.12762 6086 367388 5:74886293 5:75590468:GTTT:G inframe_indel "" "" "" unknown Statin medication ANKDD1B 2.51e-13 0.0836 9.05e-07 0.073 rs9332464 5 75625861 G A 0.999769 0.235081 20440 367388 5:74921686 5:75625861:G:A missense_variant "" "" "" unknown Statin medication SLC22A1 1.14e-17 0.4303 rs2282143 6 160136611 C T 0.999447 0.0095131 42 367388 6:160557643 6:160136611:C:T missense_variant "" "" "" unknown Statin medication LPA 7.27e-21 0.4299 rs3798220 6 160540105 T C 0.998711 0.0116825 52 367388 6:160961137 6:160540105:T:C missense_variant "" "" "" unknown Statin medication CYP2W1 3.44e-08 -0.0598 3.811e-05 -0.053 rs3808348 7 988812 C T 0.993733 0.277823 28754 367388 7:1028448 7:988812:C:T missense_variant "" "" "" unknown Statin medication OBP2B 1.77e-12 0.1227 rs11244035 9 133205932 C T 0.969814 0.0871014 2788 367388 9:136081319 9:133205932:C:T missense_variant "" "" "" unknown Statin medication STKLD1 9.18e-11 0.1111 rs41302673 9 133405414 T G 0.988635 0.0881656 2996 367388 9:136270538 9:133405414:T:G missense_variant "" "" "" unknown Statin medication BUD13 1.09e-29 0.2158 2.375e-05 0.207 rs11820589 11 116763146 G A 0.99814 0.0699016 1840 367388 11:116633862 11:116763146:G:A missense_variant "" "" "" unknown Statin medication ZPR1 3.62e-29 0.2232 0.0001635 0.2 rs35120633 11 116784884 G A 0.999343 0.0635894 1528 367388 11:116655600 11:116784884:G:A missense_variant "" "" "" unknown Statin medication APOA5 3.77e-29 0.221 8.07e-06 0.232 rs3135506 11 116791691 G C 0.999267 0.0648824 1590 367388 11:116662407 11:116791691:G:C missense_variant risk factor risk factor no_Criteria dominant Statin medication APOA4 2.33e-09 -0.0698 9.494e-08 -0.038 rs5104 11 116821618 C T 0.994315 0.776781 222080 367388 11:116692334 11:116821618:C:T missense_variant "" "" "" unknown Statin medication PAFAH1B2 8.69e-08 -0.0763 7.787e-08 -0.043 rs4936367 11 117171661 G A 0.999937 0.865592 275378 367388 11:117042377 11:117171661:G:A missense_variant "" "" "" unknown Statin medication TRIM65 7.58e-08 -0.0624 4.33e-05 -0.064 rs7222757 17 75892346 A C 0.998473 0.22633 19038 367388 17:73888427 17:75892346:A:C missense_variant "" "" "" unknown Statin medication ATG4D 1.36e-13 -0.1047 0.0007619 -0.085 rs2304165 19 10548983 C T 0.998922 0.136959 6956 367388 19:10659659 19:10548983:C:T missense_variant "" "" "" unknown Statin medication KRI1 7.5e-09 0.1431 rs11545166 19 10561218 T G 0.991628 0.0405185 606 367388 19:10671894 19:10561218:T:G missense_variant "" "" "" unknown Statin medication SLC44A2 2.94e-25 0.1323 2.379e-24 0.075 rs2288904 19 10631494 A G 0.999678 0.823775 249314 367388 19:10742170 19:10631494:A:G missense_variant "" "" "" unknown Statin medication YIPF2 9.53e-24 -0.2106 0.002713 -0.171 rs17850995 19 10923363 T A 0.990447 0.0572964 1326 367388 19:11034039 19:10923363:T:A missense_variant "" "" "" unknown Statin medication LDLR 3.88e-09 0.2478 rs45508991 19 11123210 C T 0.997807 0.0133537 66 367388 19:11233886 19:11123210:C:T missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter dominant Statin medication CCDC159 5.16e-13 -0.1017 0.0006878 -0.084 rs111737410 19 11348993 G A 0.984818 0.139411 7276 367388 19:11459669 19:11348993:G:A missense_variant "" "" "" unknown Statin medication NCAN 2.03e-07 -0.0999 5.474e-08 -0.273 rs2228603 19 19219115 C T 0.98753 0.069809 1792 367388 19:19329924 19:19219115:C:T missense_variant "" "" "" unknown Statin medication TM6SF2 1.67e-08 -0.1121 6.723e-07 -0.266 rs58542926 19 19268740 C T 0.996009 0.0645503 1552 367388 19:19379549 19:19268740:C:T missense_variant "" "" "" unknown Statin medication TM6SF2 2.72e-10 -0.1413 2.186e-11 -0.451 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Statin medication ZNF574 1.53e-11 -0.2829 rs201596848 19 42080806 C T 0.982246 0.0140641 52 367388 19:42584958 19:42080806:C:T missense_variant "" "" "" unknown Statin medication CBLC 1.08e-20 -0.3073 rs3208856 19 44793549 C T 0.98973 0.0224449 198 367388 19:45296806 19:44793549:C:T missense_variant "" "" "" unknown Statin medication BCAM 3.73e-33 -0.4877 0.006969 -0.634 rs28399653 19 44812188 G A 0.994314 0.0149079 92 367388 19:45315445 19:44812188:G:A missense_variant (likely)Benign Benign no_Criteria recessive Statin medication BCAM 3.05e-33 -0.4882 0.006956 -0.634 rs28399654 19 44813331 G A 0.994023 0.0149134 92 367388 19:45316588 19:44813331:G:A missense_variant "" "" "" recessive Statin medication APOE 7.58e-17 0.0901 4.046e-15 0.054 rs440446 19 44905910 C G 0.994125 0.716098 188684 367388 19:45409167 19:44905910:C:G missense_variant "" "" "" both Statin medication APOE 2.03e-09 0.3319 rs769452 19 44907853 T C 0.995163 0.00781463 38 367388 19:45411110 19:44907853:T:C missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Statin medication APOE 2.63e-135 0.3143 1.129e-28 0.218 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Statin medication APOE 1.07e-212 -0.6905 0.002724 -0.206 rs7412 19 44908822 C T 0.996766 0.0532217 932 367388 19:45412079 19:44908822:C:T missense_variant drug response drug response Criteria_multSubmitter both Statin medication APOC4-APOC2 1.05e-12 0.0707 6.802e-06 0.041 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Statin medication CLPTM1 8.31e-13 0.1062 1.158e-12 0.058 rs9193 19 44993045 T C 0.993645 0.876311 282318 367388 19:45496303 19:44993045:T:C missense_variant "" "" "" unknown Statin medication MARK4 1.28e-07 -0.4586 rs144086640 19 45294407 C T 0.99491 0.00313021 4 367388 19:45797665 19:45294407:C:T missense_variant "" "" "" unknown Statin medication EML2 6.27e-14 -0.165 rs35384424 19 45642403 C T 0.979396 0.0524105 1116 367388 19:46145661 19:45642403:C:T missense_variant "" "" "" unknown Statin medication DMPK 9.32e-12 0.2178 0.003953 0.397 rs146680240 19 45771366 G A 0.993923 0.0234902 218 367388 19:46274624 19:45771366:G:A missense_variant "" "" "" dominant SLE (Finngen) NCF2 5.04e-08 1.1101 1.002e-08 6.233 rs17849502 1 183563445 G T 0.992467 0.0378918 642 367388 1:183532580 1:183563445:G:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Spondyloarthritis TNRC18 2.3e-09 0.9954 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Spondylopathies (FG) TNRC18 4.28e-10 1.2132 rs147458296 7 5362736 C T 0.977646 0.010278 48 367388 7:5402367 7:5362736:C:T missense_variant "" "" "" unknown Fracture of forearm IDUA 6.68e-09 0.1364 0.0008879 0.129 rs3755955 4 1000626 G A 0.995774 0.156777 8980 367388 4:994414 4:1000626:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Fracture of forearm IDUA 3.62e-09 0.139 0.0008666 0.13 rs6830825 4 1002131 G C 0.997595 0.155977 8896 367388 4:995919 4:1002131:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Fracture of forearm IDUA 3.24e-09 0.1394 0.0009258 0.129 rs6811373 4 1002209 A G 0.997825 0.156004 8900 367388 4:995997 4:1002209:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Fracture of forearm IDUA 3.24e-09 0.1394 0.0009246 0.129 rs6831021 4 1002224 G C 0.997857 0.156004 8900 367388 4:996012 4:1002224:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Fracture of forearm IDUA 3.63e-09 0.1388 0.0006937 0.133 rs6831280 4 1002377 G A 0.998859 0.156889 8858 367388 4:996165 4:1002377:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Fracture of forearm IDUA 3.22e-09 0.1394 0.0009556 0.129 rs73066479 4 1002902 G A 0.997545 0.156004 8900 367388 4:996690 4:1002902:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Fracture of forearm CPED1 1.85e-10 -0.1136 6.063e-05 -0.073 rs10953934 7 121261641 G A 0.99513 0.358098 47152 367388 7:120901695 7:121261641:G:A missense_variant "" "" "" unknown Injuries to the elbow and forearm CPED1 9.21e-09 -0.0876 0.0008892 -0.051 rs10953934 7 121261641 G A 0.99513 0.358098 47152 367388 7:120901695 7:121261641:G:A missense_variant "" "" "" unknown Adult-onset Still disease PTPN22 6.03e-21 -0.3901 1.962e-18 -0.204 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Adult-onset Still disease DCLRE1B 1.9e-08 0.2068 2.365e-05 0.231 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type1 diabetes, definitions combined PTPN22 1.77e-36 -0.5845 3.497e-29 -0.291 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type1 diabetes, definitions combined DCLRE1B 3.35e-10 0.2614 6.73e-06 0.278 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type1 diabetes, definitions combined INS 1.52e-34 0.5361 6.469e-35 0.309 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type1 diabetes, definitions combined INS 9.67e-24 -0.4907 0.000116 -0.332 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes, strict definition PTPN22 2.76e-32 -0.5962 4.071e-26 -0.3 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes, strict definition INS 5.29e-31 0.5583 1.992e-31 0.322 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes, strict definition INS 8.87e-21 -0.5037 0.0002125 -0.356 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes, strict definition, subgroup 1 PTPN22 8.65e-34 -0.6514 1.328e-27 -0.329 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes, strict definition, subgroup 1 INS 7.96e-29 0.5712 1.077e-29 0.333 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes, strict definition, subgroup 1 INS 6.91e-20 -0.5236 0.0006934 -0.344 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes, wide definition PTPN22 3.98e-41 -0.4048 1.088e-32 -0.203 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes, wide definition INS 2.42e-33 0.3356 1.723e-36 0.205 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes, wide definition INS 7.91e-25 -0.3199 0.000382 -0.185 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes, wide definition HNF1A 5.11e-08 0.2872 rs1800574 12 120979061 C T 0.998343 0.0427069 722 367388 12:121416864 12:120979061:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes, wide definition AIRE 6.84e-09 0.3258 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes, wide definition, subgroup 1 PTPN22 7.5e-49 -0.5245 1.598e-39 -0.266 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Type 1 diabetes, wide definition, subgroup 1 DCLRE1B 1.17e-09 0.1953 8.078e-06 0.209 rs11552449 1 113905767 C T 0.997669 0.189503 13270 367388 1:114448389 1:113905767:C:T missense_variant "" "" "" unknown Type 1 diabetes, wide definition, subgroup 1 INS 2.76e-42 0.4586 5.706e-46 0.277 rs3842753 11 2159830 T G 0.985937 0.791738 230246 367388 11:2181060 11:2159830:T:G missense_variant (likely)Benign Benign Criteria_oneSubmitter both Type 1 diabetes, wide definition, subgroup 1 INS 1.22e-30 -0.4324 4.558e-05 -0.261 rs3842752 11 2159843 G A 0.989477 0.155903 8944 367388 11:2181073 11:2159843:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 1 diabetes, wide definition, subgroup 1 AIRE 3.01e-08 0.368 rs74203920 21 44294411 C T 0.985394 0.0372848 576 367388 21:45714294 21:44294411:C:T missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Type 2 diabetes, definitions combined PPARG 9.76e-12 -0.1073 0.0006979 -0.084 rs1801282 3 12351626 C G 0.999961 0.168789 10730 367388 3:12393125 3:12351626:C:G missense_variant (likely)Benign Likely benign Criteria_oneSubmitter both Type 2 diabetes, definitions combined WFS1 5.27e-14 0.0946 7.909e-13 0.06 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes, definitions combined GPSM1 4.63e-14 -0.098 5.119e-08 -0.081 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Type 2 diabetes, definitions combined RP11-366L20.2 5.95e-10 0.2501 0.001448 0.563 rs73119894 12 65866936 G A 0.993848 0.0219278 194 367388 12:66260716 12:65866936:G:A missense_variant "" "" "" unknown Type 2 diabetes, definitions combined HNF1A 9.06e-11 -0.0854 1.446e-05 -0.067 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes, definitions combined CRB3 8.01e-08 0.7813 0.003904 2.229 rs141345495 19 6466466 C T 0.978145 0.00166581 10 367388 19:6466477 19:6466466:C:T missense_variant "" "" "" unknown Type 2 diabetes, definitions combined TM6SF2 7.07e-08 0.1456 0.0007271 0.271 rs187429064 19 19269704 A G 0.977229 0.0503228 1024 367388 19:19380513 19:19269704:A:G missense_variant "" "" "" unknown Type 2 diabetes, wide definition TET1 8.39e-09 0.1607 rs142008363 10 68572720 G T 0.984565 0.0737776 2178 367388 10:70332477 10:68572720:G:T missense_variant "" "" "" unknown Essential (haemorrhagic) thrombocythaemia JAK2 1.03e-36 78.5667 0.0006681 116.298 rs77375493 9 5073770 G T 0.875366 0.000593378 24 367388 9:5073770 9:5073770:G:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Disorders of thyroid, IBD co-morbidities PTPN22 5.88e-18 -0.3133 2.915e-16 -0.166 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Thyrotoxicosis PTPN22 2.6e-12 -0.2634 2.613e-11 -0.141 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Thyrotoxicosis CEP128 3.88e-11 0.1795 6.461e-06 0.118 rs2288347 14 80894614 C T 0.999714 0.385056 55018 367388 14:81360958 14:80894614:C:T missense_variant "" "" "" unknown Thyrotoxicosis SECISBP2L 1.39e-09 0.1764 1.159e-05 0.146 rs34895054 15 48992804 G C 0.992667 0.298464 32760 367388 15:49285001 15:48992804:G:C missense_variant "" "" "" unknown Vascular dementia (subcortical) APOE 3.64e-10 0.9814 5.766e-05 1.275 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Vascular dementia (undefined) APOE 4.78e-15 1.0039 1.752e-08 1.598 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Suicide or other Intentional self-harm APOE 6.27e-30 0.1355 2.485e-16 0.152 rs429358 19 44908684 T C 0.99757 0.182788 11772 367388 19:45411941 19:44908684:T:C missense_variant risk factor Likely pathogenic, other, risk factor Criteria_multSubmitter both Wet age-related macular degeneration CFH 7.54e-44 -0.6229 1.23e-11 -0.352 rs800292 1 196673103 G A 0.999831 0.291055 31154 367388 1:196642233 1:196673103:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Wet age-related macular degeneration CFHR4 3.35e-08 0.2664 6.012e-09 0.168 rs7417769 1 196907328 A G 0.984743 0.797636 235198 367388 1:196876458 1:196907328:A:G missense_variant "" "" "" unknown Wet age-related macular degeneration CFHR4 2.29e-14 0.4318 2.688e-06 0.466 rs10494745 1 196918327 G A 0.982065 0.14476 7950 367388 1:196887457 1:196918327:G:A missense_variant "" "" "" unknown Wet age-related macular degeneration CFHR5 2.35e-10 -0.6704 rs565457964 1 196994128 C CAA 0.986447 0.0401347 602 367388 1:196963258 1:196994128:C:CAA pLoF (likely)Benign Benign/Likely benign Criteria_multSubmitter dominant Wet age-related macular degeneration ASPM 8.6e-08 -0.4574 rs12138336 1 197101391 C G 0.989019 0.0582545 1270 367388 1:197070521 1:197101391:C:G missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter recessive Wet age-related macular degeneration TACC2 5e-08 0.3404 rs2295876 10 122211207 T A 0.992586 0.11177 4770 367388 10:123970722 10:122211207:T:A missense_variant "" "" "" unknown Wet age-related macular degeneration PLEKHA1 5e-15 0.3416 1.452e-15 0.22 rs1045216 10 122429681 A G 0.999948 0.708717 184508 367388 10:124189197 10:122429681:A:G missense_variant "" "" "" unknown Wet age-related macular degeneration ARMS2 1.62e-08 -0.3052 rs2736911 10 122454839 C T 0.998665 0.159891 9628 367388 10:124214355 10:122454839:C:T pLoF (likely)Benign Likely benign Criteria_oneSubmitter unknown Wet age-related macular degeneration ARMS2 1.9e-104 1.061 2.156e-91 1.407 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Family history of certain disabilities and chronic diseases leading to disablement MYBPC3 1.9e-08 25.971 rs397516005 11 47333566 G A 0.827562 0.000315742 0 367388 11:47355117 11:47333566:G:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter dominant Family history of certain disabilities and chronic diseases leading to disablement OR4A47 2.9e-09 37.7317 rs140340264 11 48489468 C T 0.895595 0.000239529 0 367388 11:48511020 11:48489468:C:T missense_variant "" "" "" unknown Persons with potential health hazards related to socioeconomic and psychosocial circumstances IRAK3 6.9e-09 -0.2405 5.629e-08 -0.12 rs1152888 12 66211448 A G 0.992389 0.912278 305836 367388 12:66605228 12:66211448:A:G missense_variant "" "" "" unknown Presence of cardiac and vascular implants and grafts ADAMTS7 1.13e-06 0.1947 rs189146505 15 78766388 A G 0.989541 0.0678683 1692 367388 15:79058730 15:78766388:A:G missense_variant "" "" "" unknown Hereditary retinal dystrophy CLRN1 1.84e-08 7.3087 0 390.999 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Other specified/unspecified hearing loss CLRN1 0 74.894 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Care involving use of rehabilitation procedures CLRN1 0 7.23 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Care involving use of rehabilitation procedures LRBA 0 7.822 rs145709687 4 150265730 G A 0.962385 0.000871014 4 367388 4:151186882 4:150265730:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Fitting and adjustment of other devices CLRN1 0 39.127 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Persons encountering health services in other circumstances LRBA 0 4.841 rs145709687 4 150265730 G A 0.962385 0.000871014 4 367388 4:151186882 4:150265730:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Presence of other devices CLRN1 0 65.343 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Wet age-related macular degeneration CFH 8.22e-69 -0.6965 5.308e-34 -0.373 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Lactose intolerance R3HDM1 1.4e-28 0.9284 1.01e-29 1.11 rs1446585 2 135649909 A G 0.998065 0.34911 45530 367388 2:136407479 2:135649909:A:G missense_variant "" "" "" unknown Sensorineural hearing loss GJB2 2.859e-28 6.485 rs398123814 13 20189546 AC A 0.990104 0.01156 52 367388 13:20763685 13:20189546:AC:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Conductive and sensorineural hearing loss GJB2 4.909e-27 6.042 rs398123814 13 20189546 AC A 0.990104 0.01156 52 367388 13:20763685 13:20189546:AC:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Other disorders of ear GJB2 9.29e-05 0.2149 9.266e-26 4.744 rs398123814 13 20189546 AC A 0.990104 0.01156 52 367388 13:20763685 13:20189546:AC:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Lactose intolerance, other/unspecified R3HDM1 1.16e-25 0.9434 8.618e-25 1.069 rs1446585 2 135649909 A G 0.998065 0.34911 45530 367388 2:136407479 2:135649909:A:G missense_variant "" "" "" unknown Degeneration of macula and posterior pole CFH 3.9e-49 -0.3277 4.041e-23 -0.168 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Alzheimer's disease, wide definition (more controls excluded) APOC4-APOC2 3.56e-33 0.324 3.511e-22 0.246 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Emphysema SERPINA1 7.9e-11 1.7889 2.161e-21 28 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Chronic kidney disease NPHS1 2.875e-21 42.335 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Renal failure NPHS1 8.53e-21 37.422 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Dementia APOC4-APOC2 1.44e-27 0.2389 1.883e-20 0.192 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Statin medication APOB 9.05e-25 -0.1004 2.977e-20 -0.069 rs679899 2 21028042 G A 0.999704 0.551156 111650 367388 2:21250914 2:21028042:G:A missense_variant (likely)Benign Benign/Likely benign Criteria_multSubmitter both Glomerulonephritis NPHS1 1.313e-19 31.604 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hereditary retinal dystrophy EYS 2.24e-11 6.8872 3.79e-19 224.21 rs528919874 6 63721375 TTCTGCATG T 0.98815 0.00692456 24 367388 6:64431271 6:63721375:TTCTGCATG:T pLoF (likely)Pathogenic Pathogenic/Likely pathogenic Criteria_multSubmitter recessive Transplanted organ and tissue status NPHS1 3.1e-09 1.6437 6.654e-19 29.194 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Lung transplantation NPHS1 4.52e-09 1.612 7.276e-19 29.411 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Alzheimer disease (more controls excluded) APOC4-APOC2 2e-28 0.3491 8.338e-19 0.265 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Diseases of the ear and mastoid process GJB2 9.669e-19 2.585 rs398123814 13 20189546 AC A 0.990104 0.01156 52 367388 13:20763685 13:20189546:AC:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Glomerular diseases NPHS1 3.489e-18 17.264 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive COPD-related respiratory insufficiency NPHS1 3.206e-17 20.396 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Organic, including symptomatic, mental disorders APOC4-APOC2 3.24e-24 0.1896 4.277e-17 0.148 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) APOC4-APOC2 2.1e-24 0.3796 4.982e-17 0.298 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Hypothyroidism, levothyroxin purchases SH2B3 6.44e-29 -0.1699 1.452e-16 -0.092 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Any dementia APOC4-APOC2 1.08e-21 0.2254 1.633e-16 0.183 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Hypothyroidism,other/unspecified SH2B3 1.78e-29 -0.137 1.852e-16 -0.073 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Any dementia (more controls excluded) APOC4-APOC2 6.27e-21 0.2253 2.456e-16 0.185 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Diabetic nephropathy NPHS1 1.54e-05 0.697 2.642e-16 14.071 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hypothyroidism and >3 levothyroxin purchases SH2B3 1.16e-28 -0.1693 2.704e-16 -0.092 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Diabetic nephropathy (more controls excluded) NPHS1 2.95e-05 0.6671 4.921e-16 12.833 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hypothyroidism (congenital or acquired) SH2B3 2.76e-28 -0.1674 5.246e-16 -0.09 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Persons with potential health hazards related to family and personal history and certain conditions influencing health status NPHS1 6.347e-16 12.865 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Bronchiectasis SERPINA1 1.41e-07 1.0594 2.645e-15 16.198 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Childhood asthma (age<16) (more controls excluded) GSDMA 7.99e-21 0.3128 2.802e-15 0.252 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Childhood asthma (age<16) GSDMA 1.07e-20 0.3121 3.419e-15 0.252 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Diabetes-related co-morbidities/complications (more controls excluded) NPHS1 4.451e-15 7.169 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Other hearing loss GJB2 6.144e-15 22.667 rs398123814 13 20189546 AC A 0.990104 0.01156 52 367388 13:20763685 13:20189546:AC:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Hypertension NPHS1 6.533e-15 9.282 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hypertensive diseases NPHS1 8.491e-15 9.199 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Dementia in Alzheimer disease APOC4-APOC2 3e-20 0.3482 9.413e-15 0.28 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Alzheimer disease APOC4-APOC2 1.14e-24 0.2975 9.535e-15 0.212 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Other degenerative diseases of the nervous system APOC4-APOC2 4.65e-20 0.2126 2.227e-14 0.167 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) GSDMB 4.27e-26 -0.3479 2.813e-14 -0.194 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Childhood asthma (age<16) GSDMB 6.34e-26 -0.3471 3.519e-14 -0.193 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Diseases of the myoneural junction and muscle CLCN1 1.89e-05 0.7107 3.665e-14 13.073 rs55960271 7 143351678 C T 0.995509 0.0165928 106 367388 7:143048771 7:143351678:C:T pLoF (likely)Pathogenic Pathogenic/Likely pathogenic Criteria_multSubmitter both Normotensive glaucoma RP11-145E5.5 1.78e-16 0.4699 7.283e-14 0.361 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Other degenerative diseases of the nervous system APOC4-APOC2 4.28e-21 0.2479 1.125e-13 0.184 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Alzheimer's disease (Late onset) APOC4-APOC2 1.47e-21 0.3292 1.25e-13 0.243 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Primary open-angle glaucoma, strict RP11-145E5.5 1.13e-16 0.246 1.473e-13 0.18 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) GSDMB 1.35e-25 -0.3427 2.641e-13 -0.197 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Chronic lower respiratory diseases GSDMA 8.24e-13 0.0764 2.933e-13 0.073 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Childhood asthma (age<16) GSDMB 1.78e-25 -0.3423 3.066e-13 -0.197 rs2305480 17 39905943 G A 0.999545 0.504415 93600 367388 17:38062196 17:39905943:G:A missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) GSDMB 1.06e-25 -0.3436 3.351e-13 -0.196 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Childhood asthma (age<16) GSDMB 1.39e-25 -0.3432 3.884e-13 -0.196 rs11078928 17 39908216 T C 0.99961 0.50466 93598 367388 17:38064469 17:39908216:T:C pLoF "" "" "" unknown Nephrotic syndrome WDR62 9.57e-08 1.0214 4.904e-13 6.801 rs17851503 19 36103951 G A 0.992618 0.0472008 838 367388 19:36594853 19:36103951:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Care involving dialysis NPHS1 1.6e-06 1.4676 5.674e-13 26.31 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Intrahepatic Cholestasis of Pregnancy (ICP) ABCG8 3.4e-22 -0.5238 7.438e-13 -0.36 rs4148211 2 43844604 A G 0.991933 0.442573 72234 367388 2:44071743 2:43844604:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Childhood asthma (age<16) (more controls excluded) ZPBP2 3.41e-23 -0.3267 1.122e-12 -0.178 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Childhood asthma (age<16) ZPBP2 5e-23 -0.3259 1.397e-12 -0.178 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) SH2B3 2.23e-17 -0.0974 1.745e-12 -0.059 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Asthma (more controls excluded) GSDMA 8.92e-13 0.0942 1.877e-12 0.087 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Conductive and sensorineural hearing loss C10orf90 2.251e-12 5.958 rs139123090 10 126459169 G A 0.962755 0.00847333 26 367388 10:128147738 10:126459169:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Hallux valgus (acquired) UQCC1 5.25e-15 0.1555 2.699e-12 0.103 rs4911494 20 35384111 C T 0.999857 0.573821 120892 367388 20:33971914 20:35384111:C:T missense_variant "" "" "" unknown Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 4.7e-16 -0.4303 3.656e-12 -0.286 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Disorders of the thyroid gland SH2B3 2.06e-21 -0.1062 3.678e-12 -0.057 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Gestational diabetes (for exclusion) MTNR1B 2.3e-19 0.2126 4.159e-12 0.121 rs1447350 11 92984961 G C 0.996537 0.577801 122848 367388 11:92718127 11:92984961:G:C missense_variant "" "" "" dominant Primary open-angle glaucoma RP11-145E5.5 4.37e-14 0.1967 4.32e-12 0.148 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Asthma GSDMA 2.72e-12 0.0918 5e-12 0.085 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 6.37e-16 -0.429 6.692e-12 -0.284 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other chronic obstructive pulmonary disease SERPINA1 8.84e-06 0.3516 8.209e-12 3.887 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Female infertility PKHD1L1 8.78e-07 0.2067 9.368e-12 0.825 rs17368310 8 109459837 G C 0.995384 0.0685678 1794 367388 8:110472066 8:109459837:G:C pLoF "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) GSDMA 6.02e-13 0.1009 1.387e-11 0.089 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Metabolic disorders SERPINA1 1.431e-11 1.72 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hereditary retinal dystrophy DST 1.53e-05 2.807 1.544e-11 88.402 rs201429821 6 56463608 G A 0.995524 0.0119601 58 367388 6:56328406 6:56463608:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Sensorineural hearing loss GJB2 1.564e-11 1.529 rs35887622 13 20189481 A G 0.964565 367388 13:20763620 13:20189481:A:G missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter both Unspecified lump in breast PLTP 1.613e-11 15.455 rs56126980 20 45904979 C T 0.995209 367388 20:44533618 20:45904979:C:T missense_variant "" "" "" unknown Asthma (mode) GSDMA 1.35e-12 0.0948 2.072e-11 0.084 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Female infertility, cervigal, vaginal, other or unspecified origin PKHD1L1 4.13e-06 0.2035 2.808e-11 0.873 rs17368310 8 109459837 G C 0.995384 0.0685678 1794 367388 8:110472066 8:109459837:G:C pLoF "" "" "" unknown IBD patients in KELA-register MST1 3.89e-11 0.183 3.015e-11 0.178 rs3197999 3 49684099 G A 0.999906 0.392288 56796 367388 3:49721532 3:49684099:G:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) GSDMA 1.59e-12 0.0988 3.099e-11 0.087 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Conductive and sensorineural hearing loss GJB2 3.255e-11 1.431 rs35887622 13 20189481 A G 0.964565 367388 13:20763620 13:20189481:A:G missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter both Sensorineural hearing loss C10orf90 3.576e-11 5.842 rs139123090 10 126459169 G A 0.962755 0.00847333 26 367388 10:128147738 10:126459169:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Cholelithiasis FUT6 5.9e-10 0.0846 3.65e-11 0.088 rs778805 19 5832198 G A 0.999513 0.382909 54144 367388 19:5832209 19:5832198:G:A missense_variant "" "" "" unknown Lactose intolerance LCT 1.5e-21 -0.8782 3.693e-11 -0.36 rs2322659 2 135798089 T C 0.999886 0.7305 196510 367388 2:136555659 2:135798089:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Pain (limb, back, neck, head abdominally) TMEM214 5.45e-08 -0.0426 3.792e-11 -0.061 rs1124649 2 27037601 G A 0.997405 0.280815 29122 367388 2:27260469 2:27037601:G:A missense_variant "" "" "" unknown Statin medication HNF1A 1.55e-14 0.0775 6.949e-11 0.065 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Other joint disorders UQCC1 3.5e-13 0.0696 7.504e-11 0.046 rs4911494 20 35384111 C T 0.999857 0.573821 120892 367388 20:33971914 20:35384111:C:T missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) GSDMA 1.69e-16 -0.276 7.691e-11 -0.158 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Interstitial lung disease MUC5B 6.44e-18 -0.3341 7.882e-11 -0.193 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Asthma, hospital admissions , main diagnosis only GSDMA 3.46e-12 0.0946 8.625e-11 0.083 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Other insterstitial pulmonary diseases MUC5B 5.21e-18 -0.3349 9.102e-11 -0.193 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Childhood asthma (age<16) GSDMA 2.35e-16 -0.275 9.46e-11 -0.158 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Hypertensive diseases SH2B3 1.09e-14 -0.0776 1.085e-10 -0.047 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Dialysis WDR62 3.17e-08 0.9298 1.102e-10 4.184 rs17851503 19 36103951 G A 0.992618 0.0472008 838 367388 19:36594853 19:36103951:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Endometriosis SYNE1 2.32e-11 -0.13 1.206e-10 -0.098 rs4645434 6 152344126 C A 0.999937 0.541648 108228 367388 6:152665261 6:152344126:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Hypertension SH2B3 9.63e-15 -0.0783 1.235e-10 -0.047 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown COPD, hospital admissions SERPINA1 2.33e-05 0.3311 1.264e-10 3.404 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Lactose intolerance, other/unspecified LCT 2.86e-18 -0.8594 1.341e-10 -0.377 rs2322659 2 135798089 T C 0.999886 0.7305 196510 367388 2:136555659 2:135798089:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive IBD patients in KELA-register BSN 2.35e-10 0.1742 1.372e-10 0.165 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown COPD, early/later onset SERPINA1 2.42e-05 0.3283 1.384e-10 3.38 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Benign neoplasm of breast (other cancers excluded from controls) PLTP 1.397e-10 15.042 rs56126980 20 45904979 C T 0.995209 367388 20:44533618 20:45904979:C:T missense_variant "" "" "" unknown Hypertension LSP1 1.22e-11 0.0685 1.413e-10 0.06 rs621679 11 1881538 G A 0.991394 0.413239 63334 367388 11:1902768 11:1881538:G:A missense_variant "" "" "" unknown Hypertensive diseases LSP1 1.21e-11 0.0681 1.443e-10 0.06 rs621679 11 1881538 G A 0.991394 0.413239 63334 367388 11:1902768 11:1881538:G:A missense_variant "" "" "" unknown Interstitial lung disease MUC5B 1.15e-17 -0.3321 1.472e-10 -0.192 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other insterstitial pulmonary diseases MUC5B 8.72e-18 -0.3332 1.658e-10 -0.191 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant ILD, hospital admissions 1, main diag only MUC5B 1.72e-16 -0.3405 1.785e-10 -0.202 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Allergic asthma (mode) (more controls excluded) GSDMA 3.03e-09 0.1464 1.792e-10 0.15 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Genitourinary diseases NPHS1 1.897e-10 2.612 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Transplanted organ and tissue status WDR62 1.92e-05 0.4637 1.959e-10 3.249 rs17851503 19 36103951 G A 0.992618 0.0472008 838 367388 19:36594853 19:36103951:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Gout, unspecified SLC2A9 5.2e-14 0.2894 2.005e-10 0.191 rs2276961 4 10021357 C T 0.997243 0.5371 106128 367388 4:10022981 4:10021357:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Hereditary retinal dystrophy CNGB1 5.82e-07 5.0517 2.01e-10 124.317 rs201162411 16 57901371 T A 0.990294 0.00623319 28 367388 16:57935275 16:57901371:T:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Hypothyroidism, drug reimbursement SH2B3 1.23e-17 -0.2032 2.039e-10 -0.11 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Inflammatory bowel disease, strict (require KELA) MST1 7.14e-10 0.1773 2.098e-10 0.177 rs3197999 3 49684099 G A 0.999906 0.392288 56796 367388 3:49721532 3:49684099:G:A missense_variant "" "" "" unknown Allergic asthma (mode) GSDMA 3.95e-09 0.1449 2.39e-10 0.149 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) GSDMA 2.1e-14 0.2519 2.424e-10 0.185 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown Childhood asthma (age<16) GSDMA 2.16e-14 0.2521 2.442e-10 0.186 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown ILD, hospital admissions MUC5B 1.12e-17 -0.3345 2.696e-10 -0.189 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Cholelithiasis, broad definition with cholecystitis SLC3A1 1.71e-14 0.1023 2.698e-10 0.06 rs698761 2 44320435 G A 0.998557 0.603329 134298 367388 2:44547574 2:44320435:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter both Cholelithiasis, broad definition with cholecystitis FUT6 7.34e-10 0.0824 2.826e-10 0.082 rs778805 19 5832198 G A 0.999513 0.382909 54144 367388 19:5832209 19:5832198:G:A missense_variant "" "" "" unknown Other specified congenital malformation syndromes affecting multiple systems TRIM37 6.29e-05 3.9159 2.985e-10 37.451 rs186251998 17 59079879 T C 0.960066 0.0052288 10 367388 17:57157240 17:59079879:T:C pLoF "" "" "" recessive Asthma/COPD (KELA code 203) SERPINA1 3.461e-10 1.701 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Other heart diseases NPHS1 3.519e-10 7.857 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive ILD, hospital admissions 1, main diag only MUC5B 2.56e-16 -0.3391 3.575e-10 -0.2 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Lung transplantation WDR62 2.06e-05 0.461 3.66e-10 3.106 rs17851503 19 36103951 G A 0.992618 0.0472008 838 367388 19:36594853 19:36103951:G:A missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter recessive Gout SLC2A9 1.29e-12 0.213 3.847e-10 0.146 rs2276961 4 10021357 C T 0.997243 0.5371 106128 367388 4:10022981 4:10021357:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Undefined dementia (more controls excluded) APOC4-APOC2 1.43e-11 0.2957 3.865e-10 0.265 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Other retinal disorders CFH 5.89e-23 -0.1597 3.917e-10 -0.076 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Hypertension, essential SH2B3 6.55e-14 -0.0821 4.466e-10 -0.05 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown ILD, hospital admissions MUC5B 1.75e-17 -0.333 4.737e-10 -0.188 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Inflammatory bowel disease, strict (require KELA) BSN 2.2e-09 0.1709 4.878e-10 0.166 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown Cholelithiasis SLC3A1 4.57e-14 0.1027 5.556e-10 0.061 rs698761 2 44320435 G A 0.998557 0.603329 134298 367388 2:44547574 2:44320435:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter both Gout, FINNGEN SLC2A9 1.57e-12 0.2095 6.013e-10 0.143 rs2276961 4 10021357 C T 0.997243 0.5371 106128 367388 4:10022981 4:10021357:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetes mellitus in pregnancy ACOXL 6.49e-10 6.805 rs150003283 2 110794148 G A 0.99526 367388 2:111551725 2:110794148:G:A missense_variant "" "" "" unknown Actinic keratosis FANCA 4.35e-14 0.1956 7.81e-10 0.139 rs7190823 16 89799635 T C 0.988053 0.459773 77656 367388 16:89866043 16:89799635:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas UGT1A6 4.82e-08 0.0658 8.148e-10 0.065 rs1105879 2 233693556 A C 0.999952 0.451147 75358 367388 2:234602202 2:233693556:A:C missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Cholelithiasis, broad definition with cholecystitis UGT1A6 3.04e-08 0.0734 8.333e-10 0.075 rs2070959 2 233693545 A G 0.999944 0.414061 63450 367388 2:234602191 2:233693545:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Renal tubulo-intestitial diseases NPHS1 8.714e-10 7.3 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Type 1 diabetes without complications TH 2.13e-16 0.2096 9.881e-10 0.137 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Alzheimer's disease, wide definition APOC4-APOC2 1.68e-12 0.1725 1.011e-09 0.114 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Type 1 diabetes, wide definition, subgroup 1 TH 1.91e-14 0.1979 1.039e-09 0.139 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Childhood asthma (age<16) (more controls excluded) ERBB2 1.61e-14 -0.2671 1.068e-09 -0.141 rs1058808 17 39727784 C G 0.999318 0.674565 167122 367388 17:37884037 17:39727784:C:G missense_variant not_provided not provided none unknown Hypertension LSP1 3.18e-11 0.0674 1.124e-09 0.059 rs686722 11 1870492 C T 0.996813 0.395478 57866 367388 11:1891722 11:1870492:C:T missense_variant "" "" "" unknown Hypertensive diseases LSP1 3.14e-11 0.067 1.178e-09 0.058 rs686722 11 1870492 C T 0.996813 0.395478 57866 367388 11:1891722 11:1870492:C:T missense_variant "" "" "" unknown Childhood asthma (age<16) ERBB2 1.77e-14 -0.2671 1.234e-09 -0.141 rs1058808 17 39727784 C G 0.999318 0.674565 167122 367388 17:37884037 17:39727784:C:G missense_variant not_provided not provided none unknown Organic, including symptomatic, mental disorders APOC4-APOC2 1.85e-12 0.1302 1.574e-09 0.085 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Other retinal disorders CERKL 1.841e-09 7.516 rs200711686 2 181603943 G C 0.994958 0.00563165 20 367388 2:182468670 2:181603943:G:C missense_variant "" "" "" unknown Diabetes, varying definitions WFS1 6.47e-11 0.0685 1.932e-09 0.052 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Other retinal disorders EYS 2.109e-09 9.279 rs528919874 6 63721375 TTCTGCATG T 0.98815 0.00692456 24 367388 6:64431271 6:63721375:TTCTGCATG:T pLoF (likely)Pathogenic Pathogenic/Likely pathogenic Criteria_multSubmitter recessive Presence of other devices GJB2 2.223e-09 9.621 rs398123814 13 20189546 AC A 0.990104 0.01156 52 367388 13:20763685 13:20189546:AC:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Gestational diabetes (for exclusion) ACOXL 2.297e-09 8.066 rs150003283 2 110794148 G A 0.99526 367388 2:111551725 2:110794148:G:A missense_variant "" "" "" unknown Other respiratory diseases principally affecting the interstitium MUC5B 4.99e-16 -0.2814 2.31e-09 -0.158 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other diabetes, wide definition WFS1 1.96e-12 0.0793 2.44e-09 0.055 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Asthma and opportunit respiratory infection SERPINA1 8.33e-05 1.1047 2.635e-09 16.823 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Disorders of the thyroid gland TRMO 1.98e-13 0.0864 2.736e-09 0.075 rs2282192 9 97910056 C T 0.993649 0.321551 38204 367388 9:100672338 9:97910056:C:T missense_variant "" "" "" unknown UC patients in KELA-register ( KELA 208 prior to 1994, or ICD K51) MST1 1.92e-10 0.2004 2.794e-09 0.181 rs3197999 3 49684099 G A 0.999906 0.392288 56796 367388 3:49721532 3:49684099:G:A missense_variant "" "" "" unknown Cholelithiasis UGT1A6 1.54e-07 0.0709 2.904e-09 0.074 rs2070959 2 233693545 A G 0.999944 0.414061 63450 367388 2:234602191 2:233693545:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Gout, strict definition SLC2A9 8.23e-12 0.2879 2.905e-09 0.195 rs2276961 4 10021357 C T 0.997243 0.5371 106128 367388 4:10022981 4:10021357:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Diabetes-related co-morbidities/complications (more controls excluded) SH2B3 4.38e-11 -0.0646 2.922e-09 -0.042 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Chronic lower respiratory diseases GSDMA 9.21e-09 0.0606 3.333e-09 0.055 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown Skin changes due to chronic exposure to nonionizing radiation FANCA 2.55e-13 0.1852 3.634e-09 0.13 rs7190823 16 89799635 T C 0.988053 0.459773 77656 367388 16:89866043 16:89799635:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Other respiratory diseases principally affecting the interstitium MUC5B 8.88e-16 -0.2795 3.661e-09 -0.157 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Disorders of gallbladder, biliary tract and pancreas UGT1A3 1.68e-06 0.0581 4.268e-09 0.065 rs6431625 2 233729266 T C 0.999406 0.420509 65620 367388 2:234637912 2:233729266:T:C missense_variant "" "" "" unknown Dementia APOC4-APOC2 7.13e-11 0.1415 4.45e-09 0.097 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Type 1 diabetes, strict (exclude DM2) TH 1.12e-11 0.2271 4.49e-09 0.173 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Asthma (only as main-diagnosis) (more controls excluded) GSDMA 2.92e-08 0.0768 4.496e-09 0.072 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown Type 1 diabetes, wide definition, subgroup 1 SH2B3 3.66e-13 -0.1877 4.92e-09 -0.111 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown UC patients in KELA-register ( KELA 208 prior to 1994, or ICD K51) BSN 2.03e-09 0.1873 5.049e-09 0.171 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown Type 1 diabetes without complications SH2B3 2.57e-14 -0.1941 5.439e-09 -0.109 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Diabetes mellitus WFS1 9.4e-11 0.0683 5.524e-09 0.05 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Cardiac arrhytmias, COPD co-morbidities CAND2 1.53e-08 0.0665 5.531e-09 0.055 rs2305397 3 12815994 C T 0.997961 0.516266 97996 367388 3:12857493 3:12815994:C:T missense_variant "" "" "" unknown Coronary revascularization (ANGIO or CABG) RP11-145E5.5 2.17e-14 0.1402 6.123e-09 0.087 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Type1 diabetes, definitions combined TH 1.97e-11 0.2225 6.353e-09 0.17 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive IBD patients in KELA-register GPX1 7.06e-09 0.1581 6.393e-09 0.143 rs1050450 3 49357401 G A 0.999364 0.434756 69716 367388 3:49394834 3:49357401:G:A missense_variant (likely)Benign Benign no_Criteria recessive Hypothyroidism, drug reimbursement CTLA4 4.35e-12 0.1619 6.53e-09 0.107 rs231775 2 203867991 A G 0.999974 0.518705 99544 367388 2:204732714 2:203867991:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Alzheimer disease (more controls excluded) APOC4-APOC2 5.59e-10 0.1938 6.829e-09 0.138 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Type 2 diabetes, definitions combined SLC30A8 1.39e-10 -0.0781 8.433e-09 -0.069 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Malignant neoplasm of skin (other cancers excluded from controls) ALS2CR12 2.15e-13 -0.1286 8.63e-09 -0.075 rs13014235 2 201350769 C G 0.995831 0.576973 122106 367388 2:202215492 2:201350769:C:G missense_variant "" "" "" unknown Asthma (only as main-diagnosis) GSDMA 3.97e-08 0.0759 8.83e-09 0.07 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown Mucosal proctocolitis BSN 2.59e-07 0.198 8.959e-09 0.208 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) ALS2CR12 2.19e-13 -0.1288 9.401e-09 -0.075 rs13014235 2 201350769 C G 0.995831 0.576973 122106 367388 2:202215492 2:201350769:C:G missense_variant "" "" "" unknown Type 1 diabetes TH 1.81e-13 0.1717 9.513e-09 0.118 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Unspecified dementia APOC4-APOC2 2.47e-10 0.2629 9.729e-09 0.228 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Childhood asthma (age<16) (more controls excluded) STARD3 3.46e-14 -0.2661 1.02e-08 -0.132 rs1877031 17 39657827 G A 0.998956 0.684783 172280 367388 17:37814080 17:39657827:G:A missense_variant "" "" "" unknown Inflammatory bowel disease MST1 1.52e-08 0.1297 1.038e-08 0.126 rs3197999 3 49684099 G A 0.999906 0.392288 56796 367388 3:49721532 3:49684099:G:A missense_variant "" "" "" unknown Gastrointestinal diseases NPHS1 1.053e-08 1.973 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Arthropathies UQCC1 2.12e-11 0.055 1.063e-08 0.035 rs4911494 20 35384111 C T 0.999857 0.573821 120892 367388 20:33971914 20:35384111:C:T missense_variant "" "" "" unknown Medical observation and evaluation for suspected diseases and conditions NPHS1 1.063e-08 2.553 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Hereditary retinal dystrophy EYS 1.86e-06 4.9012 1.081e-08 153.741 rs143994166 6 65402507 A T 0.973242 0.00574597 12 367388 6:66112400 6:65402507:A:T pLoF (likely)Pathogenic Pathogenic Criteria_oneSubmitter recessive Statin medication ANKDD1B 1.01e-12 -0.0703 1.088e-08 -0.041 rs34358 5 75669297 G A 0.999741 0.593895 130000 367388 5:74965122 5:75669297:G:A pLoF "" "" "" unknown Diseases of the ear and mastoid process C10orf90 1.105e-08 2.56 rs139123090 10 126459169 G A 0.962755 0.00847333 26 367388 10:128147738 10:126459169:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Other disorders of ear GJB2 1.151e-08 1.064 rs35887622 13 20189481 A G 0.964565 367388 13:20763620 13:20189481:A:G missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter both Childhood asthma (age<16) STARD3 3.88e-14 -0.2659 1.17e-08 -0.132 rs1877031 17 39657827 G A 0.998956 0.684783 172280 367388 17:37814080 17:39657827:G:A missense_variant "" "" "" unknown Type 2 diabetes, strict (exclude DM1) SLC30A8 1.8e-10 -0.0773 1.188e-08 -0.068 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Immune disease comorbidities SH2B3 1.31e-10 -0.0909 1.227e-08 -0.059 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Hard cardiovascular diseases SH2B3 3.27e-11 -0.0827 1.246e-08 -0.052 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Cardiovascular diseases (excluding rheumatic etc) SH2B3 1.23e-12 -0.0623 1.25e-08 -0.036 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Varicose veins CEP250 1.274e-08 4.331 rs56259282 20 35504248 G A 0.951318 367388 20:34092076 20:35504248:G:A missense_variant "" "" "" recessive Motor neuron disease SOD1 1.306e-08 116.661 rs80265967 21 31667290 A C 0.99867 0.00915381 18 367388 21:33039603 21:31667290:A:C missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl both Asthma, hospital admissions , main diagnosis only GSDMA 6.87e-08 0.0725 1.332e-08 0.068 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown Acute tubulo-interstitial nephritis NPHS1 1.335e-08 10.894 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Inflammatory bowel disease, strict (require KELA) GPX1 3.74e-08 0.1562 1.358e-08 0.145 rs1050450 3 49357401 G A 0.999364 0.434756 69716 367388 3:49394834 3:49357401:G:A missense_variant (likely)Benign Benign no_Criteria recessive Cardiac murmurs and other cardiac sounds SLCO1A2 1.379e-08 1.031 rs10841795 12 21334610 A G 0.99995 367388 12:21487544 12:21334610:A:G missense_variant "" "" "" unknown Malignant neoplasm of skin ALS2CR12 4.22e-13 -0.1249 1.381e-08 -0.073 rs13014235 2 201350769 C G 0.995831 0.576973 122106 367388 2:202215492 2:201350769:C:G missense_variant "" "" "" unknown Thyrotoxicosis with diffuse goitr IGLV3-21 2.45e-09 -0.2218 1.385e-08 -0.189 rs4446155 22 22713048 G A 0.881217 0.454266 76154 367388 22:23055533 22:22713048:G:A missense_variant "" "" "" unknown Persons encountering health services for specific procedures and health care NPHS1 1.394e-08 4.981 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Undefined dementia APOC4-APOC2 4.3e-10 0.258 1.43e-08 0.224 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Thyrotoxicosis with diffuse goitr IGLV3-21 4.74e-09 -0.2181 1.473e-08 -0.19 rs1985791 22 22713054 G T 0.880787 0.450976 75072 367388 22:23055539 22:22713054:G:T missense_variant "" "" "" unknown Asthma (more controls excluded) GSDMA 6.72e-08 0.0704 1.503e-08 0.065 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) ALS2CR12 4.36e-13 -0.1249 1.512e-08 -0.072 rs13014235 2 201350769 C G 0.995831 0.576973 122106 367388 2:202215492 2:201350769:C:G missense_variant "" "" "" unknown Mild mental retardation ZNF415 1.563e-08 2.098 rs10410030 19 53108802 T C 0.996264 367388 19:53612055 19:53108802:T:C missense_variant "" "" "" unknown Hypothyroidism,other/unspecified CTLA4 3.24e-14 0.0909 1.564e-08 0.054 rs231775 2 203867991 A G 0.999974 0.518705 99544 367388 2:204732714 2:203867991:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Dependence on enabling machines and devices, not elsewhere classified NPHS1 2.13e-07 4.3321 1.679e-08 12.061 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Cholelithiasis UGT1A3 8.05e-06 0.0601 1.727e-08 0.069 rs6431625 2 233729266 T C 0.999406 0.420509 65620 367388 2:234637912 2:233729266:T:C missense_variant "" "" "" unknown COPD related to chronic (opportunist) infections SERPINA1 4.89e-05 1.9085 1.754e-08 47.651 rs28929474 14 94378610 C T 0.998563 0.0198482 154 367388 14:94844947 14:94378610:C:T missense_variant (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Interstitial lung disease endpoints SH2B3 1.82e-11 -0.0829 1.769e-08 -0.051 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Type 1 diabetes SH2B3 1.15e-13 -0.1726 1.778e-08 -0.096 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) WFS1 1.75e-09 0.0696 1.779e-08 0.053 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Disorders of choroid and retina CERKL 1.853e-08 5.723 rs200711686 2 181603943 G C 0.994958 0.00563165 20 367388 2:182468670 2:181603943:G:C missense_variant "" "" "" unknown Lung transplantation DMBT1 1.873e-08 36.648 rs189221852 10 122618145 G A 0.959452 367388 10:124377661 10:122618145:G:A missense_variant "" "" "" unknown Ulcerative ileocolitis BSN 1.3e-06 0.3138 1.895e-08 0.354 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown Postpartum haemorrhage USP8 2.048e-08 17.553 rs147742292 15 50465088 A G 0.994454 367388 15:50757285 15:50465088:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Type 2 diabetes SLC30A8 1.36e-09 -0.0702 2.052e-08 -0.064 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Secondary hypertension NPHS1 2.082e-08 30.649 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Transplanted organ and tissue status DMBT1 2.146e-08 35.738 rs189221852 10 122618145 G A 0.959452 367388 10:124377661 10:122618145:G:A missense_variant "" "" "" unknown Type 1 diabetes, strict definition FUT2 6.35e-07 0.184 2.208e-08 0.205 rs601338 19 48703417 G A 0.997446 0.374424 51810 367388 19:49206674 19:48703417:G:A pLoF association Benign, association no_Criteria recessive Motor neuron disease (with DMD) SOD1 5.26e-05 2.7917 2.251e-08 110.811 rs80265967 21 31667290 A C 0.99867 0.00915381 18 367388 21:33039603 21:31667290:A:C missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_multSubmitter_confl both Asthma, hospital admissions , main diagnosis only SLC22A4 3.82e-12 -0.0996 2.504e-08 -0.088 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Sensorineural hearing loss CLRN1 2.531e-08 13.073 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Dialysis SIPA1L3 3.29e-05 0.5405 2.591e-08 2.232 rs3745945 19 38182658 C G 0.991643 0.0727678 2062 367388 19:38673298 19:38182658:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Non-small cell lung cancer (other cancers excluded from controls) CHRNA5 2.92e-09 0.2868 2.593e-08 0.298 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Other retinal disorders CLRN1 2.746e-08 14.784 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Lactose intolerance MAP3K19 2.41e-07 0.5622 2.804e-08 1.19 rs16831235 2 134987559 G A 0.983584 0.154379 8864 367388 2:135745129 2:134987559:G:A missense_variant "" "" "" unknown Mucosal proctocolitis GPX1 1.77e-06 0.1824 2.836e-08 0.192 rs1050450 3 49357401 G A 0.999364 0.434756 69716 367388 3:49394834 3:49357401:G:A missense_variant (likely)Benign Benign no_Criteria recessive Other cataract CLRN1 2.844e-08 14.568 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas SLC3A1 1.87e-12 0.0864 2.902e-08 0.049 rs698761 2 44320435 G A 0.998557 0.603329 134298 367388 2:44547574 2:44320435:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter both Statin medication HNF1A 2.73e-10 0.0669 3.078e-08 0.066 rs2464196 12 120997624 G A 0.999145 0.300181 33042 367388 12:121435427 12:120997624:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Diabetes, insuline treatment (Kela reimbursement) WFS1 3.08e-09 0.0673 3.09e-08 0.051 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Ulcerative colitis MST1 1.08e-07 0.1391 3.142e-08 0.139 rs3197999 3 49684099 G A 0.999906 0.392288 56796 367388 3:49721532 3:49684099:G:A missense_variant "" "" "" unknown Non-small cell lung cancer CHRNA5 4.47e-09 0.2826 3.145e-08 0.296 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Redundant prepuce, phimosis and paraphimosis FUT11 3.215e-08 18.338 rs200368257 10 73773302 A G 0.980027 0.00571875 12 367388 10:75533060 10:73773302:A:G missense_variant "" "" "" unknown Type 1 diabetes, strict definition TH 3.97e-10 0.2274 3.239e-08 0.176 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive DVT of lower extremities FGA 3.64e-12 0.1843 3.268e-08 0.162 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Hypertensive diseases PLCE1 1.23e-12 -0.074 3.275e-08 -0.06 rs2274224 10 94279840 G C 0.999495 0.346144 44056 367388 10:96039597 10:94279840:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Asthma GSDMA 9.78e-08 0.0692 3.296e-08 0.064 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown ILD Co-morbidites, CVD and metabolic diseases TTF1 3.356e-08 0.175 rs8999 9 132401954 C A 0.998502 367388 9:135277341 9:132401954:C:A missense_variant "" "" "" unknown Hypertension PLCE1 9.31e-13 -0.0749 3.377e-08 -0.06 rs2274224 10 94279840 G C 0.999495 0.346144 44056 367388 10:96039597 10:94279840:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Asthma/COPD (KELA code 203) SLC22A4 3.77e-12 -0.0969 3.485e-08 -0.085 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Other noninflammatory disorders of uterus, except cervix APPL2 3.687e-08 5.539 rs138491961 12 105211248 G A 0.995936 367388 12:105605026 12:105211248:G:A pLoF "" "" "" unknown Venous thromboembolism KLKB1 5.95e-12 0.1255 3.74e-08 0.075 rs3733402 4 186236880 G A 0.999945 0.575816 122208 367388 4:187158034 4:186236880:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity no_Criteria recessive Type 1 diabetes with other specified/multiple/unspecified complications TH 1.73e-10 0.1914 3.757e-08 0.146 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Endometriosis of ovary USP5 3.806e-08 8.472 rs200723728 12 6856835 G A 0.987681 367388 12:6965999 12:6856835:G:A missense_variant "" "" "" unknown Disorders of the thyroid gland CTLA4 9.29e-14 0.082 3.82e-08 0.048 rs231775 2 203867991 A G 0.999974 0.518705 99544 367388 2:204732714 2:203867991:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Type 1 diabetes, wide definition TH 5.18e-11 0.1435 3.842e-08 0.106 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas UGT1A6 1.6e-07 0.0639 3.884e-08 0.062 rs2070959 2 233693545 A G 0.999944 0.414061 63450 367388 2:234602191 2:233693545:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Demyelenating diseases of the central nervous system C15orf40 3.938e-08 11.258 rs115868366 15 82988716 T C 0.998482 367388 15:83657468 15:82988716:T:C missense_variant "" "" "" unknown Demyelenating diseases of the central nervous system FAM103A1 3.938e-08 11.258 rs61738562 15 82989048 G T 0.998482 367388 15:83657800 15:82989048:G:T missense_variant "" "" "" unknown Viral infections characterized by skin and mucous membrane lesions NPHS1 4.21e-08 9.762 rs386833873 19 35851608 CAG C 0.966858 0.00903949 26 367388 19:36342510 19:35851608:CAG:C pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Asthma (only as main-diagnosis) (more controls excluded) SLC22A4 8.47e-12 -0.101 4.229e-08 -0.09 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Disorders of choroid and retina EYS 4.289e-08 6.057 rs528919874 6 63721375 TTCTGCATG T 0.98815 0.00692456 24 367388 6:64431271 6:63721375:TTCTGCATG:T pLoF (likely)Pathogenic Pathogenic/Likely pathogenic Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas FUT6 8.98e-08 0.0658 4.321e-08 0.066 rs778805 19 5832198 G A 0.999513 0.382909 54144 367388 19:5832209 19:5832198:G:A missense_variant "" "" "" unknown Hypertension, essential LSP1 2.79e-08 0.0609 4.337e-08 0.056 rs621679 11 1881538 G A 0.991394 0.413239 63334 367388 11:1902768 11:1881538:G:A missense_variant "" "" "" unknown Diabetes, varying definitions SLC30A8 7.59e-09 -0.0624 4.366e-08 -0.058 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Hypothyroidism,other/unspecified C1QTNF6 1.87e-12 0.0862 4.497e-08 0.064 rs229527 22 37185445 C A 0.998635 0.393875 56892 367388 22:37581485 22:37185445:C:A missense_variant "" "" "" unknown Fibrosis and chirrhosis of liver PNPLA3 2e-10 0.4707 4.58e-08 0.582 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Other disorders of glucose regulation and pancreatic internal secretion PCK1 4.645e-08 9.773 rs201186470 20 57563691 G A 0.99664 0.010836 50 367388 20:56138747 20:57563691:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity Path_Criteria_oneSubmitter_confl recessive Varicose veins HDAC7 6.5e-09 0.092 4.683e-08 0.098 rs7972177 12 47784730 A G 0.988182 0.300209 33362 367388 12:48178513 12:47784730:A:G missense_variant "" "" "" unknown Malignant neoplasm of liver and intrahepatic bile ducts (other cancers excluded from controls) PNPLA3 1.02e-07 0.6075 4.804e-08 0.927 rs738409 22 43928847 C G 0.999239 0.227724 19206 367388 22:44324727 22:43928847:C:G missense_variant drug response drug response Criteria_multSubmitter unknown Asthma (only as main-diagnosis) SLC22A4 7.59e-12 -0.1011 4.969e-08 -0.089 rs1050152 5 132340627 C T 0.99996 0.316502 36980 367388 5:131676320 5:132340627:C:T missense_variant (likely)Benign Benign no_Criteria unknown Autoimmune diseases related-to ILD SH2B3 1.59e-10 -0.0815 5.02e-08 -0.051 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Type 2 diabetes WFS1 2.4e-11 0.0752 5.427e-08 0.05 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Nonalcoholic fatty liver disease PARVB 6.51e-09 0.3259 5.522e-08 0.266 rs1007863 22 43999571 T C 0.997845 0.468464 80750 367388 22:44395451 22:43999571:T:C missense_variant "" "" "" unknown Myeloproliferative diseases EXPH5 5.926e-08 0.735 rs10749920 11 108512949 A G 0.997505 367388 11:108383676 11:108512949:A:G missense_variant "" "" "" recessive Polyarthropathies SH2B3 1.31e-09 -0.0912 5.998e-08 -0.06 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Asthma (mode) GSDMA 5.24e-08 0.0719 6.118e-08 0.063 rs56030650 17 39974934 C A 0.995064 0.443041 72004 367388 17:38131187 17:39974934:C:A missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism KLKB1 6.51e-11 0.137 6.163e-08 0.074 rs925453 4 186258056 T C 0.999836 0.698319 179464 367388 4:187179210 4:186258056:T:C missense_variant "" "" "" recessive Conductive and sensorineural hearing loss CLRN1 6.326e-08 11.462 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Chronic diseases of tonsils and adenoids IL17REL 5.91e-06 0.056 6.375e-08 0.066 rs9617090 22 50000765 C T 0.995347 0.372489 51050 367388 22:50439194 22:50000765:C:T missense_variant "" "" "" unknown Inflammatory bowel disease BSN 2.77e-08 0.1264 6.722e-08 0.114 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown Hypertension, essential FES 5.66e-10 -0.068 6.787e-08 -0.043 rs7177338 15 90885406 G A 0.996156 0.590852 128382 367388 15:91428636 15:90885406:G:A missense_variant "" "" "" unknown DVT of lower extremities and pulmonary embolism KLKB1 3.42e-13 0.1414 6.793e-08 0.078 rs3733402 4 186236880 G A 0.999945 0.575816 122208 367388 4:187158034 4:186236880:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity no_Criteria recessive Ulcerative colitis ( strict definition, require KELA) MST1 4.78e-08 0.1827 6.86e-08 0.174 rs3197999 3 49684099 G A 0.999906 0.392288 56796 367388 3:49721532 3:49684099:G:A missense_variant "" "" "" unknown Excessive, freguent and irrelgular menstruation ABCA13 6.951e-08 2.404 rs79809732 7 48281413 G A 0.934452 367388 7:48321010 7:48281413:G:A missense_variant "" "" "" unknown Type 1 diabetes, strict definition, subgroup 1 FUT2 1.91e-06 0.1871 6.972e-08 0.21 rs601338 19 48703417 G A 0.997446 0.374424 51810 367388 19:49206674 19:48703417:G:A pLoF association Benign, association no_Criteria recessive malignant neoplasm of male genital organs POU5F1B 4.6e-10 -0.1432 6.998e-08 -0.116 rs6998061 8 127416393 G A 0.997801 0.40844 61620 367388 8:128428638 8:127416393:G:A missense_variant "" "" "" unknown Chronic lower respiratory diseases IL1RL1 5.49e-13 -0.0767 7.088e-08 -0.053 rs10206753 2 102351902 T C 0.999919 0.408647 61384 367388 2:102968362 2:102351902:T:C missense_variant "" "" "" unknown Myeloproliferative diseases (CML excluded) EXPH5 7.324e-08 0.787 rs10749920 11 108512949 A G 0.997505 367388 11:108383676 11:108512949:A:G missense_variant "" "" "" recessive Hypertensive diseases (excluding secondary) LSP1 1.7e-07 0.0599 7.38e-08 0.057 rs621679 11 1881538 G A 0.991394 0.413239 63334 367388 11:1902768 11:1881538:G:A missense_variant "" "" "" unknown Chronic lower respiratory diseases IL1RL1 5.47e-13 -0.0767 7.54e-08 -0.053 rs10192036 2 102351751 C A 0.999915 0.40865 61390 367388 2:102968211 2:102351751:C:A missense_variant "" "" "" unknown Moderate visual impairment, binocular ARMS2 3.96e-07 0.479 7.591e-08 0.71 rs10490924 10 122454932 G T 0.999773 0.243448 21752 367388 10:124214448 10:122454932:G:T missense_variant (likely)Benign Likely benign Criteria_oneSubmitter unknown Type 2 diabetes, definitions combined WFS1 1.09e-10 0.0763 7.593e-08 0.052 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Atopic dermatitis, strict definition with reimbursement IL6R 5.26e-07 0.126 7.681e-08 0.155 rs2228145 1 154454494 A C 0.99727 0.297816 32800 367388 1:154426970 1:154454494:A:C missense_variant association association no_Criteria unknown Dementia in Alzheimer disease APOC4-APOC2 2.05e-08 0.2079 7.903e-08 0.152 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Complications following infusion, transfusion and therapeutic injection DNAH3 4.33e-05 0.5896 7.939e-08 1.144 rs72780891 16 21140592 G T 0.997721 0.255044 24028 367388 16:21151913 16:21140592:G:T missense_variant "" "" "" unknown Alzheimer's disease (Early onset) (more controls excluded) APOC4-APOC2 1.14e-08 0.3836 8.095e-08 0.354 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Chronic lower respiratory diseases IL1RL1 6.03e-13 -0.0766 8.098e-08 -0.053 rs4988956 2 102351547 G A 0.999972 0.408658 61388 367388 2:102968007 2:102351547:G:A missense_variant "" "" "" unknown Chronic lower respiratory diseases IL1RL1 6.44e-13 -0.0765 8.127e-08 -0.053 rs10192157 2 102351896 C T 0.999919 0.408663 61394 367388 2:102968356 2:102351896:C:T missense_variant "" "" "" unknown Chronic lower respiratory diseases IL1RL1 5.75e-13 -0.0766 8.132e-08 -0.053 rs10204137 2 102351752 A G 0.999916 0.408658 61394 367388 2:102968212 2:102351752:A:G missense_variant "" "" "" unknown Persons with potential health hazards related to family and personal history and certain conditions influencing health status CLRN1 8.16e-08 8.351 rs121908140 3 150928107 A C 0.995026 0.00444761 12 367388 3:150645894 3:150928107:A:C LC (likely)Pathogenic Pathogenic Criteria_multSubmitter recessive Type 1 diabetes with ophthalmic complications INS-IGF2 4.65e-09 0.1902 8.183e-08 0.129 rs10770125 11 2147784 A G 0.998678 0.570974 120056 367388 11:2169014 11:2147784:A:G missense_variant "" "" "" unknown Type 1 diabetes, wide definition, subgroup 1 INS-IGF2 4.1e-08 0.1406 8.229e-08 0.102 rs10770125 11 2147784 A G 0.998678 0.570974 120056 367388 11:2169014 11:2147784:A:G missense_variant "" "" "" unknown Type 2 diabetes, strict (exclude DM1) WFS1 9.33e-11 0.0763 8.355e-08 0.052 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Other malignant neoplasms of skin (=non-melanoma skin cancer) TRAK2 9.21e-08 0.0959 8.499e-08 0.102 rs2244438 2 201387816 G A 0.999529 0.337014 41776 367388 2:202252539 2:201387816:G:A missense_variant "" "" "" unknown Fitting and adjustment of other devices GJB2 8.511e-08 5.34 rs398123814 13 20189546 AC A 0.990104 0.01156 52 367388 13:20763685 13:20189546:AC:A pLoF (likely)Pathogenic Pathogenic Criteria_multSubmitter both Asthma, hospital admissions , main diagnosis only IL13 4.41e-09 -0.081 8.725e-08 -0.052 rs20541 5 132660272 A G 0.997119 0.631752 146944 367388 5:131995964 5:132660272:A:G missense_variant risk factor risk factor no_Criteria dominant Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 4.59e-12 -0.3667 8.778e-08 -0.238 rs60787297 11 1244556 C T 0.97166 0.490296 88638 367388 11:1265786 11:1244556:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other diabetes, wide definition GPSM1 2.68e-10 -0.0781 8.787e-08 -0.075 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin TRAK2 9.6e-08 0.0957 8.92e-08 0.101 rs2244438 2 201387816 G A 0.999529 0.337014 41776 367388 2:202252539 2:201387816:G:A missense_variant "" "" "" unknown malignant neoplasm of male genital organs (other cancers excluded from controls) POU5F1B 4.46e-10 -0.1469 8.943e-08 -0.118 rs6998061 8 127416393 G A 0.997801 0.40844 61620 367388 8:128428638 8:127416393:G:A missense_variant "" "" "" unknown Hypertension, essential FES 7.34e-10 -0.0676 8.969e-08 -0.043 rs7183988 15 90885359 T G 0.995674 0.591285 128564 367388 15:91428589 15:90885359:T:G missense_variant "" "" "" unknown Ulcerative colitis ( strict definition, require KELA) BSN 2.4e-07 0.1716 9.237e-08 0.166 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown Malignant neoplasm of prostate POU5F1B 2.78e-10 -0.1486 9.263e-08 -0.117 rs6998061 8 127416393 G A 0.997801 0.40844 61620 367388 8:128428638 8:127416393:G:A missense_variant "" "" "" unknown Atopic dermatitis, strict definition IL6R 8.48e-07 0.1262 9.389e-08 0.158 rs2228145 1 154454494 A C 0.99727 0.297816 32800 367388 1:154426970 1:154454494:A:C missense_variant association association no_Criteria unknown Ulcerative colitis BSN 3.4e-07 0.1325 9.411e-08 0.129 rs34762726 3 49651777 G A 0.999839 0.412248 62790 367388 3:49689210 3:49651777:G:A missense_variant "" "" "" unknown Diabetes mellitus SLC30A8 4.86e-09 -0.0636 9.572e-08 -0.057 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Follow-up examination after treatment for conditions other than malignant neoplasms TTN 9.672e-08 5.38 rs72647870 2 178781235 C G 0.995345 0.00443673 12 367388 2:179645962 2:178781235:C:G missense_variant VUS Conflicting interpretations of pathogenicity Criteria_multSubmitter both Atopic dermatitis IL6R 2.82e-07 0.116 9.943e-08 0.138 rs2228145 1 154454494 A C 0.99727 0.297816 32800 367388 1:154426970 1:154454494:A:C missense_variant association association no_Criteria unknown Type 2 diabetes with other specified/multiple/unspecified complications GPSM1 1.08e-10 -0.0902 9.953e-08 -0.085 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) TRAK2 8.14e-08 0.098 1.014e-07 0.103 rs2244438 2 201387816 G A 0.999529 0.337014 41776 367388 2:202252539 2:201387816:G:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) GSDMB 6.88e-16 -0.1113 1.031e-07 -0.056 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Statin medication POC5 3.13e-10 0.0617 1.038e-07 0.047 rs2307111 5 75707853 T C 0.998356 0.425988 66846 367388 5:75003678 5:75707853:T:C missense_variant "" "" "" unknown Coxarthrosis [arthrosis of hip](FG) GNL3 9.63e-08 0.0953 1.043e-07 0.087 rs2289247 3 52693241 G A 0.999984 0.41917 64604 367388 3:52727257 3:52693241:G:A missense_variant "" "" "" unknown Primary coxarthrosis, bilateral GNL3 9.6e-08 0.143 1.067e-07 0.131 rs2289247 3 52693241 G A 0.999984 0.41917 64604 367388 3:52727257 3:52693241:G:A missense_variant "" "" "" unknown Hypertension LSP1 3.4e-11 0.0666 1.072e-07 0.04 rs7938342 11 1866576 T A 0.995387 0.575596 122088 367388 11:1887806 11:1866576:T:A missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) TRAK2 8.61e-08 0.0976 1.08e-07 0.102 rs2244438 2 201387816 G A 0.999529 0.337014 41776 367388 2:202252539 2:201387816:G:A missense_variant "" "" "" unknown Type 1 diabetes, wide definition SH2B3 6.68e-12 -0.1492 1.095e-07 -0.085 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Hypertensive diseases LSP1 3.04e-11 0.0664 1.119e-07 0.039 rs7938342 11 1866576 T A 0.995387 0.575596 122088 367388 11:1887806 11:1866576:T:A missense_variant "" "" "" unknown Coxarthrosis [arthrosis of hip](FG) SPCS1 9.48e-08 0.0953 1.125e-07 0.087 rs6617 3 52706166 C G 0.999685 0.419121 64610 367388 3:52740182 3:52706166:C:G missense_variant "" "" "" unknown Asthma (only as main-diagnosis) IL13 8.46e-09 -0.0817 1.129e-07 -0.053 rs20541 5 132660272 A G 0.997119 0.631752 146944 367388 5:131995964 5:132660272:A:G missense_variant risk factor risk factor no_Criteria dominant Asthma/COPD (KELA code 203) IL1RL1 6.07e-13 -0.0948 1.152e-07 -0.065 rs10206753 2 102351902 T C 0.999919 0.408647 61384 367388 2:102968362 2:102351902:T:C missense_variant "" "" "" unknown Malignant neoplasm of prostate (other cancers excluded from controls) POU5F1B 3.43e-10 -0.1521 1.186e-07 -0.12 rs6998061 8 127416393 G A 0.997801 0.40844 61620 367388 8:128428638 8:127416393:G:A missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) IL1RL1 6.29e-13 -0.0948 1.208e-07 -0.065 rs4988956 2 102351547 G A 0.999972 0.408658 61388 367388 2:102968007 2:102351547:G:A missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) IL1RL1 6e-13 -0.0949 1.243e-07 -0.065 rs10204137 2 102351752 A G 0.999916 0.408658 61394 367388 2:102968212 2:102351752:A:G missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) IL1RL1 6.96e-13 -0.0946 1.243e-07 -0.065 rs10192157 2 102351896 C T 0.999919 0.408663 61394 367388 2:102968356 2:102351896:C:T missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) IL1RL1 6.57e-13 -0.0947 1.267e-07 -0.065 rs10192036 2 102351751 C A 0.999915 0.40865 61390 367388 2:102968211 2:102351751:C:A missense_variant "" "" "" unknown Noninfective enteritis and colitis FCGR2A 9.92e-08 -0.098 1.322e-07 -0.079 rs1801274 1 161509955 A G 0.999052 0.502265 92940 367388 1:161479745 1:161509955:A:G missense_variant drug response drug response Criteria_multSubmitter both Diabetes mellitus in pregnancy MTNR1B 3e-14 0.1774 1.336e-07 0.091 rs1447350 11 92984961 G C 0.996537 0.577801 122848 367388 11:92718127 11:92984961:G:C missense_variant "" "" "" dominant Disorders of the thyroid gland C1QTNF6 2.87e-11 0.0748 1.341e-07 0.057 rs229527 22 37185445 C A 0.998635 0.393875 56892 367388 22:37581485 22:37185445:C:A missense_variant "" "" "" unknown Coxarthrosis, GNL3 7.56e-08 0.0976 1.354e-07 0.087 rs2289247 3 52693241 G A 0.999984 0.41917 64604 367388 3:52727257 3:52693241:G:A missense_variant "" "" "" unknown Asthma (more controls excluded) ZPBP2 1.8e-14 -0.0997 1.459e-07 -0.052 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Type 2 diabetes, wide definition GPSM1 1.53e-09 -0.0971 1.465e-07 -0.096 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Type 1 diabetes, strict (exclude DM2) INS-IGF2 1.37e-08 0.189 1.505e-07 0.129 rs10770125 11 2147784 A G 0.998678 0.570974 120056 367388 11:2169014 11:2147784:A:G missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) PRDM7 3.25e-08 -0.0947 1.526e-07 -0.07 rs12925933 16 90074947 A C 0.995417 0.542514 108530 367388 16:90141355 16:90074947:A:C missense_variant "" "" "" unknown Coxarthrosis, SPCS1 7.72e-08 0.0975 1.574e-07 0.087 rs6617 3 52706166 C G 0.999685 0.419121 64610 367388 3:52740182 3:52706166:C:G missense_variant "" "" "" unknown Malignant neoplasm of skin PRDM7 3.22e-08 -0.0947 1.626e-07 -0.069 rs12925933 16 90074947 A C 0.995417 0.542514 108530 367388 16:90141355 16:90074947:A:C missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) ZPBP2 1.28e-14 -0.1065 1.662e-07 -0.055 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Coronary atherosclerosis RP11-145E5.5 1.1e-11 0.0944 1.72e-07 0.059 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Asthma (more controls excluded) GSDMB 9.93e-16 -0.1042 1.778e-07 -0.052 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Asthma (only as main-diagnosis) GSDMB 2.25e-15 -0.1091 1.789e-07 -0.055 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Cardiovascular diseases SH2B3 3.71e-10 -0.054 1.847e-07 -0.033 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Other embolism and thrombosis FGA 3.27e-09 0.2421 1.942e-07 0.24 rs6050 4 154586438 T C 0.998828 0.315032 36746 367388 4:155507590 4:154586438:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Coronary artery bypass grafting RP11-145E5.5 5.39e-11 0.1627 1.999e-07 0.105 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) IL13 1.55e-08 -0.0804 2.015e-07 -0.052 rs20541 5 132660272 A G 0.997119 0.631752 146944 367388 5:131995964 5:132660272:A:G missense_variant risk factor risk factor no_Criteria dominant Glaucoma RP11-145E5.5 4.63e-09 0.111 2.169e-07 0.08 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) APOC4-APOC2 3.5e-08 0.2031 2.284e-07 0.145 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown UC patients in KELA-register ( KELA 208 prior to 1994, or ICD K51) GPX1 2.91e-08 0.1722 2.307e-07 0.144 rs1050450 3 49357401 G A 0.999364 0.434756 69716 367388 3:49394834 3:49357401:G:A missense_variant (likely)Benign Benign no_Criteria recessive Radiation-related disorders of the skin and subcutaneous tissue FANCA 2.43e-11 0.1596 2.309e-07 0.108 rs7190823 16 89799635 T C 0.988053 0.459773 77656 367388 16:89866043 16:89799635:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Asthma, hospital admissions , main diagnosis only GSDMB 7.96e-15 -0.1039 2.415e-07 -0.053 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) GSDMA 1.32e-08 0.0753 2.621e-07 0.064 rs3894194 17 39965740 G A 0.992691 0.405773 60490 367388 17:38121993 17:39965740:G:A missense_variant "" "" "" unknown Disorders of choroid and retina CFH 5.18e-16 -0.1116 2.623e-07 -0.053 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Asthma IL13 1.59e-08 -0.0754 2.727e-07 -0.048 rs20541 5 132660272 A G 0.997119 0.631752 146944 367388 5:131995964 5:132660272:A:G missense_variant risk factor risk factor no_Criteria dominant Major coronary heart disease event RP11-145E5.5 1.13e-09 0.0878 2.877e-07 0.06 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Endocrine, nutritional and metabolic diseases SH2B3 1.68e-10 -0.0528 2.967e-07 -0.031 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Asthma ZPBP2 6.33e-14 -0.0972 3.088e-07 -0.05 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Statin medication HNF1A 7.6e-09 0.0587 3.146e-07 0.053 rs2464195 12 120997672 G A 0.998984 0.354742 46296 367388 12:121435475 12:120997672:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Asthma (only as main-diagnosis) ZPBP2 3.93e-14 -0.1043 3.247e-07 -0.053 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Asthma GSDMB 3.8e-15 -0.1016 3.288e-07 -0.051 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Type 2 diabetes, wide definition WFS1 9.01e-09 0.0894 3.403e-07 0.053 rs1801212 4 6300792 G A 0.99874 0.670354 165366 367388 4:6302519 4:6300792:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Type1 diabetes, definitions combined INS-IGF2 5.22e-08 0.1797 3.454e-07 0.124 rs10770125 11 2147784 A G 0.998678 0.570974 120056 367388 11:2169014 11:2147784:A:G missense_variant "" "" "" unknown Atrial fibrillation and flutter ENPEP 4.51e-09 -0.0965 3.483e-07 -0.061 rs1126483 4 110488549 T C 0.997774 0.602532 133770 367388 4:111409705 4:110488549:T:C missense_variant "" "" "" unknown Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) SLC30A8 1.31e-08 -0.0677 3.702e-07 -0.06 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Statin medication HAVCR1 6.17e-09 0.0597 3.773e-07 0.035 rs373345404 5 157052546 GTTGGAACAGTCGTCA G 0.989555 0.655898 158076 367388 5:156479557 5:157052546:GTTGGAACAGTCGTCA:G inframe_indel (likely)Benign Benign Criteria_oneSubmitter unknown Hypertension FES 3.56e-10 -0.0634 4.061e-07 -0.037 rs7177338 15 90885406 G A 0.996156 0.590852 128382 367388 15:91428636 15:90885406:G:A missense_variant "" "" "" unknown Ischaemic heart disease, wide definition RP11-145E5.5 6.24e-10 0.0743 4.14e-07 0.05 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Statin medication FUT2 5.85e-08 0.0544 4.608e-07 0.05 rs601338 19 48703417 G A 0.997446 0.374424 51810 367388 19:49206674 19:48703417:G:A pLoF association Benign, association no_Criteria recessive Asthma (more controls excluded) IL13 2.91e-08 -0.0743 4.921e-07 -0.047 rs20541 5 132660272 A G 0.997119 0.631752 146944 367388 5:131995964 5:132660272:A:G missense_variant risk factor risk factor no_Criteria dominant Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 8.36e-11 -0.3401 4.983e-07 -0.224 rs2943521 11 1248605 G A 0.994036 0.482027 85684 367388 11:1269835 11:1248605:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Type 2 diabetes with other specified/multiple/unspecified complications SLC30A8 2.59e-09 -0.0779 4.99e-07 -0.065 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Hypertension FES 4.38e-10 -0.0631 5.02e-07 -0.037 rs7183988 15 90885359 T G 0.995674 0.591285 128564 367388 15:91428589 15:90885359:T:G missense_variant "" "" "" unknown IBD patients in KELA-register FCGR2A 2.68e-08 -0.1497 5.064e-07 -0.111 rs1801274 1 161509955 A G 0.999052 0.502265 92940 367388 1:161479745 1:161509955:A:G missense_variant drug response drug response Criteria_multSubmitter both Type 2 diabetes HNF1A 1.92e-09 0.0701 5.071e-07 0.058 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Asthma, hospital admissions , main diagnosis only ZPBP2 1.45e-13 -0.0991 5.173e-07 -0.051 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Diabetes, insuline treatment (Kela reimbursement) SLC30A8 2.27e-08 -0.0653 5.393e-07 -0.058 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Other malignant neoplasms of skin (=non-melanoma skin cancer) FANCA 4.34e-13 0.1247 5.459e-07 0.075 rs7190823 16 89799635 T C 0.988053 0.459773 77656 367388 16:89866043 16:89799635:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Malignant neoplasm of bronchus and lung (other cancers excluded from controls) CHRNA5 5.67e-11 0.273 5.719e-07 0.226 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Hypertensive diseases FES 5.74e-10 -0.0623 5.815e-07 -0.037 rs7177338 15 90885406 G A 0.996156 0.590852 128382 367388 15:91428636 15:90885406:G:A missense_variant "" "" "" unknown Malignant neoplasm of skin FANCA 4.28e-13 0.1247 5.846e-07 0.075 rs7190823 16 89799635 T C 0.988053 0.459773 77656 367388 16:89866043 16:89799635:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Any dementia ERCC2 8.75e-11 -0.1513 6.268e-07 -0.106 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive ILD, hospital admissions 1, main diag only MUC5B 7.54e-13 -0.2964 6.574e-07 -0.171 rs60787297 11 1244556 C T 0.97166 0.490296 88638 367388 11:1265786 11:1244556:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Malignant neoplasm of bronchus and lung CHRNA5 8.53e-11 0.2688 6.714e-07 0.223 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Pulmonary heart disease, diseases of pulmonary circulation KLKB1 3.65e-09 0.1638 6.769e-07 0.089 rs925453 4 186258056 T C 0.999836 0.698319 179464 367388 4:187179210 4:186258056:T:C missense_variant "" "" "" recessive Arthrosis UQCC1 5.34e-09 0.0633 6.978e-07 0.04 rs4911494 20 35384111 C T 0.999857 0.573821 120892 367388 20:33971914 20:35384111:C:T missense_variant "" "" "" unknown Pulmonary heart disease KLKB1 2.01e-11 0.1807 6.982e-07 0.099 rs3733402 4 186236880 G A 0.999945 0.575816 122208 367388 4:187158034 4:186236880:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity no_Criteria recessive Hypertensive diseases FES 7.02e-10 -0.062 7.145e-07 -0.036 rs7183988 15 90885359 T G 0.995674 0.591285 128564 367388 15:91428589 15:90885359:T:G missense_variant "" "" "" unknown Pulmonary embolism KLKB1 2.05e-11 0.1809 7.17e-07 0.099 rs3733402 4 186236880 G A 0.999945 0.575816 122208 367388 4:187158034 4:186236880:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity no_Criteria recessive Atrial fibrillation and flutter with reimbursement SYNE2 1.4e-09 -0.1276 7.564e-07 -0.095 rs10151658 14 64146140 C A 0.995054 0.426119 67426 367388 14:64612858 14:64146140:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter dominant Asthma (mode) GSDMB 6.89e-15 -0.1025 7.855e-07 -0.05 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Hypertension, essential LSP1 2.15e-08 0.0617 7.889e-07 0.052 rs686722 11 1870492 C T 0.996813 0.395478 57866 367388 11:1891722 11:1870492:C:T missense_variant "" "" "" unknown Type 1 diabetes INS-IGF2 9.39e-08 0.1232 7.927e-07 0.085 rs10770125 11 2147784 A G 0.998678 0.570974 120056 367388 11:2169014 11:2147784:A:G missense_variant "" "" "" unknown Other diabetes, wide definition SLC30A8 2.21e-08 -0.0648 7.931e-07 -0.056 rs13266634 8 117172544 C T 0.998683 0.376041 52102 367388 8:118184783 8:117172544:C:T missense_variant risk factor risk factor no_Criteria dominant Asthma (mode) ZPBP2 1.06e-13 -0.0981 8.232e-07 -0.049 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 2.97e-09 -0.3295 8.291e-07 -0.29 rs2672785 11 1225711 A G 0.992321 0.347739 44340 367388 11:1246941 11:1225711:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Atrial fibrillation and flutter with reimbursement ENPEP 3.09e-08 -0.1175 8.299e-07 -0.075 rs1126483 4 110488549 T C 0.997774 0.602532 133770 367388 4:111409705 4:110488549:T:C missense_variant "" "" "" unknown Type 1 diabetes without complications INS-IGF2 9.49e-08 0.1349 8.362e-07 0.092 rs10770125 11 2147784 A G 0.998678 0.570974 120056 367388 11:2169014 11:2147784:A:G missense_variant "" "" "" unknown Interstitial lung disease MUC5B 1.75e-13 -0.2858 8.564e-07 -0.159 rs60787297 11 1244556 C T 0.97166 0.490296 88638 367388 11:1265786 11:1244556:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Idiopathic pulmonary fibrosis (attempt to specificity) MUC5B 7.67e-11 -0.342 8.586e-07 -0.218 rs2943517 11 1250091 C G 0.987023 0.485051 86748 367388 11:1271321 11:1250091:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Autoimmune diseases related-to ILD GPR35 8.08e-08 0.0782 9.073e-07 0.092 rs3749171 2 240630275 C T 0.995293 0.2447 22028 367388 2:241569692 2:240630275:C:T missense_variant "" "" "" unknown Other insterstitial pulmonary diseases MUC5B 1.78e-13 -0.2854 9.254e-07 -0.158 rs60787297 11 1244556 C T 0.97166 0.490296 88638 367388 11:1265786 11:1244556:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Chronic lower respiratory diseases ZPBP2 5.35e-14 -0.0793 9.325e-07 -0.039 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) KRT75 1.59e-08 -0.1018 9.838e-07 -0.061 rs298104 12 52424720 T G 0.992853 0.637541 149178 367388 12:52818504 12:52424720:T:G missense_variant "" "" "" unknown Thyrotoxicosis with diffuse goitr CTLA4 4.14e-09 0.2065 1.003e-06 0.137 rs231775 2 203867991 A G 0.999974 0.518705 99544 367388 2:204732714 2:203867991:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Malignant neoplasm of skin (other cancers excluded from controls) KRT75 1.51e-08 -0.1018 1.011e-06 -0.061 rs298104 12 52424720 T G 0.992853 0.637541 149178 367388 12:52818504 12:52424720:T:G missense_variant "" "" "" unknown Type 1 diabetes with other specified/multiple/unspecified complications INS-IGF2 7.64e-08 0.1595 1.042e-06 0.107 rs10770125 11 2147784 A G 0.998678 0.570974 120056 367388 11:2169014 11:2147784:A:G missense_variant "" "" "" unknown Inflammatory bowel disease FCGR2A 4.2e-08 -0.1222 1.057e-06 -0.089 rs1801274 1 161509955 A G 0.999052 0.502265 92940 367388 1:161479745 1:161509955:A:G missense_variant drug response drug response Criteria_multSubmitter both Alzheimer disease ERCC2 1.75e-10 -0.1832 1.072e-06 -0.128 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Hypertensive diseases (excluding secondary) SUN1 5.77e-08 0.0612 1.19e-06 0.045 rs6461378 7 842031 C T 0.999957 0.487675 87638 367388 7:881668 7:842031:C:T missense_variant "" "" "" unknown ILD Co-morbidites, CVD and metabolic diseases SH2B3 7.28e-08 -0.0499 1.204e-06 -0.033 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Nontoxic multinodular goitre TRMO 1.69e-09 0.1848 1.209e-06 0.162 rs2282192 9 97910056 C T 0.993649 0.321551 38204 367388 9:100672338 9:97910056:C:T missense_variant "" "" "" unknown Gonarthrosis UQCC1 1.99e-08 0.0733 1.345e-06 0.047 rs4911494 20 35384111 C T 0.999857 0.573821 120892 367388 20:33971914 20:35384111:C:T missense_variant "" "" "" unknown Any dementia APOC4-APOC2 9.5e-08 0.1242 1.355e-06 0.086 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Myocardial infarction, strict RP11-145E5.5 2.37e-08 0.1022 1.368e-06 0.072 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown ILD, hospital admissions MUC5B 2.17e-13 -0.2869 1.413e-06 -0.157 rs60787297 11 1244556 C T 0.97166 0.490296 88638 367388 11:1265786 11:1244556:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other malignant neoplasms of skin (=non-melanoma skin cancer) KRT75 6.61e-09 -0.1029 1.432e-06 -0.059 rs298104 12 52424720 T G 0.992853 0.637541 149178 367388 12:52818504 12:52424720:T:G missense_variant "" "" "" unknown Malignant neoplasm of skin KRT75 6.31e-09 -0.103 1.479e-06 -0.059 rs298104 12 52424720 T G 0.992853 0.637541 149178 367388 12:52818504 12:52424720:T:G missense_variant "" "" "" unknown ILD, hospital admissions 1, main diag only MUC5B 2.33e-12 -0.2877 1.497e-06 -0.165 rs2943517 11 1250091 C G 0.987023 0.485051 86748 367388 11:1271321 11:1250091:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Pulmonary embolism KLKB1 3.27e-09 0.1725 1.522e-06 0.091 rs925453 4 186258056 T C 0.999836 0.698319 179464 367388 4:187179210 4:186258056:T:C missense_variant "" "" "" recessive Diabetes, insuline treatment (Kela reimbursement) (more controls excluded) GPSM1 9.26e-09 -0.073 1.523e-06 -0.069 rs60980157 9 136340958 C T 0.983273 0.297832 32882 367388 9:139235415 9:136340958:C:T missense_variant "" "" "" unknown Pulmonary heart disease KLKB1 3.26e-09 0.1722 1.535e-06 0.091 rs925453 4 186258056 T C 0.999836 0.698319 179464 367388 4:187179210 4:186258056:T:C missense_variant "" "" "" recessive Statin medication TDRD15 1.51e-09 -0.0593 1.574e-06 -0.043 rs312966 2 21137711 A G 0.996763 0.427502 67590 367388 2:21360583 2:21137711:A:G missense_variant "" "" "" unknown UC patients in KELA-register ( KELA 208 prior to 1994, or ICD K51) FCGR2A 6.76e-08 -0.1652 1.685e-06 -0.12 rs1801274 1 161509955 A G 0.999052 0.502265 92940 367388 1:161479745 1:161509955:A:G missense_variant drug response drug response Criteria_multSubmitter both Chronic lower respiratory diseases GSDMB 1.31e-14 -0.0809 1.776e-06 -0.038 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Actinic keratosis ZNF276 7.67e-08 0.1421 1.833e-06 0.123 rs6500437 16 89723490 T C 0.994567 0.384852 54434 367388 16:89789898 16:89723490:T:C missense_variant "" "" "" unknown Alzheimer's disease, wide definition ERCC2 4.86e-11 -0.1609 1.865e-06 -0.106 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Type 1 diabetes, strict definition, subgroup 1 TH 1.73e-08 0.2178 1.982e-06 0.161 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Interstitial lung disease MUC5B 7.98e-13 -0.2756 2.006e-06 -0.153 rs2943517 11 1250091 C G 0.987023 0.485051 86748 367388 11:1271321 11:1250091:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Pulmonary heart disease, diseases of pulmonary circulation KLKB1 5.81e-11 0.1684 2.061e-06 0.091 rs3733402 4 186236880 G A 0.999945 0.575816 122208 367388 4:187158034 4:186236880:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity no_Criteria recessive Other insterstitial pulmonary diseases MUC5B 7.54e-13 -0.2756 2.064e-06 -0.153 rs2943517 11 1250091 C G 0.987023 0.485051 86748 367388 11:1271321 11:1250091:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Diabetes, varying definitions HNF1A 4.04e-08 0.0597 2.081e-06 0.051 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Statin medication GPN1 2.68e-08 0.0629 2.113e-06 0.069 rs3749147 2 27629051 G A 0.999795 0.242664 21864 367388 2:27851918 2:27629051:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) FANCA 3.4e-12 0.1219 2.14e-06 0.072 rs7190823 16 89799635 T C 0.988053 0.459773 77656 367388 16:89866043 16:89799635:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Type 2 diabetes with other specified/multiple/unspecified complications WFS1 5.26e-09 0.0742 2.253e-06 0.049 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Alzheimer disease (more controls excluded) ERCC2 5.65e-11 -0.2041 2.311e-06 -0.134 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Malignant neoplasm of skin (other cancers excluded from controls) FANCA 3.48e-12 0.1216 2.325e-06 0.072 rs7190823 16 89799635 T C 0.988053 0.459773 77656 367388 16:89866043 16:89799635:T:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Coronary atherosclerosis SH2B3 4.83e-08 -0.0771 2.374e-06 -0.049 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Other maternal disorders predominantly related to pregnancy MTNR1B 8.01e-10 0.1017 2.426e-06 0.058 rs1447350 11 92984961 G C 0.996537 0.577801 122848 367388 11:92718127 11:92984961:G:C missense_variant "" "" "" dominant Interstitial lung disease MUC5B 1.36e-12 -0.272 2.528e-06 -0.152 rs2943521 11 1248605 G A 0.994036 0.482027 85684 367388 11:1269835 11:1248605:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other insterstitial pulmonary diseases MUC5B 1.27e-12 -0.272 2.554e-06 -0.152 rs2943521 11 1248605 G A 0.994036 0.482027 85684 367388 11:1269835 11:1248605:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other ILD-related CVD-co-morbidities KLKB1 9.24e-09 0.1652 2.611e-06 0.088 rs925453 4 186258056 T C 0.999836 0.698319 179464 367388 4:187179210 4:186258056:T:C missense_variant "" "" "" recessive Allergic asthma (mode) (more controls excluded) GSDMB 1.85e-09 -0.1462 2.624e-06 -0.087 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis HNF1A 9.34e-09 -0.0786 2.712e-06 -0.066 rs2464195 12 120997672 G A 0.998984 0.354742 46296 367388 12:121435475 12:120997672:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both ILD, hospital admissions 1, main diag only MUC5B 4.41e-12 -0.2831 2.776e-06 -0.161 rs2943521 11 1248605 G A 0.994036 0.482027 85684 367388 11:1269835 11:1248605:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Unspecified diabetes PTPN22 1.92e-10 -0.2526 2.903e-06 -0.104 rs2476601 1 113834946 A G 0.999503 0.851827 266866 367388 1:114377568 1:113834946:A:G missense_variant "" "" "" both Any dementia (more controls excluded) ERCC2 1.03e-09 -0.1452 2.914e-06 -0.102 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive ILD, hospital admissions MUC5B 8.25e-13 -0.2776 2.932e-06 -0.152 rs2943517 11 1250091 C G 0.987023 0.485051 86748 367388 11:1271321 11:1250091:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Disorders of gallbladder, biliary tract and pancreas MARCH8 3.33e-08 0.0689 3.026e-06 0.058 rs7908745 10 45458319 A G 0.995333 0.361781 48280 367388 10:45953767 10:45458319:A:G missense_variant "" "" "" unknown Allergic asthma (mode) GSDMB 2.52e-09 -0.1446 3.064e-06 -0.086 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Medication related adverse effects (Asthma/COPD) UBE3B 1.93e-08 0.0598 3.248e-06 0.042 rs7298565 12 109499729 G A 0.99976 0.474474 82682 367388 12:109937534 12:109499729:G:A missense_variant "" "" "" recessive Medication related adverse effects (Asthma/COPD) KCTD10 1.95e-08 0.0598 3.411e-06 0.042 rs2058804 12 109471206 A G 0.998706 0.47476 82774 367388 12:109909011 12:109471206:A:G missense_variant "" "" "" unknown Sensorineural hearing loss TRIOBP 4.09e-08 0.0775 3.421e-06 0.065 rs9610841 22 37725145 C A 0.999621 0.375263 52188 367388 22:38121152 22:37725145:C:A missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Psychiatric diseases APOC4-APOC2 1.16e-08 0.0525 3.448e-06 0.039 rs5167 19 44945208 T G 0.988256 0.41371 62808 367388 19:45448465 19:44945208:T:G missense_variant "" "" "" unknown Disorders of lens UBE3B 1.66e-09 0.074 3.626e-06 0.048 rs7298565 12 109499729 G A 0.99976 0.474474 82682 367388 12:109937534 12:109499729:G:A missense_variant "" "" "" recessive Sensorineural hearing loss TRIOBP 6.57e-08 0.0763 3.865e-06 0.064 rs756464380 22 37723747 TCAA T 0.998035 0.37544 52336 367388 22:38119754 22:37723747:TCAA:T inframe_indel (likely)Benign Benign Criteria_multSubmitter recessive Sensorineural hearing loss TRIOBP 7.43e-08 0.0761 3.972e-06 0.064 rs5756795 22 37726115 T C 0.996661 0.375377 52322 367388 22:38122122 22:37726115:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter recessive Disorders of lens KCTD10 1.48e-09 0.0743 4.063e-06 0.048 rs2058804 12 109471206 A G 0.998706 0.47476 82774 367388 12:109909011 12:109471206:A:G missense_variant "" "" "" unknown Dementia ERCC2 1.27e-10 -0.1398 4.2e-06 -0.091 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Hypertensive diseases (excluding secondary) PLCE1 1.29e-09 -0.0724 4.209e-06 -0.057 rs2274224 10 94279840 G C 0.999495 0.346144 44056 367388 10:96039597 10:94279840:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Other ILD-related CVD-co-morbidities KLKB1 1.06e-10 0.1719 4.238e-06 0.091 rs3733402 4 186236880 G A 0.999945 0.575816 122208 367388 4:187158034 4:186236880:G:A missense_variant Conflicting Conflicting interpretations of pathogenicity no_Criteria recessive Alzheimer disease APOC4-APOC2 2.33e-08 0.1599 4.329e-06 0.1 rs1132899 19 44944779 T C 0.985261 0.555465 113586 367388 19:45448036 19:44944779:T:C missense_variant "" "" "" unknown Fracture of forearm WNT16 3.63e-08 -0.0956 4.438e-06 -0.073 rs2707466 7 121339035 C T 0.991795 0.421154 65288 367388 7:120979089 7:121339035:C:T missense_variant "" "" "" unknown Adult-onset Still disease SH2B3 2.16e-08 -0.164 4.489e-06 -0.098 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Diabetes mellitus HNF1A 4.53e-08 0.0598 4.624e-06 0.049 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both ILD, hospital admissions MUC5B 1.67e-12 -0.2729 4.692e-06 -0.149 rs2943521 11 1248605 G A 0.994036 0.482027 85684 367388 11:1269835 11:1248605:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Hypothyroidism and >3 levothyroxin purchases C1QTNF6 3.81e-10 0.0963 4.794e-06 0.067 rs229527 22 37185445 C A 0.998635 0.393875 56892 367388 22:37581485 22:37185445:C:A missense_variant "" "" "" unknown Type 2 diabetes, definitions combined HNF1A 2.85e-09 0.0728 4.933e-06 0.055 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Hypothyroidism, levothyroxin purchases C1QTNF6 4.44e-10 0.0958 4.98e-06 0.067 rs229527 22 37185445 C A 0.998635 0.393875 56892 367388 22:37581485 22:37185445:C:A missense_variant "" "" "" unknown Medication related adverse effects (Asthma/COPD) MMAB 2.48e-08 0.0593 5.078e-06 0.041 rs9593 12 109557065 A T 0.999279 0.475301 83002 367388 12:109994870 12:109557065:A:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Disorders of lens MMAB 2.18e-09 0.0735 6.095e-06 0.047 rs9593 12 109557065 A T 0.999279 0.475301 83002 367388 12:109994870 12:109557065:A:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Cholelithiasis, broad definition with cholecystitis MARCH8 1.34e-08 0.0771 6.144e-06 0.061 rs7908745 10 45458319 A G 0.995333 0.361781 48280 367388 10:45953767 10:45458319:A:G missense_variant "" "" "" unknown Allergic asthma (mode) (more controls excluded) ZPBP2 2.56e-08 -0.1357 6.293e-06 -0.083 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Disorders of the thyroid gland PSMB7 7.51e-11 0.0726 6.344e-06 0.047 rs4574 9 124414882 A G 0.999715 0.407104 61368 367388 9:127177161 9:124414882:A:G missense_variant "" "" "" unknown Other respiratory diseases principally affecting the interstitium MUC5B 6.71e-12 -0.2384 6.813e-06 -0.129 rs60787297 11 1244556 C T 0.97166 0.490296 88638 367388 11:1265786 11:1244556:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Senile cataract UBE3B 7.84e-09 0.0757 6.877e-06 0.05 rs7298565 12 109499729 G A 0.99976 0.474474 82682 367388 12:109937534 12:109499729:G:A missense_variant "" "" "" recessive Cholelithiasis MARCH8 2.33e-08 0.0773 7.665e-06 0.062 rs7908745 10 45458319 A G 0.995333 0.361781 48280 367388 10:45953767 10:45458319:A:G missense_variant "" "" "" unknown Allergic asthma (mode) ZPBP2 3.42e-08 -0.1341 7.698e-06 -0.082 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Primary open-angle glaucoma SIX6 5.83e-08 -0.1555 7.74e-06 -0.083 rs33912345 14 60509819 C A 0.998812 0.709283 185600 367388 14:60976537 14:60509819:C:A missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Hypothyroidism (congenital or acquired) C1QTNF6 5.84e-10 0.0949 7.771e-06 0.065 rs229527 22 37185445 C A 0.998635 0.393875 56892 367388 22:37581485 22:37185445:C:A missense_variant "" "" "" unknown Type 2 diabetes, definitions combined MTNR1B 2.78e-08 0.0663 7.79e-06 0.04 rs1447350 11 92984961 G C 0.996537 0.577801 122848 367388 11:92718127 11:92984961:G:C missense_variant "" "" "" dominant Senile cataract KCTD10 7.08e-09 0.076 7.959e-06 0.05 rs2058804 12 109471206 A G 0.998706 0.47476 82774 367388 12:109909011 12:109471206:A:G missense_variant "" "" "" unknown Type 2 diabetes, strict (exclude DM1) HNF1A 4.29e-09 0.0718 8.1e-06 0.054 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes, strict (exclude DM1) MTNR1B 3.13e-08 0.0658 8.604e-06 0.039 rs1447350 11 92984961 G C 0.996537 0.577801 122848 367388 11:92718127 11:92984961:G:C missense_variant "" "" "" dominant Type 2 diabetes without complications WFS1 8.64e-09 0.0904 9.726e-06 0.057 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Thyrotoxicosis with diffuse goitr CEP128 1.15e-08 0.2051 9.727e-06 0.154 rs2288347 14 80894614 C T 0.999714 0.385056 55018 367388 14:81360958 14:80894614:C:T missense_variant "" "" "" unknown Type 1 diabetes without complications SRPK1 8.93e-10 0.1623 1.041e-05 0.121 rs662713 6 35920290 G C 0.995651 0.33739 42088 367388 6:35888067 6:35920290:G:C pLoF "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) GSDMA 1.52e-09 -0.085 1.065e-05 -0.045 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown ILD, hospital admission 2, with pulmonary infections MUC5B 3.14e-11 -0.3354 1.112e-05 -0.169 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Disorders of thyroid, IBD co-morbidities CEP128 4.55e-09 0.1528 1.129e-05 0.11 rs2288347 14 80894614 C T 0.999714 0.385056 55018 367388 14:81360958 14:80894614:C:T missense_variant "" "" "" unknown Statin medication C2orf16 4.96e-08 0.0588 1.141e-05 0.056 rs1919127 2 27578626 T C 0.999785 0.280113 29038 367388 2:27801493 2:27578626:T:C missense_variant "" "" "" unknown Ischemic heart diseases RP11-145E5.5 2.2e-08 0.068 1.159e-05 0.043 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Type 2 diabetes, wide definition WFS1 4.47e-08 0.08 1.225e-05 0.052 rs734312 4 6301627 G A 0.99972 0.497561 90926 367388 4:6303354 4:6301627:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Statin medication HNF1A 5.38e-08 -0.059 1.262e-05 -0.056 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 2 diabetes with other specified/multiple/unspecified complications HNF1A 7.66e-09 0.0762 1.317e-05 0.056 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Angina pectoris RP11-145E5.5 7e-08 0.0814 1.336e-05 0.054 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Endocrine, nutritional and metabolic diseases VPS33B 6.81e-08 0.0445 1.358e-05 0.033 rs11073964 15 91000531 C T 0.997259 0.414777 63654 367388 15:91543761 15:91000531:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Senile cataract MMAB 1.29e-08 0.0746 1.372e-05 0.048 rs9593 12 109557065 A T 0.999279 0.475301 83002 367388 12:109994870 12:109557065:A:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Statin medication C2orf16 4.39e-08 0.059 1.421e-05 0.055 rs1919128 2 27578892 A G 0.999886 0.280352 29108 367388 2:27801759 2:27578892:A:G missense_variant "" "" "" unknown Hypertension, essential LSP1 1.88e-08 0.0613 1.465e-05 0.035 rs7938342 11 1866576 T A 0.995387 0.575596 122088 367388 11:1887806 11:1866576:T:A missense_variant "" "" "" unknown Type 1 diabetes with ophthalmic complications SH2B3 3.21e-08 -0.1809 1.518e-05 -0.104 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Hypertensive diseases (excluding secondary) LSP1 2.27e-08 0.0639 1.538e-05 0.037 rs7938342 11 1866576 T A 0.995387 0.575596 122088 367388 11:1887806 11:1866576:T:A missense_variant "" "" "" unknown Cholelithiasis HNF1A 3.78e-08 -0.0768 1.554e-05 -0.062 rs2464195 12 120997672 G A 0.998984 0.354742 46296 367388 12:121435475 12:120997672:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Other respiratory diseases principally affecting the interstitium MUC5B 2.16e-11 -0.2307 1.604e-05 -0.124 rs2943517 11 1250091 C G 0.987023 0.485051 86748 367388 11:1271321 11:1250091:C:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Fracture of forearm WNT16 5.07e-08 -0.0944 1.615e-05 -0.068 rs2908004 7 121329715 G A 0.991385 0.425398 66624 367388 7:120969769 7:121329715:G:A missense_variant "" "" "" unknown ILD, hospital admission 2, with pulmonary infections MUC5B 4.8e-11 -0.3329 1.621e-05 -0.167 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Asthma (only as main-diagnosis) GSDMA 3.33e-09 -0.0831 1.702e-05 -0.044 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Alzheimer's disease, wide definition (more controls excluded) ERCC2 1.68e-10 -0.1704 1.802e-05 -0.104 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Asthma, hospital admissions , main diagnosis only GSDMA 5.72e-09 -0.0795 1.859e-05 -0.042 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Diseases of veins, lymphatic vessels and lymph nodes, not elsewhere classified (FINNGEN) SH2B3 2.96e-08 -0.0755 1.956e-05 -0.042 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Type 2 diabetes, wide definition HNF1A 6.91e-08 -0.0878 2.004e-05 -0.081 rs56348580 12 120994314 G C 0.992391 0.28321 29462 367388 12:121432117 12:120994314:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Type 1 diabetes with other specified/multiple/unspecified complications SH2B3 6.08e-10 -0.1849 2.02e-05 -0.094 rs3184504 12 111446804 T C 0.99977 0.591214 128650 367388 12:111884608 12:111446804:T:C missense_variant "" "" "" unknown Other respiratory diseases principally affecting the interstitium MUC5B 4.55e-11 -0.2262 2.492e-05 -0.122 rs2943521 11 1248605 G A 0.994036 0.482027 85684 367388 11:1269835 11:1248605:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Coronary atherosclerosis ADAMTS7 2.82e-09 0.0857 2.539e-05 0.06 rs2127898 15 78790778 G A 0.998281 0.366991 49614 367388 15:79083120 15:78790778:G:A missense_variant (likely)Benign Benign Criteria_oneSubmitter unknown Asthma (mode) GSDMA 3.24e-09 -0.0795 2.609e-05 -0.041 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Diabetic retinopathy CFH 2.05e-10 -0.09 2.742e-05 -0.045 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Dementia in Alzheimer disease ERCC2 1.65e-08 -0.2101 2.869e-05 -0.141 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Chronic lower respiratory diseases GSDMA 7.35e-10 -0.066 3.691e-05 -0.032 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Asthma (more controls excluded) GSDMA 1.9e-09 -0.0796 3.693e-05 -0.039 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Sarcoidosis ANXA11 8.15e-10 -0.2291 3.801e-05 -0.135 rs1049550 10 80166946 G A 0.999873 0.449585 74622 367388 10:81926702 10:80166946:G:A missense_variant "" "" "" dominant Malignant neoplasm of respiratory system and intrathoracic organs CHRNA5 1.92e-08 0.2074 4.586e-05 0.161 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Malignant neoplasm of respiratory system and intrathoracic organs (other cancers excluded from controls) CHRNA5 1.76e-08 0.2113 4.617e-05 0.164 rs16969968 15 78590583 G A 0.999947 0.330531 40346 367388 15:78882925 15:78590583:G:A missense_variant drug response drug response Criteria_multSubmitter unknown Hypothyroidism, levothyroxin purchases CTLA4 3.12e-08 0.0832 5.472e-05 0.048 rs231775 2 203867991 A G 0.999974 0.518705 99544 367388 2:204732714 2:203867991:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Diabetic retinopathy (more controls excluded) CFH 4.7e-09 -0.0871 5.587e-05 -0.045 rs1061170 1 196690107 C T 0.999504 0.563965 117416 367388 1:196659237 1:196690107:C:T missense_variant (likely)Benign Benign Criteria_oneSubmitter both Thyrotoxicosis, other and/or unspecified CEP128 1.12e-08 0.1795 5.687e-05 0.122 rs2288347 14 80894614 C T 0.999714 0.385056 55018 367388 14:81360958 14:80894614:C:T missense_variant "" "" "" unknown Asthma/COPD (KELA code 203) ZPBP2 5.63e-09 -0.0761 5.814e-05 -0.04 rs11557467 17 39872381 G T 0.999935 0.560737 115402 367388 17:38028634 17:39872381:G:T missense_variant "" "" "" unknown Asthma GSDMA 4.8e-09 -0.0772 6.208e-05 -0.038 rs7212938 17 39966427 G T 0.99017 0.59966 132268 367388 17:38122680 17:39966427:G:T missense_variant "" "" "" unknown Type 1 diabetes with ophthalmic complications TH 1.63e-08 0.1853 6.277e-05 0.115 rs6356 11 2169721 C T 0.979479 0.439726 71322 367388 11:2190951 11:2169721:C:T missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Disorders of gallbladder, biliary tract and pancreas HNF1A 9.05e-08 -0.0672 7.202e-05 -0.051 rs2464195 12 120997672 G A 0.998984 0.354742 46296 367388 12:121435475 12:120997672:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter both Hypothyroidism and >3 levothyroxin purchases CTLA4 4.03e-08 0.0827 7.289e-05 0.047 rs231775 2 203867991 A G 0.999974 0.518705 99544 367388 2:204732714 2:203867991:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Hypertension, essential PLCE1 2.09e-08 -0.0636 7.345e-05 -0.047 rs2274224 10 94279840 G C 0.999495 0.346144 44056 367388 10:96039597 10:94279840:G:C missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Chronic lower respiratory diseases STARD3 6.82e-08 -0.0606 7.516e-05 -0.029 rs1877031 17 39657827 G A 0.998956 0.684783 172280 367388 17:37814080 17:39657827:G:A missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) TRAK2 8.37e-08 -0.0972 0.0001009 -0.048 rs13022344 2 201399433 C T 0.999466 0.652716 156556 367388 2:202264156 2:201399433:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) TRAK2 8.9e-08 -0.0969 0.0001039 -0.048 rs13022344 2 201399433 C T 0.999466 0.652716 156556 367388 2:202264156 2:201399433:C:T missense_variant "" "" "" unknown Disorders of gallbladder, biliary tract and pancreas GCKR 2.78e-08 0.0701 0.0001192 0.033 rs1260326 2 27508073 T C 0.995194 0.648905 154626 367388 2:27730940 2:27508073:T:C missense_variant association association no_Criteria unknown Hypothyroidism (congenital or acquired) CTLA4 6.44e-08 0.0811 0.0001213 0.045 rs231775 2 203867991 A G 0.999974 0.518705 99544 367388 2:204732714 2:203867991:A:G missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Other malignant neoplasms of skin (=non-melanoma skin cancer) TRAK2 9.28e-08 -0.0952 0.0001215 -0.047 rs13022344 2 201399433 C T 0.999466 0.652716 156556 367388 2:202264156 2:201399433:C:T missense_variant "" "" "" unknown Malignant neoplasm of skin TRAK2 9.71e-08 -0.0951 0.000124 -0.047 rs13022344 2 201399433 C T 0.999466 0.652716 156556 367388 2:202264156 2:201399433:C:T missense_variant "" "" "" unknown Organic, including symptomatic, mental disorders ERCC2 3.77e-08 -0.1017 0.0001339 -0.064 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Asthma (only as main-diagnosis) IL1RL1 6.52e-08 -0.0753 0.0001442 -0.049 rs10206753 2 102351902 T C 0.999919 0.408647 61384 367388 2:102968362 2:102351902:T:C missense_variant "" "" "" unknown Asthma (only as main-diagnosis) IL1RL1 6.9e-08 -0.0752 0.0001455 -0.049 rs4988956 2 102351547 G A 0.999972 0.408658 61388 367388 2:102968007 2:102351547:G:A missense_variant "" "" "" unknown Cholelithiasis GCKR 3.12e-08 0.0776 0.0001484 0.036 rs1260326 2 27508073 T C 0.995194 0.648905 154626 367388 2:27730940 2:27508073:T:C missense_variant association association no_Criteria unknown Asthma (only as main-diagnosis) IL1RL1 6.48e-08 -0.0753 0.0001538 -0.049 rs10204137 2 102351752 A G 0.999916 0.408658 61394 367388 2:102968212 2:102351752:A:G missense_variant "" "" "" unknown Asthma (only as main-diagnosis) IL1RL1 7.3e-08 -0.075 0.0001538 -0.049 rs10192157 2 102351896 C T 0.999919 0.408663 61394 367388 2:102968356 2:102351896:C:T missense_variant "" "" "" unknown Asthma (only as main-diagnosis) IL1RL1 6.53e-08 -0.0753 0.0001561 -0.049 rs10192036 2 102351751 C A 0.999915 0.40865 61390 367388 2:102968211 2:102351751:C:A missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis GCKR 3.84e-08 0.0755 0.0001567 0.035 rs1260326 2 27508073 T C 0.995194 0.648905 154626 367388 2:27730940 2:27508073:T:C missense_variant association association no_Criteria unknown Asthma (only as main-diagnosis) (more controls excluded) IL1RL1 7.39e-08 -0.0751 0.0001886 -0.049 rs10206753 2 102351902 T C 0.999919 0.408647 61384 367388 2:102968362 2:102351902:T:C missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) IL1RL1 7.81e-08 -0.075 0.0001897 -0.049 rs4988956 2 102351547 G A 0.999972 0.408658 61388 367388 2:102968007 2:102351547:G:A missense_variant "" "" "" unknown Cholelithiasis, broad definition with cholecystitis HNF1A 9.59e-08 -0.0725 0.0001959 -0.05 rs1169288 12 120978847 A C 0.996877 0.373404 51256 367388 12:121416650 12:120978847:A:C missense_variant (likely)Benign Benign Criteria_multSubmitter both Coronary revascularization (ANGIO or CABG) MTAP 2.66e-08 -0.1024 0.0001984 -0.062 rs7023954 9 21816759 G A 0.999954 0.431427 69058 367388 9:21816758 9:21816759:G:A missense_variant (likely)Benign Benign Criteria_multSubmitter dominant Asthma (only as main-diagnosis) (more controls excluded) IL1RL1 7.34e-08 -0.0752 0.0002006 -0.048 rs10204137 2 102351752 A G 0.999916 0.408658 61394 367388 2:102968212 2:102351752:A:G missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) IL1RL1 8.26e-08 -0.0749 0.0002006 -0.048 rs10192157 2 102351896 C T 0.999919 0.408663 61394 367388 2:102968356 2:102351896:C:T missense_variant "" "" "" unknown Other malignant neoplasms of skin (=non-melanoma skin cancer) (other cancers excluded from controls) RP11-145E5.5 2.23e-10 -0.1095 0.0002025 -0.052 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Asthma (only as main-diagnosis) (more controls excluded) IL1RL1 7.4e-08 -0.0751 0.0002036 -0.048 rs10192036 2 102351751 C A 0.999915 0.40865 61390 367388 2:102968211 2:102351751:C:A missense_variant "" "" "" unknown Malignant neoplasm of skin (other cancers excluded from controls) RP11-145E5.5 2.47e-10 -0.1091 0.000213 -0.052 rs10965215 9 22029446 G A 0.998711 0.501206 92610 367388 9:22029445 9:22029446:G:A missense_variant "" "" "" unknown Other spirochaetal diseases SCGB1D2 6.07e-08 0.2645 0.000232 0.171 rs2232950 11 62243391 C T 0.998583 0.401611 59472 367388 11:62010863 11:62243391:C:T missense_variant "" "" "" unknown Coxarthrosis, primary, with hip surgery TSEN15 5.67e-08 -0.1171 0.000244 -0.074 rs1046934 1 184054395 A C 0.999299 0.409466 61660 367388 1:184023529 1:184054395:A:C missense_variant "" "" "" recessive Asthma/COPD (KELA code 203) GSDMB 1.9e-08 -0.0732 0.0002536 -0.036 rs2305479 17 39905964 C T 0.999902 0.549024 110656 367388 17:38062217 17:39905964:C:T missense_variant "" "" "" unknown Asthma IL1RL1 9.3e-08 -0.0699 0.0002574 -0.045 rs10206753 2 102351902 T C 0.999919 0.408647 61384 367388 2:102968362 2:102351902:T:C missense_variant "" "" "" unknown Alzheimer's disease (Late onset) (more controls excluded) ERCC2 8.47e-08 -0.1963 0.0002588 -0.122 rs13181 19 45351661 T G 0.999799 0.422169 65670 367388 19:45854919 19:45351661:T:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Asthma IL1RL1 9.82e-08 -0.0698 0.0002598 -0.045 rs4988956 2 102351547 G A 0.999972 0.408658 61388 367388 2:102968007 2:102351547:G:A missense_variant "" "" "" unknown Asthma IL1RL1 9.22e-08 -0.0699 0.0002715 -0.044 rs10204137 2 102351752 A G 0.999916 0.408658 61394 367388 2:102968212 2:102351752:A:G missense_variant "" "" "" unknown Asthma IL1RL1 9.34e-08 -0.0699 0.0002755 -0.044 rs10192036 2 102351751 C A 0.999915 0.40865 61390 367388 2:102968211 2:102351751:C:A missense_variant "" "" "" unknown Coxarthrosis, primary, with hip surgery TSEN15 6.47e-08 -0.1166 0.0002764 -0.073 rs2274432 1 184051811 G A 0.999438 0.409194 61574 367388 1:184020945 1:184051811:G:A missense_variant "" "" "" recessive ILD, hospital admissions 3, with pneumonia sepsis MUC5B 4.23e-09 -0.3245 0.0003216 -0.15 rs55813014 11 1246095 T C 0.994481 0.556374 113730 367388 11:1267325 11:1246095:T:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant ILD, hospital admissions 3, with pneumonia sepsis MUC5B 6.02e-09 -0.3219 0.0004092 -0.149 rs2943529 11 1247283 G C 0.989454 0.55458 113014 367388 11:1268513 11:1247283:G:C missense_variant (likely)Benign Benign Criteria_oneSubmitter dominant Migraine, single triptan purchase ok & required. ICD-code if available is included FHL5 5.62e-08 -0.0891 0.0004155 -0.052 rs2252816 6 96610698 G A 0.996825 0.436533 70196 367388 6:97058574 6:96610698:G:A missense_variant "" "" "" unknown Need for immunization against other single viral diseases GNA12 1.08e-08 -0.5081 0.0005011 -0.266 rs2644275 7 2814376 G A 0.999653 0.461988 78654 367388 7:2854010 7:2814376:G:A missense_variant "" "" "" unknown Hypertensive diseases AGT 2.85e-08 0.0553 0.0007834 0.03 rs699 1 230710048 A G 0.999874 0.430768 68682 367388 1:230845794 1:230710048:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Hypertension AGT 3.23e-08 0.0554 0.0008331 0.03 rs699 1 230710048 A G 0.999874 0.430768 68682 367388 1:230845794 1:230710048:A:G missense_variant (likely)Benign Benign Criteria_multSubmitter recessive Antenatal screening MXRA5 2.06e-13 0.3248 rs199982099 23 3310341 G A 0.997523 0.0222381 2556 367388 X:3228382 23:3310341:G:A missense_variant "" "" "" unknown Supervision of normal pregnancy MXRA5 9.8e-12 0.32 rs199982099 23 3310341 G A 0.997523 0.0222381 2556 367388 X:3228382 23:3310341:G:A missense_variant "" "" "" unknown Entropion and trichiasis of eyelid SRPX 7.23e-09 1.9277 rs200219563 23 38149779 C T 0.994395 0.00671769 1094 367388 X:38009032 23:38149779:C:T missense_variant "" "" "" unknown Varicose veins SRPX 8.64e-08 -0.1453 rs35318931 23 38149868 G A 0.997478 0.0619291 10582 367388 X:38009121 23:38149868:G:A missense_variant "" "" "" unknown Hernia SRPX 2.35e-11 -0.1224 rs35318931 23 38149868 G A 0.997478 0.0619291 10582 367388 X:38009121 23:38149868:G:A missense_variant "" "" "" unknown Gonarthrosis [arthrosis of knee](FG) GPRASP2 5.69e-08 1.3926 rs770705221 23 102717216 A T 0.908853 0.000372903 66 367388 X:101972144 23:102717216:A:T missense_variant "" "" "" recessive Gonarthrosis,primary GPRASP2 1.68e-08 1.5792 rs770705221 23 102717216 A T 0.908853 0.000372903 66 367388 X:101972144 23:102717216:A:T missense_variant "" "" "" recessive Gonarthrosis, primary, with knee surgery GPRASP2 2.65e-10 2.9779 rs770705221 23 102717216 A T 0.908853 0.000372903 66 367388 X:101972144 23:102717216:A:T missense_variant "" "" "" recessive Primary gonarthrosis, bilateral GPRASP2 7.01e-09 2.7837 rs770705221 23 102717216 A T 0.908853 0.000372903 66 367388 X:101972144 23:102717216:A:T missense_variant "" "" "" recessive Alcohol-induced chronic pancreatitis MORC4 5.21e-08 0.2225 rs6622126 23 106956972 G A 0.998196 0.405628 98992 367388 X:106200202 23:106956972:G:A missense_variant "" "" "" unknown Antenatal screening CT47B1 1.27e-09 -0.627 rs777379376 23 120875312 A C 0.993045 0.00308121 1094 367388 X:120009166 23:120875312:A:C missense_variant "" "" "" unknown Supervision of normal pregnancy CT47B1 1e-08 -0.6229 rs777379376 23 120875312 A C 0.993045 0.00308121 1094 367388 X:120009166 23:120875312:A:C missense_variant "" "" "" unknown