=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  miRanda v1.0b    microRNA Target Scanning Algorithm
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  (c) 2003 Memorial Sloan-Kettering Cancer Center, New York
  
  Authors: Anton Enright, Bino John, Chris Sander and Debora Marks
  (mirnatargets@cbio.mskcc.org - reaches all authors)
  
  Software written by: Anton Enright
  Distributed for anyone to use under the GNU Public License (GPL),
  See the files 'COPYING' and 'LICENSE' for details
  
  If you use this software please cite:
  Enright AJ, John B, Gaul U, Tuschl T, Sander C and Marks DS;
  (2003) Genome Biology; 5(1):R1.
  
     miRanda comes with ABSOLUTELY NO WARRANTY;
     This is free software, and you are welcome to redistribute it
     under certain conditions; type `miranda --license' for details.
  
  Current Settings:
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Query Filename:		d:\docs\Zak\Tools\miRanda\Post Zwi\TAR 5p.txt
  Reference Filename:	d:\docs\Zak\Tools\miRanda\Post Zwi\Experiment new for nature.txt
  Gap Open Penalty:	-2.000000
  Gap Extend:		-8.000000
  Score Threshold		80.000000
  Energy Threshold	-14.000000 kcal/mol
  Z-Score Threshold	5.000000
  
  Shuffling Turned on:
  Shuffles:		150
  Window Size:		20
  Scaling Parameter:	2.000000
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Read Sequence:TAR  5p
  (19 nt)
  Read Sequence:TAR  Sequence
  (21 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 42.93	St. Dev: 6.83	Max: 56.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs TAR
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 85.000000  Q:2 to 20  R:1 to 19 Align Len (18) (77.78%) (77.78%)
  
     Query:    3' ACCAGAUUGGUCUCUCUGG 5'
                   |||||  ||||  |||||
     Ref:      5' GGUCUCUCUGGUUAGACC 3'
  
     Z-Score: 6.162
     Energy:  -21.160000 kCal/Mol
  
  Scores for this hit:
  >TAR	TAR	85.00	-21.16	6.16	2 20	1 19	18	77.78%	77.78%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	TAR	85.00	-21.16	85.00	-21.16	1	19	21	 0
  Complete
  
  Read Sequence:Human  alpha-1 type VII collagen (COL7A1) mRNA, complete cds.
  (9287 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 71.96	St. Dev: 6.60	Max: 82.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Human
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 114.000000  Q:1 to 20  R:3595 to 3617 Align Len (23) (73.91%) (78.26%)
  
     Query:    3' ACC-AGAUUGGUC-UCU-C-UGG 5'
                  ||| ||| :|||| ||| | |||
     Ref:      5' TGGTTCT-GCTAGTGGATGAACC 3'
  
     Z-Score: 6.372
     Energy:  -15.980000 kCal/Mol
  
  Scores for this hit:
  >TAR	Human	114.00	-15.98	6.37	1 20	3595 3617	23	73.91%	78.26%
  
  
     Forward:	Score: 114.000000  Q:1 to 20  R:2737 to 2759 Align Len (23) (73.91%) (78.26%)
  
     Query:    3' ACCA-GAUUG-GUCUCUC-UG-G 5'
                  |||| | |:| ||||||| || |
     Ref:      5' TGGTGC-AGCGCGGGGAGCACTC 3'
  
     Z-Score: 6.372
     Energy:  -20.510000 kCal/Mol
  
  Scores for this hit:
  >TAR	Human	114.00	-20.51	6.37	1 20	2737 2759	23	73.91%	78.26%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Human	228.00	-36.49	114.00	-20.51	2	19	9287	 3594 2736
  Complete
  
  Read Sequence:Homo  sapiens retinal degeneration B beta mRNA, complete cds.
  (1124 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 66.15	St. Dev: 6.67	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 108.000000  Q:1 to 19  R:580 to 605 Align Len (25) (68.00%) (68.00%)
  
     Query:    3' A-C-CAG-A-U-UGGUCUC-UC-UGG 5'
                  | | | | | | ||||||| || || 
     Ref:      5' TGGGGGCTTCAGACCAGAGTGGAACA 3'
  
     Z-Score: 6.275
     Energy:  -18.889999 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	108.00	-18.89	6.28	1 19	580 605	25	68.00%	68.00%
  
  
     Forward:	Score: 106.000000  Q:4 to 19  R:476 to 492 Align Len (17) (82.35%) (82.35%)
  
     Query:    3' ACCAGAUU-GGUCUC-UCUGG 5'
                     || || |||||| |||| 
     Ref:      5' ACTTC-AAGTCAGAGAAGACA 3'
  
     Z-Score: 5.975
     Energy:  -16.799999 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	106.00	-16.80	5.98	4 19	476 492	17	82.35%	82.35%
  
  
     Forward:	Score: 105.000000  Q:2 to 20  R:120 to 138 Align Len (20) (70.00%) (75.00%)
  
     Query:    3' ACCAGAUUGGUCUCU-CU-GG 5'
                   |||| : ||||| | || ||
     Ref:      5' AGGTC-GTCCAGA-ATGAGCC 3'
  
     Z-Score: 5.825
     Energy:  -20.850000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	105.00	-20.85	5.83	2 20	120 138	20	70.00%	75.00%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	319.00	-56.54	108.00	-20.85	3	19	1124	 579 475 119
  Complete
  
  Read Sequence:Homo  sapiens ARF GTPase-activating protein GIT2 (KIAA0148) mRNA,
  (2473 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 69.04	St. Dev: 6.52	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 116.000000  Q:1 to 20  R:1865 to 1887 Align Len (23) (73.91%) (73.91%)
  
     Query:    3' ACCA-GAU-UG-GUC-UCUCUGG 5'
                  |||| | | || ||| ||| |||
     Ref:      5' TGGTACCAGACACAGCAGA-ACC 3'
  
     Z-Score: 7.200
     Energy:  -14.760000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	116.00	-14.76	7.20	1 20	1865 1887	23	73.91%	73.91%
  
  
     Forward:	Score: 113.000000  Q:1 to 20  R:1530 to 1555 Align Len (25) (64.00%) (68.00%)
  
     Query:    3' A-CC-AG-AUUGGU-C-U-CUCUGG 5'
                  | ||  | |: ||| | | ||||||
     Ref:      5' TAGGCCCATGTCCATGTACGAGACC 3'
  
     Z-Score: 6.740
     Energy:  -15.560000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	113.00	-15.56	6.74	1 20	1530 1555	25	64.00%	68.00%
  
  
     Forward:	Score: 104.000000  Q:3 to 20  R:1255 to 1272 Align Len (19) (73.68%) (78.95%)
  
     Query:    3' ACC-AGAUUGGUCU-CUCUGG 5'
                    | |:| |||||| | ||||
     Ref:      5' CAGATTT-ATCAGATG-GACC 3'
  
     Z-Score: 5.360
     Energy:  -15.650000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	104.00	-15.65	5.36	3 20	1255 1272	19	73.68%	78.95%
  
  
     Forward:	Score: 103.000000  Q:4 to 20  R:2010 to 2030 Align Len (21) (66.67%) (71.43%)
  
     Query:    3' ACCA-G-AUUG-GUCUCU-CUG-G 5'
                     | | | :| |||||| ||| |
     Ref:      5' TATTCCCT-GCTCAGAGAGGATAC 3'
  
     Z-Score: 5.207
     Energy:  -18.030001 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	103.00	-18.03	5.21	4 20	2010 2030	21	66.67%	71.43%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	436.00	-64.00	116.00	-18.03	4	19	2473	 1864 1529 1254 2009
  Complete
  
  Read Sequence:Homo  sapiens protein inhibitor of activated STAT protein PIASy
  (1533 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 67.48	St. Dev: 6.37	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 104.000000  Q:2 to 20  R:699 to 717 Align Len (19) (73.68%) (78.95%)
  
     Query:    3' ACCAGAUU-GGUCUCUCUGG 5'
                   |||  |: ||| |||||||
     Ref:      5' GGGTGGAGCCCA-AGAGGCC 3'
  
     Z-Score: 5.732
     Energy:  -23.930000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	104.00	-23.93	5.73	2 20	699 717	19	73.68%	78.95%
  
  
     Forward:	Score: 101.000000  Q:1 to 20  R:927 to 946 Align Len (20) (75.00%) (80.00%)
  
     Query:    3' ACCA-GAUUGGUCUCUCUGG 5'
                  || | ||:| ||| ||||||
     Ref:      5' TGATCCTGA-CAGCGAGATC 3'
  
     Z-Score: 5.261
     Energy:  -15.890000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	101.00	-15.89	5.26	1 20	927 946	20	75.00%	80.00%
  
  
     Forward:	Score: 100.000000  Q:1 to 19  R:71 to 97 Align Len (26) (61.54%) (69.23%)
  
     Query:    3' A-CC-A-G-A-UUGGUCUC-U-CU-GG 5'
                  | || | | | ::|||||| | || | 
     Ref:      5' TGGGTTTCGTGGGCCGGAGTAAGAGTG 3'
  
     Z-Score: 5.104
     Energy:  -17.540001 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	100.00	-17.54	5.10	1 19	71 97	26	61.54%	69.23%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	305.00	-57.36	104.00	-23.93	5	19	1533	 698 926 70
  Complete
  
  Read Sequence:gi|119964722|ref|NM_003897.3|  Homo sapiens immediate early response 3 (IER3), mRNA
  (1254 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 65.46	St. Dev: 6.41	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs gi|119964722|ref|NM_003897.3|
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 108.000000  Q:1 to 20  R:1004 to 1029 Align Len (25) (76.00%) (76.00%)
  
     Query:    3' A-CCAG-AUU-G-GU-CUCU-CUGG 5'
                  | |||| ||| | || |||| ||||
     Ref:      5' TGGGTCGTAAGTTTAGGAGGTGACT 3'
  
     Z-Score: 6.635
     Energy:  -15.400000 kCal/Mol
  
  Scores for this hit:
  >TAR	gi|119964722|ref|NM_003897.3|	108.00	-15.40	6.63	1 20	1004 1029	25	76.00%	76.00%
  
  
     Forward:	Score: 102.000000  Q:2 to 20  R:656 to 677 Align Len (21) (66.67%) (71.43%)
  
     Query:    3' ACC-AGAU-UG-GUCUCUCUGG 5'
                   ||  | | :| || |||||||
     Ref:      5' GGGACCGAGGCGCACAGAGACC 3'
  
     Z-Score: 5.699
     Energy:  -16.530001 kCal/Mol
  
  Scores for this hit:
  >TAR	gi|119964722|ref|NM_003897.3|	102.00	-16.53	5.70	2 20	656 677	21	66.67%	71.43%
  
  
     Forward:	Score: 99.000000  Q:1 to 20  R:1165 to 1185 Align Len (20) (75.00%) (80.00%)
  
     Query:    3' ACCAGAUUG-GUCUCUCUGG 5'
                  ||| ||: | ||||| ||||
     Ref:      5' TGGGCTGTCACGGAGCGACT 3'
  
     Z-Score: 5.231
     Energy:  -18.520000 kCal/Mol
  
  Scores for this hit:
  >TAR	gi|119964722|ref|NM_003897.3|	99.00	-18.52	5.23	1 20	1165 1185	20	75.00%	80.00%
  
  
     Forward:	Score: 98.000000  Q:2 to 20  R:351 to 374 Align Len (24) (58.33%) (62.50%)
  
     Query:    3' AC-C-A-GAU-U-GGUCUCUCUG-G 5'
                   | |   ||:   |||||| ||| |
     Ref:      5' GGCGCCCCTGCCTCCAGAG-GACGC 3'
  
     Z-Score: 5.075
     Energy:  -18.820000 kCal/Mol
  
  Scores for this hit:
  >TAR	gi|119964722|ref|NM_003897.3|	98.00	-18.82	5.08	2 20	351 374	24	58.33%	62.50%
  
  
     Forward:	Score: 98.000000  Q:1 to 20  R:1073 to 1099 Align Len (27) (59.26%) (62.96%)
  
     Query:    3' A-CCAGAUU-G-G-U-C-U-CUCU-GG 5'
                  | || | :| | | | | | |||| ||
     Ref:      5' TCGG-CGGACCATTAGGAATGAGATCC 3'
  
     Z-Score: 5.075
     Energy:  -15.260000 kCal/Mol
  
  Scores for this hit:
  >TAR	gi|119964722|ref|NM_003897.3|	98.00	-15.26	5.08	1 20	1073 1099	27	59.26%	62.96%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	gi|119964722|ref|NM_003897.3|	505.00	-84.53	108.00	-18.82	6	19	1254	 1003 655 1164 350 1072
  Complete
  
  Read Sequence:Homo  sapiens SBC2 mRNA for sodium bicarbonate cotransporter2,
  (3238 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 68.59	St. Dev: 6.44	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 107.000000  Q:1 to 20  R:2756 to 2778 Align Len (22) (72.73%) (77.27%)
  
     Query:    3' AC-CAGAUUG-GUCUCUC-UGG 5'
                  || ||:| ||  |||||| |||
     Ref:      5' TGTGTTTCACGAAGAGAGAACT 3'
  
     Z-Score: 5.968
     Energy:  -15.140000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	107.00	-15.14	5.97	1 20	2756 2778	22	72.73%	77.27%
  
  
     Forward:	Score: 106.000000  Q:1 to 18  R:2058 to 2080 Align Len (22) (72.73%) (72.73%)
  
     Query:    3' AC-C--A-GA-UUGGUCUCUCUGG 5'
                  || |  | || | |||||||||  
     Ref:      5' TGAGCCTACTCATCCAGAGAGAGG 3'
  
     Z-Score: 5.813
     Energy:  -19.400000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	106.00	-19.40	5.81	1 18	2058 2080	22	72.73%	72.73%
  
  
     Forward:	Score: 105.000000  Q:1 to 20  R:1505 to 1529 Align Len (26) (65.38%) (65.38%)
  
     Query:    3' ACC-A-GAUUGGUCU-C-U-C-U-GG 5'
                  ||| | | || |||| | | | | ||
     Ref:      5' TGGTTGC-AA-CAGATGCAAGCAGCC 3'
  
     Z-Score: 5.658
     Energy:  -14.650000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	105.00	-14.65	5.66	1 20	1505 1529	26	65.38%	65.38%
  
  
     Forward:	Score: 103.000000  Q:1 to 20  R:1098 to 1120 Align Len (22) (72.73%) (77.27%)
  
     Query:    3' A-CCAGA-UUGGUCUCU-CUGG 5'
                  | || || |:||| ||| ||||
     Ref:      5' TGGGCCTGAGCTACAGAGGACT 3'
  
     Z-Score: 5.347
     Energy:  -18.160000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	103.00	-18.16	5.35	1 20	1098 1120	22	72.73%	77.27%
  
  
     Forward:	Score: 103.000000  Q:1 to 20  R:348 to 367 Align Len (20) (80.00%) (80.00%)
  
     Query:    3' ACCAGAUUGGUCU-CUCUGG 5'
                  ||| | ||||||| ||| ||
     Ref:      5' TGG-CCAATTAGACGAGTCC 3'
  
     Z-Score: 5.347
     Energy:  -15.810000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	103.00	-15.81	5.35	1 20	348 367	20	80.00%	80.00%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	524.00	-83.16	107.00	-19.40	7	19	3238	 2755 2057 1504 1097 347
  Complete
  
  Read Sequence:Human  (HepG2) glucose transporter gene mRNA, complete cds.
  (2856 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 68.02	St. Dev: 6.34	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Human
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 106.000000  Q:2 to 20  R:1720 to 1737 Align Len (19) (78.95%) (84.21%)
  
     Query:    3' ACCAGAUUGGUCU-CUCUGG 5'
                   || | |:||||| ||||||
     Ref:      5' AGG-C-AGCTGGATGAGACT 3'
  
     Z-Score: 5.989
     Energy:  -17.580000 kCal/Mol
  
  Scores for this hit:
  >TAR	Human	106.00	-17.58	5.99	2 20	1720 1737	19	78.95%	84.21%
  
  
     Forward:	Score: 100.000000  Q:3 to 20  R:2088 to 2110 Align Len (22) (72.73%) (72.73%)
  
     Query:    3' ACC-A-GAU-UGGU-CUCU-CUGG 5'
                    | | |||  ||| |||| ||||
     Ref:      5' AAGCTTCTATCCCAGGAGGTGGCT 3'
  
     Z-Score: 5.043
     Energy:  -14.320000 kCal/Mol
  
  Scores for this hit:
  >TAR	Human	100.00	-14.32	5.04	3 20	2088 2110	22	72.73%	72.73%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Human	206.00	-31.90	106.00	-17.58	8	19	2856	 1719 2087
  Complete
  
  Read Sequence:Homo  sapiens mRNA for 39k3 protein.
  (4058 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 68.02	St. Dev: 6.49	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 104.000000  Q:1 to 20  R:503 to 521 Align Len (21) (76.19%) (76.19%)
  
     Query:    3' ACCA-GAUUGGUCUCUC-UGG 5'
                  | || | |||||||| | |||
     Ref:      5' T-GTAC-AATCAGAG-GTATC 3'
  
     Z-Score: 5.544
     Energy:  -16.270000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	104.00	-16.27	5.54	1 20	503 521	21	76.19%	76.19%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	104.00	-16.27	104.00	-16.27	9	19	4058	 502
  Complete
  
  Read Sequence:Homo  sapiens TIMM13b mRNA, complete cds.
  (288 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 63.91	St. Dev: 6.42	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Score for this Scan:
  No Hits Found above Threshold
  Complete
  
  Read Sequence:Homo  sapiens CGI-21 protein mRNA, complete cds.
  (2166 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 67.81	St. Dev: 6.54	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 117.000000  Q:1 to 20  R:293 to 316 Align Len (24) (70.83%) (75.00%)
  
     Query:    3' ACC-A-GA-U-U-GGUCUCUCUGG 5'
                  ||| | || | : |||||||| ||
     Ref:      5' TGGATTCTGAGGACCGGAGAG-CC 3'
  
     Z-Score: 7.526
     Energy:  -22.629999 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	117.00	-22.63	7.53	1 20	293 316	24	70.83%	75.00%
  
  
     Forward:	Score: 104.000000  Q:1 to 20  R:888 to 909 Align Len (22) (72.73%) (72.73%)
  
     Query:    3' AC-CAGAUUGGU-CUCU-CUGG 5'
                  || ||||  ||| |||| | ||
     Ref:      5' TGTGTCTCCCCATGAGATG-CT 3'
  
     Z-Score: 5.537
     Energy:  -15.530000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	104.00	-15.53	5.54	1 20	888 909	22	72.73%	72.73%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	221.00	-38.16	117.00	-22.63	11	19	2166	 292 887
  Complete
  
  Read Sequence:H.sapiens  mRNA for RanBP3 (59 kDa).
  (3198 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 69.31	St. Dev: 6.63	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs H.sapiens
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 116.000000  Q:1 to 20  R:2491 to 2513 Align Len (23) (73.91%) (78.26%)
  
     Query:    3' ACCA-GAU-UGG-UCUCUC-UGG 5'
                  | || ||| :|| |||||| |||
     Ref:      5' T-GTCCTAGGCCTGGAGAGTGCC 3'
  
     Z-Score: 7.038
     Energy:  -18.290001 kCal/Mol
  
  Scores for this hit:
  >TAR	H.sapiens	116.00	-18.29	7.04	1 20	2491 2513	23	73.91%	78.26%
  
  
     Forward:	Score: 106.000000  Q:2 to 20  R:3027 to 3044 Align Len (19) (73.68%) (73.68%)
  
     Query:    3' ACC-AGAUUGGUCUCUCUGG 5'
                   ||  ||  || ||||||||
     Ref:      5' AGGCCCT-CCC-GAGAGACC 3'
  
     Z-Score: 5.530
     Energy:  -20.969999 kCal/Mol
  
  Scores for this hit:
  >TAR	H.sapiens	106.00	-20.97	5.53	2 20	3027 3044	19	73.68%	73.68%
  
  
     Forward:	Score: 104.000000  Q:1 to 20  R:2812 to 2831 Align Len (21) (66.67%) (76.19%)
  
     Query:    3' ACC-AG-AUUGGUCUCUCUGG 5'
                  |||  | |::||| |||| ||
     Ref:      5' TGGAGCATGGCCA-AGAG-CC 3'
  
     Z-Score: 5.229
     Energy:  -16.530001 kCal/Mol
  
  Scores for this hit:
  >TAR	H.sapiens	104.00	-16.53	5.23	1 20	2812 2831	21	66.67%	76.19%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	H.sapiens	326.00	-55.79	116.00	-20.97	12	19	3198	 2490 3026 2811
  Complete
  
  Read Sequence:Homo  sapiens mRNA for ferrochelatase, complete cds.
  (2443 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 67.50	St. Dev: 6.31	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 119.000000  Q:1 to 20  R:835 to 853 Align Len (20) (85.00%) (85.00%)
  
     Query:    3' ACCAGAUUGGUCUCU-CUGG 5'
                  ||||| || |||||| ||||
     Ref:      5' TGGTC-AA-CAGAGGCGACC 3'
  
     Z-Score: 8.161
     Energy:  -22.480000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	119.00	-22.48	8.16	1 20	835 853	20	85.00%	85.00%
  
  
     Forward:	Score: 109.000000  Q:1 to 20  R:1831 to 1854 Align Len (23) (69.57%) (73.91%)
  
     Query:    3' ACC-A-G-A-UUGGUCUCUCUGG 5'
                  ||| | | |  :|||| ||||||
     Ref:      5' TGGCTGCTTTTGCCAGCGAGGCC 3'
  
     Z-Score: 6.576
     Energy:  -22.430000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	109.00	-22.43	6.58	1 20	1831 1854	23	69.57%	73.91%
  
  
     Forward:	Score: 107.000000  Q:1 to 20  R:1256 to 1272 Align Len (19) (78.95%) (84.21%)
  
     Query:    3' ACCAGAUUGGUCUCUCUGG 5'
                  | |||| : ||||||||||
     Ref:      5' T-GTCT-G-CAGGGAGACT 3'
  
     Z-Score: 6.259
     Energy:  -21.160000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	107.00	-21.16	6.26	1 20	1256 1272	19	78.95%	84.21%
  
  
     Forward:	Score: 104.000000  Q:1 to 20  R:247 to 265 Align Len (20) (80.00%) (80.00%)
  
     Query:    3' ACCAGAUUGGU-CUCUCUGG 5'
                  | | |||| || ||||||||
     Ref:      5' T-G-CTAAACATGGGAGGCC 3'
  
     Z-Score: 5.784
     Energy:  -19.190001 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	104.00	-19.19	5.78	1 20	247 265	20	80.00%	80.00%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	439.00	-85.26	119.00	-22.48	13	19	2443	 834 1830 1255 246
  Complete
  
  Read Sequence:Homo  sapiens ubiquinol-cytochrome c reductase binding protein, mRNA
  (965 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 64.23	St. Dev: 6.13	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 101.000000  Q:1 to 20  R:46 to 72 Align Len (26) (65.38%) (69.23%)
  
     Query:    3' ACCAG-A-U-U-GGUC-U-C-UCUGG 5'
                  |||||   | : |||| | | |||||
     Ref:      5' TGGTCAAAATGGCTGGTAAGCAGGCC 3'
  
     Z-Score: 6.002
     Energy:  -18.160000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	101.00	-18.16	6.00	1 20	46 72	26	65.38%	69.23%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	101.00	-18.16	101.00	-18.16	14	19	965	 45
  Complete
  
  Read Sequence:Homo  sapiens KAL1 gene, VIRTUAL TRANSCRIPT, partial sequence,
  (1473 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 65.73	St. Dev: 6.49	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 101.000000  Q:1 to 20  R:128 to 146 Align Len (19) (84.21%) (84.21%)
  
     Query:    3' ACCAGAUUGGUCUCUCUGG 5'
                  ||||  || ||||||||||
     Ref:      5' TGGT-GAAGCAGGGGGACT 3'
  
     Z-Score: 5.432
     Energy:  -21.540001 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	101.00	-21.54	5.43	1 20	128 146	19	84.21%	84.21%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	101.00	-21.54	101.00	-21.54	15	19	1473	 127
  Complete
  
  Read Sequence:Homo  sapiens microfibrillar-associated protein 1 (MFAP1), mRNA.
  (2063 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 67.24	St. Dev: 6.32	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 107.000000  Q:3 to 20  R:1397 to 1418 Align Len (22) (63.64%) (72.73%)
  
     Query:    3' ACCAG-A-U-UGG-UCUCUC-UGG 5'
                    | | | : :|| |||||| |||
     Ref:      5' CAG-CTTGGGGCCAAGAGAGTGCC 3'
  
     Z-Score: 6.291
     Energy:  -18.629999 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	107.00	-18.63	6.29	3 20	1397 1418	22	63.64%	72.73%
  
  
     Forward:	Score: 103.000000  Q:1 to 18  R:639 to 662 Align Len (23) (65.22%) (69.57%)
  
     Query:    3' AC-CAG-A-UU-G-GU-CUCUCUGG 5'
                  || |||   :| | || ||||||  
     Ref:      5' TGCGTCAGCGAGCACAGGAGAGAAA 3'
  
     Z-Score: 5.658
     Energy:  -14.890000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	103.00	-14.89	5.66	1 18	639 662	23	65.22%	69.57%
  
  
     Forward:	Score: 102.000000  Q:2 to 20  R:728 to 751 Align Len (23) (69.57%) (73.91%)
  
     Query:    3' AC-CAGAUUGGU-C-UCUC-UG-G 5'
                   | ||||:| || | |||| || |
     Ref:      5' AGAGTCTGAGTATGAAGAGTACAC 3'
  
     Z-Score: 5.500
     Energy:  -14.930000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	102.00	-14.93	5.50	2 20	728 751	23	69.57%	73.91%
  
  
     Forward:	Score: 102.000000  Q:2 to 20  R:701 to 721 Align Len (21) (76.19%) (76.19%)
  
     Query:    3' ACCAG-AUUGGUCUCU-CU-GG 5'
                   |||| |  ||||||| || ||
     Ref:      5' GGGTCGT-TCTGGAGAGGAGTC 3'
  
     Z-Score: 5.500
     Energy:  -21.299999 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	102.00	-21.30	5.50	2 20	701 721	21	76.19%	76.19%
  
  
     Forward:	Score: 101.000000  Q:2 to 20  R:1266 to 1287 Align Len (22) (72.73%) (72.73%)
  
     Query:    3' AC-C-A-GAUUGG-UCUCUCUGG 5'
                   | | | ||| || |||| ||||
     Ref:      5' AGCGCTCCTACCCTGGAG-GATC 3'
  
     Z-Score: 5.342
     Energy:  -14.290000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	101.00	-14.29	5.34	2 20	1266 1287	22	72.73%	72.73%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	515.00	-84.04	107.00	-21.30	16	19	2063	 1396 638 727 700 1265
  Complete
  
  Read Sequence:Homo  sapiens lectin, galactoside-binding, soluble, 1 (galectin 1)
  (586 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 64.51	St. Dev: 6.68	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 116.000000  Q:1 to 20  R:126 to 150 Align Len (24) (75.00%) (75.00%)
  
     Query:    3' AC-CAGA-U-UGG-UCUCUC-UGG 5'
                  ||  ||| | ||| |||||| |||
     Ref:      5' TGAATCTCAAACCTGGAGAGTGCC 3'
  
     Z-Score: 7.705
     Energy:  -18.370001 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	116.00	-18.37	7.71	1 20	126 150	24	75.00%	75.00%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	116.00	-18.37	116.00	-18.37	17	19	586	 125
  Complete
  
  Read Sequence:Homo  sapiens excision repair cross-complementing rodent repair
  (1273 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 66.98	St. Dev: 6.40	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 105.000000  Q:1 to 20  R:841 to 862 Align Len (22) (72.73%) (72.73%)
  
     Query:    3' ACCAGAUU-GGUCUC-U-CUGG 5'
                  |||   || |||||| | ||||
     Ref:      5' TGG-AGAAGCTAGAGCAGGACT 3'
  
     Z-Score: 5.944
     Energy:  -16.200001 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	105.00	-16.20	5.94	1 20	841 862	22	72.73%	72.73%
  
  
     Forward:	Score: 103.000000  Q:1 to 20  R:560 to 579 Align Len (21) (66.67%) (76.19%)
  
     Query:    3' ACCA-GA-UUGGUCUCUCUGG 5'
                  | || || ::||||||  |||
     Ref:      5' T-GTGCTGGGCCAGAG-CACC 3'
  
     Z-Score: 5.632
     Energy:  -17.400000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	103.00	-17.40	5.63	1 20	560 579	21	66.67%	76.19%
  
  
     Forward:	Score: 103.000000  Q:2 to 20  R:411 to 433 Align Len (23) (60.87%) (69.57%)
  
     Query:    3' AC-C-A-GAUUGGU-CUCUCUG-G 5'
                   | |   ||:: || ||||||| |
     Ref:      5' AGAGCCCCTGG-CAGGAGAGACGC 3'
  
     Z-Score: 5.632
     Energy:  -19.260000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	103.00	-19.26	5.63	2 20	411 433	23	60.87%	69.57%
  
  
     Forward:	Score: 100.000000  Q:2 to 20  R:163 to 178 Align Len (19) (73.68%) (73.68%)
  
     Query:    3' ACCAGAUUGGUCU-CUCUGG 5'
                   || ||  ||||| | ||||
     Ref:      5' AGG-CT--CCAGATG-GACC 3'
  
     Z-Score: 5.163
     Energy:  -18.299999 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	100.00	-18.30	5.16	2 20	163 178	19	73.68%	73.68%
  
  
     Forward:	Score: 99.000000  Q:1 to 20  R:785 to 804 Align Len (20) (70.00%) (75.00%)
  
     Query:    3' ACCAGAU-UGGUCUCUCUGG 5'
                  ||| | : ||| | ||||||
     Ref:      5' TGGGCGGTACCTG-GAGACC 3'
  
     Z-Score: 5.006
     Energy:  -19.080000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	99.00	-19.08	5.01	1 20	785 804	20	70.00%	75.00%
  
  
     Forward:	Score: 99.000000  Q:1 to 20  R:815 to 835 Align Len (22) (68.18%) (68.18%)
  
     Query:    3' AC-CAG-A-UUGGUCUCUCUGG 5'
                  || | |   |||||| | ||||
     Ref:      5' TGAG-CAGAAACCAGCG-GACC 3'
  
     Z-Score: 5.006
     Energy:  -16.170000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	99.00	-16.17	5.01	1 20	815 835	22	68.18%	68.18%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	609.00	-106.41	105.00	-19.26	18	19	1273	 840 559 410 162 784 814
  Complete
  
  Read Sequence:Homo  sapiens surfeit 1 (SURF1), nuclear gene encoding mitochondrial
  (1037 nt)
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Generating Alignment Distribution of Shuffled Sequences
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  done	Average: 66.97	St. Dev: 6.32	Max: 87.00
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  Performing Scan: TAR vs Homo
  =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
  
     Forward:	Score: 107.000000  Q:4 to 20  R:492 to 513 Align Len (21) (76.19%) (76.19%)
  
     Query:    3' ACCA-GA-UUG-GUCUC-U-CUGG 5'
                     | || ||| ||||| | ||||
     Ref:      5' TCCTCCTCAACTCAGAGTGGGGCC 3'
  
     Z-Score: 6.332
     Energy:  -17.270000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	107.00	-17.27	6.33	4 20	492 513	21	76.19%	76.19%
  
  
     Forward:	Score: 101.000000  Q:1 to 20  R:451 to 471 Align Len (21) (71.43%) (76.19%)
  
     Query:    3' ACC-A-GAUUGGUCUCUCUGG 5'
                  |||   ||: || ||||||||
     Ref:      5' TGGACCCTGTCC-GGGAGGCC 3'
  
     Z-Score: 5.383
     Energy:  -21.920000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	101.00	-21.92	5.38	1 20	451 471	21	71.43%	76.19%
  
  
     Forward:	Score: 101.000000  Q:1 to 20  R:376 to 399 Align Len (23) (69.57%) (73.91%)
  
     Query:    3' A-C-CAGAU-UGGUCUC-UCUGG 5'
                  | | || || :|||| | |||||
     Ref:      5' TGGAGTATAGGCCAGTGAAGGTC 3'
  
     Z-Score: 5.383
     Energy:  -14.290000 kCal/Mol
  
  Scores for this hit:
  >TAR	Homo	101.00	-14.29	5.38	1 20	376 399	23	69.57%	73.91%
  
  Score for this Scan:
  Seq1,Seq2,Tot Score,Tot Energy,Max Score,Max Energy,Strand,Len1,Len2,Positions
  >>TAR	Homo	309.00	-53.48	107.00	-21.92	19	19	1037	 491 450 375
  Complete
  
  Run Complete