# CleaveLand4 4.5 # Fri Mar 22 21:09:12 CST 2024 # Degradome Density File: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt # Query Alignment file: miRNA.fa_GSTAr.txt # Transcriptome: /public/home/zhenglw/work/sRNA_database/Sbicolor_313_v3.1.cds.fa # P-value cutoff: 1 # Category cutoff: 4 # Output Format: Pretty --------------------------------------------------- 5' UAGGGCCUUCAAGCACUUCU 3' Transcript: Sobic.001G002000.1:2609-2628 Slice Site:2619 || ||oo|||o|||||| 3' CUCAAGGGGGUUUGUGAAGU 5' Query: miR395e-Known-5p-mature SiteID: Sobic.001G002000.1:2619 MFE of perfect match: -36.50 MFE of this site: -24.30 MFEratio: 0.665753424657534 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-15,2627-2614 18-19,2611-2610 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,2628-2628 UP5: Unpaired region at 5' of query 16-17,2613-2612 SIL: Symmetric internal loop 20-20,2609-2609 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.698293767528969 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR395e-Known-5p-mature_Sobic.001G002000.1_2619_TPlot.pdf Position Reads Category 23 1 4 72 1 4 448 1 4 703 1 4 704 1 4 709 1 4 736 1 4 737 1 4 803 1 4 1026 1 4 1063 1 4 1078 1 4 1086 1 4 1173 1 4 1308 1 4 1593 1 4 1630 1 4 1644 1 4 1647 1 4 1866 1 4 1904 1 4 2002 1 4 2340 1 4 2619 1 4 <<<<<<<<<< 2684 1 4 2779 1 4 2917 1 4 3027 1 4 3138 1 4 3139 1 4 3145 2 0 3146 1 4 3148 1 4 3150 1 4 3156 1 4 3201 1 4 3242 1 4 3244 1 4 3245 1 4 3271 1 4 3281 1 4 3288 1 4 3290 1 4 3297 1 4 3300 1 4 3303 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGUG-AAUUGUCACAGCAUAUC 3' Transcript: Sobic.001G083900.1:2431-2451 Slice Site:2442 |||| ||o||||||||||| 3' UCACUUUGACAGUGUCGUACUA 5' Query: miR167b-Known-3p-star SiteID: Sobic.001G083900.1:2442 MFE of perfect match: -37.20 MFE of this site: -26.00 MFEratio: 0.698924731182796 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 4-17,2448-2435 19-22,2434-2431 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,2451-2449 UP5: Unpaired region at 5' of query 18-18,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.242128919686887 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167b-Known-3p-star_Sobic.001G083900.1_2442_TPlot.pdf Position Reads Category 406 1 4 1210 1 4 1230 1 4 1365 1 4 1567 1 4 1572 1 4 1576 1 4 1577 1 4 1578 1 4 1654 1 4 1749 1 4 1750 1 4 1751 1 4 1947 1 4 2318 2 0 2320 1 4 2437 1 4 2442 1 4 <<<<<<<<<< 2444 1 4 2509 1 4 2526 1 4 2720 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGUCUCUACAGUCAUGACCU 3' Transcript: Sobic.001G089100.4:793-814 Slice Site:804 |o|| |||||| |||||||| 3' CUACUUUGAUGUC-GUACUGGA 5' Query: miR167j-Known-3p-star SiteID: Sobic.001G089100.4:804 MFE of perfect match: -35.90 MFE of this site: -25.48 MFEratio: 0.70974930362117 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,814-807 9-14,805-800 18-21,796-793 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,806-806 BULt: Bulge on transcript side 15-17,799-797 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.553842043677503 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167j-Known-3p-star_Sobic.001G089100.4_804_TPlot.pdf Position Reads Category 10 1 4 143 1 4 416 1 4 434 1 4 439 1 4 444 1 4 455 1 4 465 1 4 669 1 4 673 1 4 680 1 4 682 2 0 702 1 4 787 1 4 798 1 4 804 1 4 <<<<<<<<<< 805 1 4 822 1 4 843 1 4 890 1 4 961 1 4 1042 1 4 1322 1 4 1334 1 4 1400 1 4 1569 1 4 1578 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGAGCGAGGUUGAUACGGAUG 3' Transcript: Sobic.001G094400.1:153-175 Slice Site:165 ||||||| |o||oo|||| ||| 3' CUACUCGGUUCAGUUAUGG-UAC 5' Query: miR171e-Known-5p-star SiteID: Sobic.001G094400.1:165 MFE of perfect match: -38.60 MFE of this site: -26.10 MFEratio: 0.676165803108808 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,175-173 5-14,170-161 16-22,159-153 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,172-171 AILt: Asymmetric internal loop with more nts on the transcript side 15-15,160-160 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.366128511453439 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171e-Known-5p-star_Sobic.001G094400.1_165_TPlot.pdf Position Reads Category 144 1 4 165 1 4 <<<<<<<<<< 207 1 4 368 1 4 418 1 4 421 2 0 422 1 4 424 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGAUAUAACCGAGGGAGAGG 3' Transcript: Sobic.001G099800.1:712-734 Slice Site:724 ||||o o| |||||| |||||| 3' CCACUAGUUUUGGCU-CCUCUCA 5' Query: miR156i-Probable-3p-star SiteID: Sobic.001G099800.1:724 MFE of perfect match: -40.60 MFE of this site: -26.80 MFEratio: 0.660098522167488 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,733-728 8-13,726-721 15-16,719-718 18-22,716-712 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,734-734 UP5: Unpaired region at 5' of query x-x,727-727 BULt: Bulge on transcript side 14-14,720-720 SIL: Symmetric internal loop 17-17,717-717 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.837063508798076 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156i-Probable-3p-star_Sobic.001G099800.1_724_TPlot.pdf Position Reads Category 84 1 4 497 1 4 500 1 4 613 1 4 619 3 2 621 1 4 622 8 0 623 4 2 624 1 4 625 1 4 627 1 4 629 1 4 644 1 4 648 1 4 682 1 4 703 1 4 721 1 4 724 1 4 <<<<<<<<<< 726 1 4 728 1 4 747 1 4 869 1 4 877 1 4 892 1 4 939 1 4 945 1 4 981 1 4 985 1 4 987 2 2 989 1 4 994 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGUGACGUGGAGUAGUAACGCCAA 3' Transcript: Sobic.001G099900.2:300-323 Slice Site:313 |o|| |||||||o|o| |||| 3' GUAC-GCACCUCGUUAA-GCGGCU 5' Query: miR5564c-Probable-3p-star SiteID: Sobic.001G099900.2:313 MFE of perfect match: -43.30 MFE of this site: -29.10 MFEratio: 0.672055427251732 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-6,321-318 8-18,315-305 19-22,303-300 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,323-322 UP5: Unpaired region at 5' of query 7-7,317-316 AILt: Asymmetric internal loop with more nts on the transcript side x-x,304-304 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.625689203128174 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564c-Probable-3p-star_Sobic.001G099900.2_313_TPlot.pdf Position Reads Category 106 1 4 313 1 4 <<<<<<<<<< 325 1 4 462 1 4 589 1 4 962 1 4 963 1 4 1104 2 2 1105 3 2 1106 5 2 1107 3 2 1108 6 0 1109 3 2 1304 1 4 1478 1 4 1642 1 4 1781 1 4 1819 1 4 1998 1 4 2025 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCGGCAAG-GGCAGGCGGAGG 3' Transcript: Sobic.001G144900.1:1162-1182 Slice Site:1173 || ||| |||||||o ||| 3' UUACC-UUCUCCGUCCGUGUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.001G144900.1:1173 MFE of perfect match: -42.10 MFE of this site: -28.00 MFEratio: 0.665083135391924 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,1182-1180 5-12,1178-1171 14-16,1170-1168 17-18,1166-1165 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,1179-1179 SIL: Symmetric internal loop 13-13,x-x BULq: Bulge on query side x-x,1167-1167 BULt: Bulge on transcript side 19-21,1164-1162 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999986870150358 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR528-Known-3p-star_Sobic.001G144900.1_1173_TPlot.pdf Position Reads Category 509 1 4 1165 1 4 1170 1 4 1173 1 4 <<<<<<<<<< 1184 1 4 1363 1 4 1430 1 4 1431 1 4 1556 1 4 1558 1 4 1565 1 4 1569 1 4 1577 1 4 1600 1 4 1616 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAGGAGGAGGAGGAACGCGAG 3' Transcript: Sobic.001G144900.1:1605-1626 Slice Site:1616 |o ||||o|||| ||||o|| 3' CUACCUCUUCCU-CUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.001G144900.1:1616 MFE of perfect match: -39.00 MFE of this site: -27.40 MFEratio: 0.702564102564103 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 3-9,1624-1618 10-18,1616-1608 20-21,1606-1605 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1626-1625 UP5: Unpaired region at 5' of query x-x,1617-1617 BULt: Bulge on transcript side 19-19,1607-1607 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.964753415134721 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164a-Known-3p-star_Sobic.001G144900.1_1616_TPlot.pdf Position Reads Category 509 1 4 1165 1 4 1170 1 4 1173 1 4 1184 1 4 1363 1 4 1430 1 4 1431 1 4 1556 1 4 1558 1 4 1565 1 4 1569 1 4 1577 1 4 1600 1 4 1616 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGGGGGCGACCACAAGAAGGACGACGAGCACA 3' Transcript: Sobic.001G149500.1:42-73 Slice Site:53 |||||||||| || ||o|||| 3' GCCCCCGCUGGA----------CU-CUUGUGU 5' Query: miR398-Known-3p-mature SiteID: Sobic.001G149500.1:53 MFE of perfect match: -45.30 MFE of this site: -29.62 MFEratio: 0.653863134657837 Allen et al. score: 26 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,73-67 8-9,65-64 11-20,52-43 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,66-66 BULt: Bulge on transcript side 10-10,63-53 AILt: Asymmetric internal loop with more nts on the transcript side 21-21,42-42 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.147639564320707 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR398-Known-3p-mature_Sobic.001G149500.1_53_TPlot.pdf Position Reads Category 5 1 4 11 1 4 24 1 4 25 1 4 26 1 4 30 1 4 31 1 4 32 1 4 33 1 4 35 4 3 36 1 4 37 5 3 38 9 3 39 8 3 40 13 2 41 5 3 42 6 3 43 3 3 44 9 3 45 12 2 46 4 3 47 7 3 48 7 3 49 9 3 50 9 3 51 8 3 52 31 2 53 66 2 <<<<<<<<<< 54 35 2 55 69 2 56 36 2 57 47 2 58 88 0 59 25 2 60 9 3 61 6 3 62 4 3 63 4 3 64 12 2 65 7 3 66 6 3 67 7 3 68 2 3 69 1 4 70 3 3 71 12 2 72 8 3 73 17 2 74 14 2 75 12 2 76 15 2 77 15 2 78 9 3 79 16 2 80 6 3 81 3 3 82 4 3 83 5 3 84 4 3 85 4 3 86 18 2 87 4 3 88 19 2 89 13 2 90 22 2 91 27 2 92 17 2 93 11 3 94 7 3 95 5 3 96 10 3 97 20 2 98 16 2 99 13 2 100 21 2 101 18 2 102 18 2 103 11 3 104 30 2 105 7 3 106 19 2 107 46 2 108 28 2 109 45 2 110 23 2 111 22 2 112 25 2 113 6 3 114 4 3 118 2 3 125 2 3 127 2 3 128 2 3 129 1 4 130 2 3 136 2 3 157 3 3 158 1 4 159 2 3 160 4 3 161 1 4 162 1 4 163 2 3 164 5 3 165 2 3 166 2 3 167 2 3 168 1 4 169 7 3 170 1 4 171 3 3 173 9 3 174 6 3 175 5 3 176 4 3 178 2 3 179 3 3 180 2 3 181 6 3 182 9 3 183 8 3 184 3 3 185 3 3 186 5 3 187 8 3 188 7 3 190 16 2 191 5 3 192 15 2 193 6 3 194 25 2 195 14 2 196 52 2 197 18 2 198 15 2 199 9 3 200 7 3 201 6 3 202 23 2 203 19 2 204 14 2 205 14 2 206 10 3 207 5 3 208 22 2 209 31 2 210 19 2 211 35 2 212 27 2 213 23 2 214 41 2 215 27 2 216 19 2 217 18 2 218 19 2 219 23 2 220 17 2 221 8 3 222 6 3 223 3 3 224 1 4 226 3 3 227 1 4 229 3 3 230 3 3 232 1 4 234 1 4 235 1 4 245 1 4 247 1 4 251 1 4 255 1 4 256 1 4 268 1 4 269 1 4 --------------------------------------------------- --------------------------------------------------- 5' UUUGGAGGAGGUGGUGGAAGCAGCAGG 3' Transcript: Sobic.001G154100.1:307-333 Slice Site:318 ||||o||||oo| ||| |||| 3' UUACCUUCUCCGUC-----CGU-GUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.001G154100.1:318 MFE of perfect match: -42.10 MFE of this site: -27.60 MFEratio: 0.655581947743468 Allen et al. score: 16.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,333-330 5-7,328-326 8-19,320-309 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,329-329 BULt: Bulge on transcript side x-x,325-321 BULt: Bulge on transcript side 20-21,308-307 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999166506434 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR528-Known-3p-star_Sobic.001G154100.1_318_TPlot.pdf Position Reads Category 11 1 4 116 1 4 165 1 4 167 1 4 170 1 4 173 2 3 176 1 4 181 2 3 182 1 4 189 1 4 190 1 4 197 2 3 199 1 4 200 1 4 201 1 4 202 2 3 204 1 4 205 2 3 206 2 3 207 3 2 208 1 4 209 1 4 215 1 4 218 1 4 224 1 4 275 1 4 280 1 4 281 1 4 285 1 4 286 1 4 288 3 2 289 1 4 290 2 3 291 20 2 292 6 2 293 12 2 294 32 0 295 20 2 296 20 2 297 6 2 298 3 2 299 2 3 301 1 4 302 2 3 303 3 2 305 3 2 306 8 2 307 11 2 308 10 2 309 1 4 310 1 4 311 2 3 312 6 2 313 2 3 314 2 3 315 2 3 316 2 3 317 1 4 318 1 4 <<<<<<<<<< 319 1 4 324 2 3 328 1 4 329 2 3 330 1 4 331 1 4 333 1 4 334 1 4 348 1 4 372 1 4 374 1 4 434 1 4 486 1 4 496 1 4 519 1 4 523 1 4 529 1 4 537 1 4 547 1 4 569 1 4 573 1 4 575 2 3 577 1 4 578 1 4 579 2 3 583 1 4 596 1 4 597 1 4 603 1 4 604 1 4 610 2 3 623 1 4 624 1 4 626 1 4 643 1 4 645 1 4 646 1 4 654 3 2 655 2 3 656 1 4 658 2 3 665 1 4 670 1 4 673 1 4 678 1 4 696 1 4 760 1 4 794 1 4 867 1 4 874 1 4 904 1 4 908 4 2 909 1 4 914 2 3 915 2 3 917 2 3 919 2 3 920 4 2 921 1 4 922 1 4 923 3 2 924 6 2 926 1 4 927 4 2 928 5 2 929 4 2 931 1 4 932 9 2 933 1 4 936 1 4 937 8 2 938 4 2 939 4 2 940 4 2 941 10 2 942 1 4 943 4 2 950 1 4 955 1 4 1003 1 4 1009 1 4 1012 1 4 1020 1 4 1054 1 4 1074 1 4 1080 3 2 1082 2 3 1083 1 4 1084 1 4 1085 1 4 1086 2 3 1087 2 3 1088 2 3 1089 2 3 1091 1 4 1092 1 4 1093 1 4 1094 1 4 1095 3 2 1096 4 2 1097 2 3 1111 1 4 1112 1 4 1113 3 2 1114 1 4 1116 1 4 1118 1 4 1119 1 4 1120 1 4 1121 1 4 1123 1 4 1126 4 2 1127 1 4 1132 4 2 1133 2 3 1134 3 2 1135 6 2 1136 1 4 1137 2 3 1138 1 4 1139 3 2 1141 2 3 1144 1 4 1147 1 4 1150 2 3 1152 1 4 1153 1 4 1206 1 4 1208 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGACCUCAGGGUGGC-GGCG 3' Transcript: Sobic.001G193500.1:1977-1996 Slice Site:1988 |||| ||||||o|o| o||| 3' ACCUCGAGUCCUAUCUAUCGC 5' Query: miR390-Known-3p-star SiteID: Sobic.001G193500.1:1988 MFE of perfect match: -40.30 MFE of this site: -26.70 MFEratio: 0.662531017369727 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,1996-1993 7-16,1991-1982 18-21,1980-1977 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-6,1992-1992 AILq: Asymmetric internal loop with more nts on the query side 17-17,1981-1981 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.824560948661456 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR390-Known-3p-star_Sobic.001G193500.1_1988_TPlot.pdf Position Reads Category 83 1 4 84 1 4 99 2 1 100 2 1 143 2 1 162 1 4 183 2 1 190 1 4 192 1 4 194 1 4 228 1 4 288 1 4 296 1 4 374 1 4 378 1 4 654 1 4 687 1 4 758 1 4 759 1 4 763 1 4 798 1 4 845 2 1 852 1 4 978 1 4 1049 1 4 1057 1 4 1060 1 4 1066 2 1 1069 2 1 1070 2 1 1074 1 4 1125 1 4 1126 1 4 1133 1 4 1382 1 4 1567 1 4 1931 1 4 1980 1 4 1983 2 1 1988 1 4 <<<<<<<<<< 1989 1 4 1995 1 4 --------------------------------------------------- --------------------------------------------------- 5' UCUGCCGAGAAAGAGGGUGACAGCAA 3' Transcript: Sobic.001G280400.1:580-605 Slice Site:591 o|||||o||||||||o ||| 3' GGACGGUUCUUUCUCU-----UCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.001G280400.1:591 MFE of perfect match: -41.40 MFE of this site: -27.40 MFEratio: 0.66183574879227 Allen et al. score: 15 Paired Regions (query5'-query3',transcript3'-transcript5') 3-5,603-601 6-21,595-580 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,605-604 UP5: Unpaired region at 5' of query x-x,600-596 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998081914059972 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.001G280400.1_591_TPlot.pdf Position Reads Category 426 1 4 435 1 4 588 1 4 591 1 4 <<<<<<<<<< 619 1 4 624 1 4 736 1 4 738 1 4 745 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGUUCCUGCAAAUGCCUUCU 3' Transcript: Sobic.001G282500.1:117-137 Slice Site:127 |||||||o ||||oo |||| 3' CUCAAGGGGGUUUGU-GAAGU 5' Query: miR395a-Known-5p-mature SiteID: Sobic.001G282500.1:127 MFE of perfect match: -36.50 MFE of this site: -23.80 MFEratio: 0.652054794520548 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,136-133 6-11,131-126 13-20,124-117 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,137-137 UP5: Unpaired region at 5' of query x-x,132-132 BULt: Bulge on transcript side 12-12,125-125 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.811099033080168 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR395a-Known-5p-mature_Sobic.001G282500.1_127_TPlot.pdf Position Reads Category 127 1 4 <<<<<<<<<< 159 1 4 162 1 4 163 1 4 168 1 4 170 1 4 172 2 0 201 1 4 211 1 4 214 1 4 219 1 4 240 1 4 --------------------------------------------------- --------------------------------------------------- 5' CACGAGGAGAGCCAUGUCAGCA 3' Transcript: Sobic.001G282700.1:2311-2332 Slice Site:2323 || ||o|||||o||o|| 3' AAACUAA-CUUGGUACGGUUGU 5' Query: miR171a-Probable-5p-star SiteID: Sobic.001G282700.1:2323 MFE of perfect match: -33.50 MFE of this site: -23.30 MFEratio: 0.695522388059702 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-14,2332-2319 17-18,2315-2314 Unpaired Regions (query5'-query3',transcript3'-transcript5') 15-16,2318-2316 AILt: Asymmetric internal loop with more nts on the transcript side 19-21,2313-2311 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.422081856199092 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171a-Probable-5p-star_Sobic.001G282700.1_2323_TPlot.pdf Position Reads Category 267 1 4 819 1 4 1003 1 4 1406 1 4 2190 1 4 2323 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CUUGAUUGCUAUGAACCAUGCUGACU 3' Transcript: Sobic.001G344500.1:1413-1438 Slice Site:1429 ||||| ||||||||||oo|| 3' AAACUA-----ACUUGGUACGGUUGU 5' Query: miR171a-Probable-5p-star SiteID: Sobic.001G344500.1:1429 MFE of perfect match: -33.50 MFE of this site: -24.00 MFEratio: 0.716417910447761 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 2-15,1437-1424 16-20,1418-1414 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1438-1438 UP5: Unpaired region at 5' of query x-x,1423-1419 BULt: Bulge on transcript side 21-21,1413-1413 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.246783758861502 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171a-Probable-5p-star_Sobic.001G344500.1_1429_TPlot.pdf Position Reads Category 92 1 4 295 1 4 347 1 4 358 1 4 436 1 4 439 1 4 441 1 4 446 1 4 447 1 4 560 1 4 561 1 4 572 1 4 575 1 4 703 1 4 824 1 4 876 1 4 933 1 4 1064 1 4 1065 1 4 1067 1 4 1103 1 4 1131 1 4 1132 2 1 1141 1 4 1142 1 4 1153 1 4 1219 1 4 1237 1 4 1301 1 4 1328 1 4 1337 1 4 1338 2 1 1340 1 4 1343 2 1 1403 1 4 1429 1 4 <<<<<<<<<< 1604 1 4 1678 2 1 1689 1 4 1855 1 4 1862 1 4 1971 1 4 2190 1 4 2243 1 4 2264 1 4 2272 1 4 2277 1 4 --------------------------------------------------- --------------------------------------------------- 5' UCUGCCUUUAUCAGAAGAGGAGGUGGCUGCC 3' Transcript: Sobic.001G354600.1:2133-2163 Slice Site:2152 ||||| ||||||| o|||||| 3' GGACGG---------UCUCCUC--UCGACGG 5' Query: miR399b-Probable-5p-star SiteID: Sobic.001G354600.1:2152 MFE of perfect match: -45.40 MFE of this site: -31.10 MFEratio: 0.685022026431718 Allen et al. score: 15 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,2163-2157 8-14,2154-2148 15-19,2138-2134 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,2156-2155 BULt: Bulge on transcript side x-x,2147-2139 BULt: Bulge on transcript side 20-20,2133-2133 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 0 Degradome p-value: 0.052801514004426 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399b-Probable-5p-star_Sobic.001G354600.1_2152_TPlot.pdf Position Reads Category 95 1 4 163 1 4 451 1 4 942 1 4 957 1 4 2148 1 4 2152 2 0 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UCUGCCUUUAUCAGAAGAGGAGGUGGCUGCC 3' Transcript: Sobic.001G354600.2:2133-2163 Slice Site:2152 ||||| ||||||| o|||||| 3' GGACGG---------UCUCCUC--UCGACGG 5' Query: miR399b-Probable-5p-star SiteID: Sobic.001G354600.2:2152 MFE of perfect match: -45.40 MFE of this site: -31.10 MFEratio: 0.685022026431718 Allen et al. score: 15 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,2163-2157 8-14,2154-2148 15-19,2138-2134 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,2156-2155 BULt: Bulge on transcript side x-x,2147-2139 BULt: Bulge on transcript side 20-20,2133-2133 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.911189170493154 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399b-Probable-5p-star_Sobic.001G354600.2_2152_TPlot.pdf Position Reads Category 578 1 4 1364 1 4 2143 1 4 2147 1 4 2152 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CUUGAGGCUACAAGUCUUGCGUGAA 3' Transcript: Sobic.001G380600.1:2157-2181 Slice Site:2172 ||||||| ||| |||o||| 3' UUACUCCGA----CAGUACGUACUA 5' Query: miR167i-Known-3p-star SiteID: Sobic.001G380600.1:2172 MFE of perfect match: -36.50 MFE of this site: -24.40 MFEratio: 0.668493150684931 Allen et al. score: 14 Paired Regions (query5'-query3',transcript3'-transcript5') 2-8,2180-2174 10-12,2172-2170 13-19,2165-2159 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,2181-2181 UP5: Unpaired region at 5' of query 9-9,2173-2173 SIL: Symmetric internal loop x-x,2169-2166 BULt: Bulge on transcript side 20-21,2158-2157 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.609193328569064 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167i-Known-3p-star_Sobic.001G380600.1_2172_TPlot.pdf Position Reads Category 183 1 4 185 1 4 257 1 4 753 1 4 757 1 4 1060 1 4 1133 1 4 1279 1 4 1776 1 4 2172 1 4 <<<<<<<<<< 2598 1 4 2603 1 4 2885 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCGCGGCCGGGUCGAAGCCGUG 3' Transcript: Sobic.001G391300.1:797-818 Slice Site:809 o|||oo|||o| o||o|| 3' CUACUCGGUUCAGUUAUGGUAC 5' Query: miR171e-Known-5p-star SiteID: Sobic.001G391300.1:809 MFE of perfect match: -38.60 MFE of this site: -26.30 MFEratio: 0.681347150259067 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,818-813 8-18,811-801 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,812-812 SIL: Symmetric internal loop 19-22,800-797 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.296138153578233 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171e-Known-5p-star_Sobic.001G391300.1_809_TPlot.pdf Position Reads Category 98 1 4 107 1 4 108 1 4 331 1 4 332 1 4 333 1 4 335 1 4 336 1 4 337 1 4 345 1 4 346 1 4 349 1 4 350 1 4 385 1 4 389 1 4 396 1 4 404 1 4 405 1 4 410 1 4 422 1 4 431 2 2 440 1 4 442 1 4 452 1 4 562 1 4 580 1 4 634 1 4 727 1 4 737 1 4 757 1 4 778 1 4 809 1 4 <<<<<<<<<< 810 1 4 814 1 4 815 2 2 826 1 4 835 1 4 840 2 2 841 4 2 842 6 2 843 3 2 844 21 0 845 2 2 846 2 2 847 2 2 848 1 4 850 1 4 851 2 2 852 1 4 854 1 4 860 1 4 862 2 2 866 1 4 884 1 4 891 1 4 1023 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGCCAGCGGUGGAGCUGGAGGCAGUGGA 3' Transcript: Sobic.001G393200.1:26-53 Slice Site:44 ||||| ||| o||||||||| | 3' UCGGUC----CCU---UCUCCGUCACGU 5' Query: miR408-Known-3p-mature SiteID: Sobic.001G393200.1:44 MFE of perfect match: -45.10 MFE of this site: -29.60 MFEratio: 0.656319290465632 Allen et al. score: 14 Paired Regions (query5'-query3',transcript3'-transcript5') 1-1,53-53 3-12,51-42 13-15,38-36 16-20,31-27 Unpaired Regions (query5'-query3',transcript3'-transcript5') 2-2,52-52 SIL: Symmetric internal loop x-x,41-39 BULt: Bulge on transcript side x-x,35-32 BULt: Bulge on transcript side 21-21,26-26 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.99942308143588 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR408-Known-3p-mature_Sobic.001G393200.1_44_TPlot.pdf Position Reads Category 44 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGUGGUUACGGCGGAGGAGCAGG 3' Transcript: Sobic.001G394100.1:535-557 Slice Site:547 ||||o|o| oo| |||||| || 3' CCACUAGUUUUGGCUCCUC-UCA 5' Query: miR156i-Probable-3p-star SiteID: Sobic.001G394100.1:547 MFE of perfect match: -40.60 MFE of this site: -26.60 MFEratio: 0.655172413793103 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,556-555 4-9,553-548 11-13,546-544 15-22,542-535 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,557-557 UP5: Unpaired region at 5' of query x-x,554-554 BULt: Bulge on transcript side 10-10,547-547 SIL: Symmetric internal loop 14-14,543-543 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.882453846814082 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156i-Probable-3p-star_Sobic.001G394100.1_547_TPlot.pdf Position Reads Category 99 1 4 106 1 4 111 1 4 115 1 4 176 1 4 194 1 4 267 1 4 296 1 4 297 1 4 410 1 4 443 1 4 448 1 4 452 1 4 456 1 4 457 2 1 466 1 4 471 1 4 472 1 4 473 1 4 477 1 4 490 2 1 547 1 4 <<<<<<<<<< 636 1 4 642 1 4 643 1 4 650 1 4 655 1 4 658 1 4 659 1 4 660 1 4 661 1 4 665 1 4 672 1 4 683 1 4 685 1 4 686 1 4 734 1 4 735 1 4 790 1 4 812 1 4 817 1 4 847 2 1 851 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGAGGAGCUGGUGGGGGCACUG 3' Transcript: Sobic.001G394100.1:658-682 Slice Site:672 |||||||o|| o|||| o|| || 3' CCACCUCUUC---UACCCGUGU-AC 5' Query: miR164b-Known-3p-star SiteID: Sobic.001G394100.1:672 MFE of perfect match: -41.90 MFE of this site: -30.20 MFEratio: 0.720763723150358 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,682-681 3-5,679-677 7-11,675-671 12-21,667-658 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,680-680 BULt: Bulge on transcript side 6-6,676-676 SIL: Symmetric internal loop x-x,670-668 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.552465549998822 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164b-Known-3p-star_Sobic.001G394100.1_672_TPlot.pdf Position Reads Category 99 1 4 106 1 4 111 1 4 115 1 4 176 1 4 194 1 4 267 1 4 296 1 4 297 1 4 410 1 4 443 1 4 448 1 4 452 1 4 456 1 4 457 2 1 466 1 4 471 1 4 472 1 4 473 1 4 477 1 4 490 2 1 547 1 4 636 1 4 642 1 4 643 1 4 650 1 4 655 1 4 658 1 4 659 1 4 660 1 4 661 1 4 665 1 4 672 1 4 <<<<<<<<<< 683 1 4 685 1 4 686 1 4 734 1 4 735 1 4 790 1 4 812 1 4 817 1 4 847 2 1 851 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGGCGGCGGAGAGGAGGAAGU 3' Transcript: Sobic.001G415300.1:151-173 Slice Site:164 ||||o|o| o|||||o|| ||o 3' CGACUGUC-UCUCUCUUCACUCG 5' Query: miR156c-Known-5p-star SiteID: Sobic.001G415300.1:164 MFE of perfect match: -43.40 MFE of this site: -30.70 MFEratio: 0.707373271889401 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,173-171 6-14,168-160 15-22,158-151 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-5,170-169 SIL: Symmetric internal loop x-x,159-159 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.321681801059277 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156c-Known-5p-star_Sobic.001G415300.1_164_TPlot.pdf Position Reads Category 164 1 4 <<<<<<<<<< 539 1 4 906 1 4 1105 1 4 2225 1 4 2411 1 4 2615 1 4 2807 1 4 2904 1 4 3098 1 4 3099 1 4 3421 1 4 3530 1 4 3700 1 4 4110 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGAAGCUGCGGAUGCA-GACCG 3' Transcript: Sobic.001G441600.1:2148-2170 Slice Site:2159 ||||||o||o|o ||| |||| 3' CUACUUUGAUGU---CGUACUGGA 5' Query: miR167j-Known-3p-star SiteID: Sobic.001G441600.1:2159 MFE of perfect match: -35.90 MFE of this site: -25.30 MFEratio: 0.704735376044568 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,2169-2166 7-9,2165-2163 10-21,2159-2148 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,2170-2170 UP5: Unpaired region at 5' of query 6-6,x-x BULq: Bulge on query side x-x,2162-2160 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.580499918102522 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167j-Known-3p-star_Sobic.001G441600.1_2159_TPlot.pdf Position Reads Category 1182 1 4 1435 1 4 1449 1 4 1477 1 4 1478 1 4 1511 1 4 1663 1 4 1724 1 4 1995 1 4 2024 1 4 2159 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GCUCAUCAACCUUGGGCUCCC 3' Transcript: Sobic.001G524900.1:531-551 Slice Site:542 |||||||||| o|| o||| 3' CGAGUAGUUGCGACGUGAGUU 5' Query: miR397-Known-5p-mature SiteID: Sobic.001G524900.1:542 MFE of perfect match: -39.40 MFE of this site: -26.30 MFEratio: 0.66751269035533 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 3-6,549-546 8-10,544-542 12-21,540-531 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,551-550 UP5: Unpaired region at 5' of query 7-7,545-545 SIL: Symmetric internal loop 11-11,541-541 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.961578326908913 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR397-Known-5p-mature_Sobic.001G524900.1_542_TPlot.pdf Position Reads Category 542 1 4 <<<<<<<<<< 544 1 4 761 1 4 764 1 4 765 1 4 766 1 4 769 2 0 815 1 4 818 1 4 819 1 4 831 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGAGGCGGGGGAGGCGGAGG 3' Transcript: Sobic.001G541400.1:130-152 Slice Site:143 oo||||o| o|| ||||o ||| 3' UUACCUUC--UCCGUCCGUGUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.001G541400.1:143 MFE of perfect match: -42.10 MFE of this site: -29.20 MFEratio: 0.693586698337292 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,152-150 5-9,148-144 11-13,142-140 14-21,137-130 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,149-149 SIL: Symmetric internal loop 10-10,143-143 SIL: Symmetric internal loop x-x,139-138 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.995566387674075 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR528-Known-3p-star_Sobic.001G541400.1_143_TPlot.pdf Position Reads Category 143 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UGUUCGACGAGCUGCUUCCCC 3' Transcript: Sobic.002G059700.2:116-136 Slice Site:127 ||||||||||o |||||||| 3' ACAAGCUGCUUAACGAAGGGU 5' Query: miR5564a-Known-5p-mature SiteID: Sobic.002G059700.2:127 MFE of perfect match: -36.80 MFE of this site: -32.50 MFEratio: 0.883152173913044 Allen et al. score: 4 Paired Regions (query5'-query3',transcript3'-transcript5') 2-9,135-128 11-21,126-116 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,136-136 UP5: Unpaired region at 5' of query 10-10,127-127 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0273434101926404 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Known-5p-mature_Sobic.002G059700.2_127_TPlot.pdf Position Reads Category 127 1 4 <<<<<<<<<< 1476 1 4 1499 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGCGGCUGCCGC---GUGGC 3' Transcript: Sobic.002G075800.1:1923-1941 Slice Site:1935 o||| ||||||||| o||o| 3' UCACUCCGACGGCGUCGUACUG 5' Query: miR167a-Probable-3p-star SiteID: Sobic.002G075800.1:1935 MFE of perfect match: -47.20 MFE of this site: -30.90 MFEratio: 0.654661016949152 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,1941-1937 9-17,1936-1928 19-22,1926-1923 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-8,x-x BULq: Bulge on query side 18-18,1927-1927 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.971149182819717 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167a-Probable-3p-star_Sobic.002G075800.1_1935_TPlot.pdf Position Reads Category 1 1 4 187 1 4 188 1 4 191 1 4 193 1 4 194 1 4 195 2 2 196 2 2 197 2 2 198 3 2 200 2 2 202 3 2 203 5 2 204 2 2 205 3 2 206 2 2 215 1 4 218 1 4 230 1 4 340 1 4 376 1 4 404 1 4 410 1 4 419 1 4 422 8 2 434 1 4 519 1 4 535 1 4 537 1 4 572 1 4 580 1 4 620 1 4 700 1 4 721 1 4 740 2 2 768 1 4 769 1 4 774 1 4 777 1 4 778 2 2 779 2 2 781 1 4 782 2 2 786 1 4 787 1 4 788 1 4 796 2 2 798 1 4 805 1 4 827 1 4 843 1 4 847 1 4 851 1 4 871 1 4 876 1 4 885 1 4 886 1 4 887 1 4 889 1 4 891 1 4 903 1 4 905 1 4 906 1 4 908 1 4 917 1 4 1145 1 4 1156 1 4 1233 1 4 1249 1 4 1263 1 4 1264 3 2 1265 3 2 1268 3 2 1269 1 4 1270 1 4 1273 1 4 1283 2 2 1285 1 4 1303 1 4 1306 1 4 1314 1 4 1331 1 4 1349 1 4 1357 1 4 1358 1 4 1376 1 4 1380 1 4 1381 1 4 1383 1 4 1390 1 4 1392 1 4 1399 1 4 1410 1 4 1424 1 4 1435 1 4 1438 1 4 1504 1 4 1519 1 4 1555 1 4 1635 1 4 1637 1 4 1638 1 4 1642 4 2 1643 1 4 1652 1 4 1661 1 4 1664 1 4 1665 1 4 1667 4 2 1668 1 4 1669 3 2 1670 1 4 1671 6 2 1672 7 2 1673 1 4 1674 2 2 1675 8 2 1676 4 2 1677 9 0 1678 3 2 1691 1 4 1711 1 4 1713 1 4 1817 2 2 1935 1 4 <<<<<<<<<< 1936 1 4 1968 1 4 1984 1 4 1991 1 4 2018 1 4 2034 1 4 2052 1 4 2053 1 4 2079 1 4 2123 1 4 2153 1 4 2171 2 2 2179 1 4 2180 1 4 2225 1 4 2226 1 4 2227 3 2 2230 3 2 2231 1 4 2232 2 2 2233 1 4 2234 2 2 2236 3 2 2241 2 2 2242 2 2 2247 2 2 --------------------------------------------------- --------------------------------------------------- 5' GACUGGGUGCUGUGCCGGCUGU 3' Transcript: Sobic.002G080100.1:493-514 Slice Site:504 ||o|||| |o||||| || 3' UUAACUCACGUCGCGGCC-ACU 5' Query: miR397-Known-3p-star SiteID: Sobic.002G080100.1:504 MFE of perfect match: -41.20 MFE of this site: -26.90 MFEratio: 0.652912621359223 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,513-512 4-10,510-504 12-18,502-496 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,514-514 UP5: Unpaired region at 5' of query x-x,511-511 BULt: Bulge on transcript side 11-11,503-503 SIL: Symmetric internal loop 19-21,495-493 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.255633827363161 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR397-Known-3p-star_Sobic.002G080100.1_504_TPlot.pdf Position Reads Category 409 1 4 460 1 4 494 1 4 502 1 4 504 2 2 <<<<<<<<<< 505 1 4 506 1 4 520 6 0 522 1 4 525 2 2 526 1 4 533 1 4 640 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCGAGUGGGCUGGGCUUUGCA 3' Transcript: Sobic.002G081600.1:283-304 Slice Site:294 |||||o||o|o||o o|| 3' AGACUCACUCGGCUCGGU-UGU 5' Query: miR171d-Known-5p-star SiteID: Sobic.002G081600.1:294 MFE of perfect match: -42.40 MFE of this site: -27.70 MFEratio: 0.653301886792453 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,304-302 5-18,299-286 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,301-300 AILt: Asymmetric internal loop with more nts on the transcript side 19-21,285-283 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.757563291345481 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171d-Known-5p-star_Sobic.002G081600.1_294_TPlot.pdf Position Reads Category 19 1 4 82 1 4 91 1 4 100 1 4 284 1 4 285 1 4 286 1 4 294 1 4 <<<<<<<<<< 301 1 4 303 2 1 307 2 1 308 1 4 334 1 4 376 1 4 391 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAGUUCGAAGAUGGCUG-GGAA 3' Transcript: Sobic.002G090500.1:94-114 Slice Site:106 |||||| |||| o|||| |||| 3' UUCAAG-UUCUUUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.002G090500.1:106 MFE of perfect match: -33.40 MFE of this site: -22.80 MFEratio: 0.682634730538922 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,114-111 6-10,110-106 12-15,104-101 16-21,99-94 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,x-x BULq: Bulge on query side 11-11,105-105 SIL: Symmetric internal loop x-x,100-100 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.774145733861623 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-5p-mature_Sobic.002G090500.1_106_TPlot.pdf Position Reads Category 91 1 4 98 2 1 100 2 1 103 1 4 104 1 4 106 1 4 <<<<<<<<<< 112 1 4 127 1 4 132 1 4 145 1 4 147 1 4 157 1 4 173 1 4 179 1 4 242 1 4 245 1 4 247 1 4 257 1 4 355 1 4 378 1 4 703 1 4 755 1 4 759 1 4 761 1 4 763 1 4 766 1 4 770 2 1 771 2 1 772 1 4 848 1 4 856 1 4 859 1 4 860 1 4 862 1 4 976 1 4 1048 1 4 1061 1 4 1090 1 4 1096 1 4 1113 1 4 1116 1 4 1135 1 4 1137 1 4 1146 1 4 1150 1 4 1166 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGACAG-AGGAGAGG-GAGGG 3' Transcript: Sobic.002G133600.2:171-191 Slice Site:183 |||||||| |o||||o| ||| 3' CGACUGUCUUUCUCUUCGCUCGU 5' Query: miR156j-Known-3p-star SiteID: Sobic.002G133600.2:183 MFE of perfect match: -43.80 MFE of this site: -29.40 MFEratio: 0.671232876712329 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-5,189-187 7-14,186-179 16-23,178-171 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,191-190 UP5: Unpaired region at 5' of query 6-6,x-x BULq: Bulge on query side 15-15,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.835043407023012 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156j-Known-3p-star_Sobic.002G133600.2_183_TPlot.pdf Position Reads Category 183 1 4 <<<<<<<<<< 395 1 4 656 1 4 --------------------------------------------------- --------------------------------------------------- 5' UCAGGAGGAGGUAGGUGGUUUAGG 3' Transcript: Sobic.002G135000.1:316-339 Slice Site:327 |||o||||o|||oo o||| 3' UUACCUUCUCCGUCCGU---GUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.002G135000.1:327 MFE of perfect match: -42.10 MFE of this site: -27.40 MFEratio: 0.65083135391924 Allen et al. score: 13.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,339-336 5-18,332-319 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,335-333 BULt: Bulge on transcript side 19-21,318-316 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999857771033 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR528-Known-3p-star_Sobic.002G135000.1_327_TPlot.pdf Position Reads Category 327 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAUGGAGAGGAGGAGGAAGCGAA 3' Transcript: Sobic.002G162800.1:81-103 Slice Site:94 |||||||| |||||o| o|| 3' CUACCUCU--UCCUCUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.002G162800.1:94 MFE of perfect match: -39.00 MFE of this site: -25.70 MFEratio: 0.658974358974359 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 3-5,101-99 7-13,97-91 14-21,88-81 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,103-102 UP5: Unpaired region at 5' of query 6-6,98-98 SIL: Symmetric internal loop x-x,90-89 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999901553491577 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164a-Known-3p-star_Sobic.002G162800.1_94_TPlot.pdf Position Reads Category 57 1 4 61 1 4 78 1 4 85 1 4 94 1 4 <<<<<<<<<< 176 1 4 187 1 4 237 2 1 246 1 4 324 1 4 328 1 4 339 2 1 342 1 4 345 1 4 419 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCACCCGAGCCCCGGGGCGACGAUCA 3' Transcript: Sobic.002G218000.1:30-55 Slice Site:46 o| |||||||| o|o|o||o||| 3' UG-GGGCUCGG---UCUGUUGUUAGG 5' Query: miR166i-Known-5p-star SiteID: Sobic.002G218000.1:46 MFE of perfect match: -44.90 MFE of this site: -33.20 MFEratio: 0.739420935412027 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-12,54-44 13-20,40-33 21-22,31-30 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,55-55 UP5: Unpaired region at 5' of query x-x,43-41 BULt: Bulge on transcript side x-x,32-32 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.140103167674164 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166i-Known-5p-star_Sobic.002G218000.1_46_TPlot.pdf Position Reads Category 46 1 4 <<<<<<<<<< 47 2 1 48 2 1 475 1 4 482 1 4 551 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCCGUCGUCGUUGA-UGCCG 3' Transcript: Sobic.002G218300.1:184-202 Slice Site:194 |||||||o||o|o |||| 3' CGGCAGCGGCGAUCGACGGA 5' Query: miR167g-Probable-5p-star SiteID: Sobic.002G218300.1:194 MFE of perfect match: -45.90 MFE of this site: -31.20 MFEratio: 0.679738562091503 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,201-198 8-20,196-184 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,202-202 UP5: Unpaired region at 5' of query 6-7,197-197 AILq: Asymmetric internal loop with more nts on the query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999997827462605 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167g-Probable-5p-star_Sobic.002G218300.1_194_TPlot.pdf Position Reads Category 194 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GUGCUCUCUCUCUUCUGUCA 3' Transcript: Sobic.002G257900.2:989-1008 Slice Site:999 |||||||||||||||||||| 3' CACGAGAGAGAGAAGACAGU 5' Query: miR156b-Probable-5p-mature SiteID: Sobic.002G257900.2:999 MFE of perfect match: -37.40 MFE of this site: -38.80 MFEratio: 1 Allen et al. score: 0 Paired Regions (query5'-query3',transcript3'-transcript5') 1-20,1008-989 Unpaired Regions (query5'-query3',transcript3'-transcript5') NA Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00614199340168997 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156b-Probable-5p-mature_Sobic.002G257900.2_999_TPlot.pdf Position Reads Category 999 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAGUUCUUCCAAAC-CUUCG 3' Transcript: Sobic.002G278700.1:178-196 Slice Site:188 ||||||oo|||||| |||| 3' CUCAAGGGGGUUUGUGAAGU 5' Query: miR395e-Known-5p-mature SiteID: Sobic.002G278700.1:188 MFE of perfect match: -36.50 MFE of this site: -26.90 MFEratio: 0.736986301369863 Allen et al. score: 4 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,195-192 7-20,191-178 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,196-196 UP5: Unpaired region at 5' of query 6-6,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.168752746461689 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR395e-Known-5p-mature_Sobic.002G278700.1_188_TPlot.pdf Position Reads Category 27 1 4 47 1 4 71 1 4 77 1 4 98 1 4 186 1 4 188 1 4 <<<<<<<<<< 200 1 4 244 2 2 245 2 2 248 3 2 250 1 4 251 1 4 252 3 2 253 5 1 254 2 2 255 5 1 256 4 2 257 5 1 258 1 4 259 2 2 260 1 4 261 1 4 265 1 4 266 1 4 268 1 4 269 1 4 271 1 4 274 1 4 287 1 4 289 2 2 316 1 4 319 1 4 354 1 4 385 1 4 391 1 4 586 1 4 588 1 4 611 2 2 613 1 4 632 1 4 639 2 2 650 1 4 653 1 4 657 1 4 662 2 2 663 1 4 664 2 2 666 1 4 670 1 4 671 1 4 672 1 4 675 1 4 688 1 4 693 1 4 694 2 2 697 3 2 700 1 4 701 1 4 702 1 4 703 1 4 704 2 2 705 4 2 706 2 2 707 3 2 708 1 4 709 1 4 711 1 4 718 1 4 722 2 2 729 1 4 733 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAAGUCGGCGCAGAGGGUGCAGA 3' Transcript: Sobic.002G350400.2:907-932 Slice Site:923 ||o|||| o| |||||||o||| 3' CUUCUUC--UC---UCUCCCAUGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.002G350400.2:923 MFE of perfect match: -40.10 MFE of this site: -26.70 MFEratio: 0.665835411471322 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 2-12,931-921 13-14,917-916 15-21,913-907 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,932-932 UP5: Unpaired region at 5' of query x-x,920-918 BULt: Bulge on transcript side x-x,915-914 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.996019536192169 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR529-Probable-3p-star_Sobic.002G350400.2_923_TPlot.pdf Position Reads Category 68 1 4 353 1 4 358 1 4 369 1 4 543 1 4 801 1 4 806 1 4 811 1 4 840 1 4 897 1 4 903 1 4 906 1 4 907 1 4 909 1 4 923 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGCGGCGAGGGGGAGGGCGGC 3' Transcript: Sobic.002G377300.1:361-381 Slice Site:372 || || ||o|||||| o|| 3' CCACCUCUUCCCCUCGUGCAC 5' Query: miR164c-Probable-3p-star SiteID: Sobic.002G377300.1:372 MFE of perfect match: -45.50 MFE of this site: -31.40 MFEratio: 0.69010989010989 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-5,379-377 7-15,375-367 17-18,365-364 20-21,362-361 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,381-380 UP5: Unpaired region at 5' of query 6-6,376-376 SIL: Symmetric internal loop 16-16,366-366 SIL: Symmetric internal loop 19-19,363-363 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.891834933529147 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164c-Probable-3p-star_Sobic.002G377300.1_372_TPlot.pdf Position Reads Category 372 1 4 <<<<<<<<<< 1578 1 4 1696 1 4 --------------------------------------------------- --------------------------------------------------- 5' UAUGACAGGGAGAGCGGCAGGU 3' Transcript: Sobic.002G386400.1:649-670 Slice Site:661 |||||||oo|||||o| o|o 3' CUACUGUCUUUCUCGUCACUCG 5' Query: miR156f-Known-3p-star SiteID: Sobic.002G386400.1:661 MFE of perfect match: -40.90 MFE of this site: -27.40 MFEratio: 0.669926650366748 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,670-668 6-21,665-650 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-5,667-666 SIL: Symmetric internal loop 22-22,649-649 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.106138450892825 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Known-3p-star_Sobic.002G386400.1_661_TPlot.pdf Position Reads Category 157 1 4 176 1 4 285 1 4 309 1 4 313 1 4 324 1 4 328 1 4 329 1 4 331 4 0 332 1 4 342 1 4 418 1 4 426 1 4 429 2 2 431 1 4 434 1 4 437 1 4 439 1 4 441 1 4 476 1 4 497 1 4 518 1 4 535 1 4 583 2 2 586 1 4 589 2 2 592 1 4 595 1 4 601 2 2 608 1 4 609 1 4 612 2 2 613 1 4 615 1 4 616 1 4 620 1 4 629 1 4 639 1 4 647 1 4 654 1 4 661 2 2 <<<<<<<<<< 734 1 4 738 1 4 760 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGUGGGGCAUGUCAU-CGUGAU 3' Transcript: Sobic.002G401000.1:633-653 Slice Site:645 |o||o||| |||||| |o|||| 3' UUACUCCG-ACAGUACGUACUA 5' Query: miR167i-Known-3p-star SiteID: Sobic.002G401000.1:645 MFE of perfect match: -36.50 MFE of this site: -26.00 MFEratio: 0.712328767123288 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,653-648 8-13,647-642 14-21,640-633 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,x-x BULq: Bulge on query side x-x,641-641 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.18145779823613 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167i-Known-3p-star_Sobic.002G401000.1_645_TPlot.pdf Position Reads Category 202 2 2 348 1 4 351 2 2 352 1 4 355 3 2 356 1 4 357 1 4 358 4 2 370 1 4 371 3 2 372 5 0 373 1 4 374 2 2 375 1 4 377 1 4 378 1 4 441 1 4 449 1 4 450 1 4 453 1 4 486 1 4 645 1 4 <<<<<<<<<< 663 1 4 674 1 4 731 1 4 737 1 4 738 2 2 750 2 2 --------------------------------------------------- --------------------------------------------------- 5' CGGGA-UGAAGCCUGGUCCGG 3' Transcript: Sobic.003G028300.1:561-580 Slice Site:571 |||| |||||||||||||| 3' UCCCUAACUUCGGACCAGGCU 5' Query: miR166i-Known-3p-mature SiteID: Sobic.003G028300.1:571 MFE of perfect match: -42.40 MFE of this site: -37.10 MFEratio: 0.875 Allen et al. score: 3 Paired Regions (query5'-query3',transcript3'-transcript5') 2-15,579-566 17-20,565-562 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,580-580 UP5: Unpaired region at 5' of query 16-16,x-x BULq: Bulge on query side 21-21,561-561 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00307572674836032 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166i-Known-3p-mature_Sobic.003G028300.1_571_TPlot.pdf Position Reads Category 571 1 4 <<<<<<<<<< 1313 2 0 1337 1 4 1567 1 4 1596 1 4 1907 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUCGACAGAGGGAGCAGCGGGA 3' Transcript: Sobic.003G037900.1:74-95 Slice Site:86 ||||||oo|||||| |o| 3' CUACUGUCUUUCUCGUCACUCG 5' Query: miR156f-Known-3p-star SiteID: Sobic.003G037900.1:86 MFE of perfect match: -40.90 MFE of this site: -29.20 MFEratio: 0.713936430317848 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-4,94-92 6-19,90-77 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,95-95 UP5: Unpaired region at 5' of query 5-5,91-91 SIL: Symmetric internal loop 20-22,76-74 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.398468860603332 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Known-3p-star_Sobic.003G037900.1_86_TPlot.pdf Position Reads Category 23 1 4 44 2 1 46 1 4 54 1 4 56 1 4 58 1 4 64 1 4 65 1 4 77 1 4 86 1 4 <<<<<<<<<< 88 1 4 101 1 4 112 1 4 320 1 4 397 1 4 425 1 4 429 2 1 430 1 4 431 1 4 432 1 4 433 2 1 468 1 4 495 2 1 496 1 4 497 2 1 --------------------------------------------------- --------------------------------------------------- 5' GAUGGCGG-UGGAGUAG-GAGC 3' Transcript: Sobic.003G041801.1:589-608 Slice Site:600 ||||o|o| |o|||o|| |||| 3' CUACUGUCUAUCUCGUCACUCG 5' Query: miR156e-Known-3p-star SiteID: Sobic.003G041801.1:600 MFE of perfect match: -41.50 MFE of this site: -30.10 MFEratio: 0.725301204819277 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,608-605 6-13,604-597 15-22,596-589 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,x-x BULq: Bulge on query side 14-14,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.148013211641089 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156e-Known-3p-star_Sobic.003G041801.1_600_TPlot.pdf Position Reads Category 105 1 4 159 1 4 196 1 4 210 1 4 328 1 4 364 1 4 597 1 4 600 1 4 <<<<<<<<<< 601 1 4 603 1 4 628 1 4 1044 1 4 1162 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAUGGGUUGAAGCGA-UCACCAAG 3' Transcript: Sobic.003G047100.1:1061-1083 Slice Site:1075 |||||| |o||||o| || |||| 3' GUACCC-AUUUCGUUAAGCGGUUU 5' Query: miR5564a-Known-3p-star SiteID: Sobic.003G047100.1:1075 MFE of perfect match: -38.60 MFE of this site: -25.20 MFEratio: 0.652849740932642 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,1082-1079 7-8,1077-1076 10-17,1075-1068 18-23,1066-1061 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1083-1083 UP5: Unpaired region at 5' of query 6-6,1078-1078 SIL: Symmetric internal loop 9-9,x-x BULq: Bulge on query side x-x,1067-1067 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.573988622474264 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Known-3p-star_Sobic.003G047100.1_1075_TPlot.pdf Position Reads Category 656 1 4 686 1 4 839 1 4 974 1 4 1075 1 4 <<<<<<<<<< 1234 1 4 1259 1 4 1262 1 4 1265 3 0 1456 1 4 1679 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGUUUGAUGAUUUGCUGACCA 3' Transcript: Sobic.003G061800.1:143-163 Slice Site:154 |||o||o|| ||||| ||| 3' ACAAGCUGCUUAACGAAGGGU 5' Query: miR5564a-Known-5p-mature SiteID: Sobic.003G061800.1:154 MFE of perfect match: -36.80 MFE of this site: -24.70 MFEratio: 0.671195652173913 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,163-161 6-10,158-154 12-20,152-144 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-5,160-159 SIL: Symmetric internal loop 11-11,153-153 SIL: Symmetric internal loop 21-21,143-143 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.360243500779222 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Known-5p-mature_Sobic.003G061800.1_154_TPlot.pdf Position Reads Category 154 1 4 <<<<<<<<<< 705 1 4 --------------------------------------------------- --------------------------------------------------- 5' AACGAAGUGCUUU-GGGGAGC 3' Transcript: Sobic.003G077001.1:901-920 Slice Site:912 ||||||||| o||||o| 3' GUACUUCACGAACUUCCCUUG 5' Query: miR395a-Known-3p-star SiteID: Sobic.003G077001.1:912 MFE of perfect match: -36.90 MFE of this site: -26.10 MFEratio: 0.707317073170732 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,920-914 10-18,912-904 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-9,913-913 AILq: Asymmetric internal loop with more nts on the query side 19-21,903-901 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.256007842835781 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR395a-Known-3p-star_Sobic.003G077001.1_912_TPlot.pdf Position Reads Category 912 1 4 <<<<<<<<<< 1413 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAAUUGCUGAUGGUGAUCUAG 3' Transcript: Sobic.003G104350.1:713-733 Slice Site:724 ||||||||||| ||||| 3' ACAAACGACUACCAGUAGAUU 5' Query: miR827-Known-3p-mature SiteID: Sobic.003G104350.1:724 MFE of perfect match: -34.20 MFE of this site: -26.00 MFEratio: 0.760233918128655 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 2-6,732-728 8-18,726-716 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,733-733 UP5: Unpaired region at 5' of query 7-7,727-727 SIL: Symmetric internal loop 19-21,715-713 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0273434101926404 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR827-Known-3p-mature_Sobic.003G104350.1_724_TPlot.pdf Position Reads Category 425 1 4 490 2 1 492 2 1 532 1 4 630 1 4 667 1 4 668 1 4 706 1 4 710 1 4 714 1 4 715 1 4 720 1 4 724 1 4 <<<<<<<<<< 728 1 4 731 1 4 732 2 1 735 1 4 736 2 1 738 1 4 745 1 4 753 1 4 1561 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAGGAGA-AGGGCCGGGCGGC 3' Transcript: Sobic.003G130400.1:373-395 Slice Site:383 ||o||o|||| |||| o|o|| 3' CUUCUUCUCUCUCCCA---UGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.003G130400.1:383 MFE of perfect match: -40.10 MFE of this site: -26.24 MFEratio: 0.654364089775561 Allen et al. score: 13 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,395-391 7-10,386-383 12-21,382-373 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,390-387 AILt: Asymmetric internal loop with more nts on the transcript side 11-11,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999103760360694 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR529-Probable-3p-star_Sobic.003G130400.1_383_TPlot.pdf Position Reads Category 223 1 4 378 1 4 381 1 4 382 1 4 383 1 4 <<<<<<<<<< 384 1 4 385 1 4 390 1 4 399 1 4 402 1 4 403 1 4 408 1 4 409 1 4 410 1 4 414 1 4 416 1 4 418 1 4 422 1 4 447 1 4 478 1 4 479 1 4 482 2 0 --------------------------------------------------- --------------------------------------------------- 5' GGCGGAGGAGG-AGGC-CAGG 3' Transcript: Sobic.003G156700.2:10-28 Slice Site:21 |||o|||| |||| |||| 3' UUACCUUCUCCGUCCGUGUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.003G156700.2:21 MFE of perfect match: -42.10 MFE of this site: -28.50 MFEratio: 0.676959619952494 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,28-25 6-9,24-21 11-18,20-13 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,x-x BULq: Bulge on query side 10-10,x-x BULq: Bulge on query side 19-21,12-10 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.99973536723009 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR528-Known-3p-star_Sobic.003G156700.2_21_TPlot.pdf Position Reads Category 21 1 4 <<<<<<<<<< 293 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCCGUGGGCCAGUCAGCGAUUG 3' Transcript: Sobic.003G218600.2:197-218 Slice Site:209 o|| o|o||||| ||o|o||o 3' UGGGGCUCGGUCUGUUGUUAGG 5' Query: miR166i-Known-5p-star SiteID: Sobic.003G218600.2:209 MFE of perfect match: -44.90 MFE of this site: -30.20 MFEratio: 0.67260579064588 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-9,217-210 11-18,208-201 20-22,199-197 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,218-218 UP5: Unpaired region at 5' of query 10-10,209-209 SIL: Symmetric internal loop 19-19,200-200 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.86330202790958 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166i-Known-5p-star_Sobic.003G218600.2_209_TPlot.pdf Position Reads Category 209 1 4 <<<<<<<<<< 346 1 4 409 1 4 441 1 4 457 1 4 461 1 4 472 1 4 478 1 4 563 1 4 572 1 4 594 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAAGUGCUUGGGUUGGGCGAGC 3' Transcript: Sobic.003G238500.1:1333-1357 Slice Site:1344 ||||||||||o o|| ||o| 3' GUACUUCACGAACU---UCC-CUUG 5' Query: miR395a-Known-3p-star SiteID: Sobic.003G238500.1:1344 MFE of perfect match: -36.90 MFE of this site: -24.20 MFEratio: 0.655826558265583 Allen et al. score: 14 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,1357-1354 5-7,1352-1350 8-18,1346-1336 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1353-1353 BULt: Bulge on transcript side x-x,1349-1347 BULt: Bulge on transcript side 19-21,1335-1333 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.687895229138529 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR395a-Known-3p-star_Sobic.003G238500.1_1344_TPlot.pdf Position Reads Category 265 1 4 299 1 4 304 1 4 306 1 4 313 1 4 319 1 4 321 1 4 326 2 2 354 1 4 369 1 4 644 1 4 763 1 4 838 1 4 844 1 4 856 1 4 884 1 4 1040 1 4 1087 1 4 1094 1 4 1097 1 4 1109 1 4 1116 1 4 1130 1 4 1299 2 2 1300 3 0 1305 1 4 1312 1 4 1314 1 4 1337 1 4 1344 1 4 <<<<<<<<<< 1347 1 4 1350 1 4 1353 1 4 1361 1 4 --------------------------------------------------- --------------------------------------------------- 5' ACACGAGGAUCAGCCUCCUCA 3' Transcript: Sobic.003G277800.1:1355-1375 Slice Site:1366 |||||||||||| 3' CUAGAACCUAGUCGGAGGUAA 5' Query: miR166k-Known-5p-star SiteID: Sobic.003G277800.1:1366 MFE of perfect match: -38.40 MFE of this site: -26.50 MFEratio: 0.690104166666667 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 4-15,1372-1361 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,1375-1373 UP5: Unpaired region at 5' of query 16-21,1360-1355 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.28300784786216 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166k-Known-5p-star_Sobic.003G277800.1_1366_TPlot.pdf Position Reads Category 915 1 4 1366 1 4 <<<<<<<<<< 1373 1 4 1406 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGAGCUCCCUUCACUCCAAG 3' Transcript: Sobic.003G331100.1:971-991 Slice Site:982 o|||||||||||| ||||| 3' GUCUCGAGGGAAGUUAGGUUU 5' Query: miR159-Known-3p-mature SiteID: Sobic.003G331100.1:982 MFE of perfect match: -37.80 MFE of this site: -32.10 MFEratio: 0.849206349206349 Allen et al. score: 4.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-6,990-986 8-20,984-972 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,991-991 UP5: Unpaired region at 5' of query 7-7,985-985 SIL: Symmetric internal loop 21-21,971-971 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0122462627204336 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR159-Known-3p-mature_Sobic.003G331100.1_982_TPlot.pdf Position Reads Category 414 1 4 550 1 4 787 1 4 982 1 4 <<<<<<<<<< 1614 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCUGCCAACAUAGAGCAGAAGGUGGAGCCU 3' Transcript: Sobic.003G344600.1:325-354 Slice Site:345 ||||||| ||||o| |o||||o 3' GGACGGU---------UCUUUCUCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.003G344600.1:345 MFE of perfect match: -41.40 MFE of this site: -28.20 MFEratio: 0.681159420289855 Allen et al. score: 13.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,354-348 9-14,346-341 15-21,331-325 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-8,347-347 SIL: Symmetric internal loop x-x,340-332 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.971851485409016 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.003G344600.1_345_TPlot.pdf Position Reads Category 343 1 4 345 1 4 <<<<<<<<<< 384 1 4 386 1 4 418 1 4 426 1 4 436 2 1 437 1 4 438 2 1 440 1 4 445 1 4 454 1 4 491 1 4 630 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAGGAGAAGGCUGCAGAGCGGGUG 3' Transcript: Sobic.003G359900.1:1077-1101 Slice Site:1092 |o |||||||| |||o|o ||| 3' CUACCUCUUCC----UCUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.003G359900.1:1092 MFE of perfect match: -39.00 MFE of this site: -26.30 MFEratio: 0.674358974358974 Allen et al. score: 13.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,1101-1099 5-10,1097-1092 11-18,1087-1080 20-21,1078-1077 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,1098-1098 SIL: Symmetric internal loop x-x,1091-1088 BULt: Bulge on transcript side 19-19,1079-1079 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998824688044585 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164a-Known-3p-star_Sobic.003G359900.1_1092_TPlot.pdf Position Reads Category 106 1 4 190 1 4 209 1 4 211 1 4 251 1 4 480 1 4 517 2 2 867 1 4 898 1 4 932 1 4 935 1 4 936 1 4 940 1 4 941 3 2 942 2 2 943 4 0 944 1 4 947 2 2 949 2 2 951 1 4 952 1 4 961 1 4 963 1 4 970 1 4 976 1 4 1054 1 4 1055 1 4 1058 1 4 1060 1 4 1068 1 4 1073 1 4 1078 1 4 1081 1 4 1086 1 4 1092 1 4 <<<<<<<<<< 1096 1 4 1098 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGCUUGGACGAUUGGCUUCCCA 3' Transcript: Sobic.003G388700.1:113-134 Slice Site:125 || || ||||| |||||||| 3' AC-AAGCUGCUUAACGAAGGGU 5' Query: miR5564a-Known-5p-mature SiteID: Sobic.003G388700.1:125 MFE of perfect match: -36.80 MFE of this site: -24.58 MFEratio: 0.667934782608696 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,134-127 12-16,123-119 18-19,117-116 20-21,114-113 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-11,126-124 SIL: Symmetric internal loop 17-17,118-118 SIL: Symmetric internal loop x-x,115-115 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.381558562703199 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Known-5p-mature_Sobic.003G388700.1_125_TPlot.pdf Position Reads Category 66 1 4 125 1 4 <<<<<<<<<< 156 1 4 205 1 4 217 1 4 219 1 4 226 1 4 462 1 4 524 1 4 533 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGUGCUCUCUCUCUUCUGUCA 3' Transcript: Sobic.003G406600.1:856-876 Slice Site:867 |||||||||||||||||||| 3' CCACGAGAGAGAGAAGACAGU 5' Query: miR156g-Probable-5p-mature SiteID: Sobic.003G406600.1:867 MFE of perfect match: -40.70 MFE of this site: -39.00 MFEratio: 0.958230958230958 Allen et al. score: 1 Paired Regions (query5'-query3',transcript3'-transcript5') 1-20,876-857 Unpaired Regions (query5'-query3',transcript3'-transcript5') 21-21,856-856 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 3 Degradome p-value: 0.000318067419671886 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156g-Probable-5p-mature_Sobic.003G406600.1_867_TPlot.pdf Position Reads Category 867 2 3 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGCACCGGGGCCUGCGCCAGGCGU 3' Transcript: Sobic.003G430400.1:290-313 Slice Site:304 || |||o ||||o|||o||| 3' CCAGGGCUA--GACGUGGUUCGCU 5' Query: miR168-Known-5p-mature SiteID: Sobic.003G430400.1:304 MFE of perfect match: -46.70 MFE of this site: -30.50 MFEratio: 0.653104925053533 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-13,312-301 15-18,297-294 21-22,291-290 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,313-313 UP5: Unpaired region at 5' of query 14-14,300-298 AILt: Asymmetric internal loop with more nts on the transcript side 19-20,293-292 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.601902961719582 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR168-Known-5p-mature_Sobic.003G430400.1_304_TPlot.pdf Position Reads Category 304 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAU-AGCCAAGCCAAUGCUAUG 3' Transcript: Sobic.003G442900.1:58-78 Slice Site:69 ||| ||||||| ||||o|o||| 3' CUACUCGGUUCAGUUAUGGUAC 5' Query: miR171e-Known-5p-star SiteID: Sobic.003G442900.1:69 MFE of perfect match: -38.60 MFE of this site: -26.30 MFEratio: 0.681347150259067 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,78-69 12-18,67-61 20-22,60-58 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,68-68 SIL: Symmetric internal loop 19-19,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.311153244537064 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171e-Known-5p-star_Sobic.003G442900.1_69_TPlot.pdf Position Reads Category 41 1 4 48 1 4 49 1 4 69 1 4 <<<<<<<<<< 75 1 4 77 1 4 78 1 4 86 1 4 94 2 2 97 3 0 117 1 4 159 1 4 173 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGUGCUCAAGAAGGUGGAGCCU 3' Transcript: Sobic.004G000500.1:687-708 Slice Site:699 o ||| ||||||o| |o||||o 3' GGACG-GUUCUUUCUCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.004G000500.1:699 MFE of perfect match: -41.40 MFE of this site: -27.00 MFEratio: 0.652173913043478 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,708-702 9-16,700-693 17-19,691-689 21-21,687-687 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-8,701-701 SIL: Symmetric internal loop x-x,692-692 BULt: Bulge on transcript side 20-20,688-688 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999618191716666 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.004G000500.1_699_TPlot.pdf Position Reads Category 172 1 4 188 1 4 190 1 4 289 1 4 290 1 4 291 1 4 551 1 4 552 1 4 553 1 4 557 1 4 563 1 4 564 1 4 566 1 4 572 1 4 573 1 4 576 1 4 578 1 4 663 1 4 671 1 4 697 1 4 699 1 4 <<<<<<<<<< 701 1 4 718 1 4 720 2 2 723 1 4 726 1 4 727 1 4 730 1 4 731 5 1 733 1 4 734 3 2 735 3 2 736 2 2 737 1 4 738 2 2 739 3 2 741 3 2 743 5 1 745 2 2 750 1 4 828 1 4 855 1 4 1044 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAGGAGGGAGAGGG-AGAGG 3' Transcript: Sobic.004G030300.1:225-244 Slice Site:236 |o||o||o||||||| | || 3' CUUCUUCUCUCUCCCAUGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.004G030300.1:236 MFE of perfect match: -40.10 MFE of this site: -28.70 MFEratio: 0.71571072319202 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,243-242 5-5,240-240 7-21,239-225 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,244-244 UP5: Unpaired region at 5' of query 4-4,241-241 SIL: Symmetric internal loop 6-6,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.806385973079787 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR529-Probable-3p-star_Sobic.004G030300.1_236_TPlot.pdf Position Reads Category 236 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGCGGAGAGGGGGGAGCGGCGGAACGUG 3' Transcript: Sobic.004G242100.1:138-165 Slice Site:150 || ||||| o||||||| ||||| 3' CCACCUCU-UCCCCUCG------UGCAC 5' Query: miR164c-Probable-3p-star SiteID: Sobic.004G242100.1:150 MFE of perfect match: -45.50 MFE of this site: -32.60 MFEratio: 0.716483516483516 Allen et al. score: 14.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,165-161 6-13,154-147 14-18,145-141 20-21,139-138 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,160-155 BULt: Bulge on transcript side x-x,146-146 BULt: Bulge on transcript side 19-19,140-140 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.655562082407225 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164c-Probable-3p-star_Sobic.004G242100.1_150_TPlot.pdf Position Reads Category 22 1 4 143 1 4 150 1 4 <<<<<<<<<< 180 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGUCGCUGCUGUACCAGCUGGCG 3' Transcript: Sobic.004G257700.1:771-795 Slice Site:781 ||o|||||o||| ||||| | 3' CGGCAGCGGCGA-----UCGACGGA 5' Query: miR167g-Probable-5p-star SiteID: Sobic.004G257700.1:781 MFE of perfect match: -45.90 MFE of this site: -31.60 MFEratio: 0.688453159041394 Allen et al. score: 14.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-2,794-794 4-8,792-788 9-20,782-771 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,795-795 UP5: Unpaired region at 5' of query 3-3,793-793 SIL: Symmetric internal loop x-x,787-783 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999963601678756 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167g-Probable-5p-star_Sobic.004G257700.1_781_TPlot.pdf Position Reads Category 28 1 4 96 2 0 109 1 4 200 1 4 428 1 4 557 1 4 564 1 4 565 1 4 566 1 4 567 1 4 569 1 4 576 1 4 587 1 4 698 1 4 772 1 4 781 1 4 <<<<<<<<<< 786 1 4 1029 1 4 1122 1 4 1141 1 4 1295 1 4 1325 1 4 1326 1 4 1329 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGCUGCUGAACCUAUUCCAC 3' Transcript: Sobic.004G265500.1:4353-4372 Slice Site:4363 |||||| |||| o||||| 3' UCGACGUAUUGGUCGAGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.004G265500.1:4363 MFE of perfect match: -39.10 MFE of this site: -25.90 MFEratio: 0.662404092071611 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,4372-4367 9-12,4364-4361 15-20,4358-4353 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-8,4366-4365 SIL: Symmetric internal loop 13-14,4360-4359 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999667613777601 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166j-Probable-5p-star_Sobic.004G265500.1_4363_TPlot.pdf Position Reads Category 1343 1 4 1808 1 4 2704 1 4 4363 1 4 <<<<<<<<<< 4432 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCGCGGGAGGGGGGCGCGGA 3' Transcript: Sobic.004G275100.1:384-404 Slice Site:395 || | o|o|||||o||o|| 3' CCACCUCUUCCCCUCGUGCAC 5' Query: miR164c-Probable-3p-star SiteID: Sobic.004G275100.1:395 MFE of perfect match: -45.50 MFE of this site: -31.30 MFEratio: 0.687912087912088 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 3-16,402-389 18-18,387-387 20-21,385-384 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,404-403 UP5: Unpaired region at 5' of query 17-17,388-388 SIL: Symmetric internal loop 19-19,386-386 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.9069892019734 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164c-Probable-3p-star_Sobic.004G275100.1_395_TPlot.pdf Position Reads Category 395 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CCUGCUGGACAAGAUCAAGGAGAAGCUC 3' Transcript: Sobic.004G286600.1:618-645 Slice Site:636 ||||| ||||| |o|||||||o| 3' GGACG----GUUCU---UUCUCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.004G286600.1:636 MFE of perfect match: -41.40 MFE of this site: -28.00 MFEratio: 0.676328502415459 Allen et al. score: 12 Paired Regions (query5'-query3',transcript3'-transcript5') 1-11,645-635 12-16,631-627 17-21,622-618 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,634-632 BULt: Bulge on transcript side x-x,626-623 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.986435934937174 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.004G286600.1_636_TPlot.pdf Position Reads Category 38 1 4 60 1 4 67 2 2 68 1 4 72 1 4 73 1 4 76 1 4 83 1 4 85 1 4 92 1 4 95 2 2 96 4 2 97 1 4 98 1 4 99 2 2 100 6 2 101 4 2 102 2 2 103 7 2 104 9 2 105 7 2 106 19 0 107 6 2 108 2 2 109 4 2 110 7 2 111 3 2 112 5 2 113 1 4 114 2 2 115 1 4 116 1 4 117 1 4 118 2 2 119 1 4 121 1 4 125 2 2 126 1 4 127 4 2 128 1 4 130 2 2 131 2 2 133 2 2 134 1 4 135 1 4 150 1 4 153 1 4 154 1 4 156 1 4 157 2 2 163 1 4 258 1 4 259 1 4 261 1 4 262 3 2 264 1 4 265 2 2 268 2 2 271 2 2 272 1 4 273 3 2 274 1 4 276 1 4 277 1 4 279 1 4 284 2 2 285 3 2 286 1 4 291 2 2 292 1 4 295 1 4 298 1 4 299 2 2 301 4 2 302 1 4 304 4 2 305 2 2 306 1 4 307 2 2 309 1 4 310 1 4 319 5 2 320 2 2 322 5 2 323 3 2 324 1 4 325 1 4 326 1 4 327 2 2 329 2 2 330 3 2 331 3 2 333 1 4 335 1 4 341 1 4 343 1 4 344 1 4 346 1 4 349 1 4 454 1 4 456 1 4 472 1 4 507 1 4 512 1 4 548 1 4 553 1 4 575 1 4 577 1 4 579 1 4 588 1 4 591 1 4 593 1 4 596 1 4 608 1 4 610 1 4 611 1 4 613 1 4 614 1 4 615 3 2 617 1 4 619 1 4 636 1 4 <<<<<<<<<< 717 1 4 722 1 4 724 1 4 725 1 4 729 1 4 738 1 4 740 1 4 748 4 2 755 1 4 769 1 4 774 1 4 784 1 4 785 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUAUUGGCGCGGCUCAAUCA 3' Transcript: Sobic.004G290800.1:1131-1151 Slice Site:1142 |||||||||o||||||||||| 3' CUAUAACCGUGCCGAGUUAGU 5' Query: miR171i-Probable-3p-mature SiteID: Sobic.004G290800.1:1142 MFE of perfect match: -37.50 MFE of this site: -38.70 MFEratio: 1 Allen et al. score: 1 Paired Regions (query5'-query3',transcript3'-transcript5') 1-21,1151-1131 Unpaired Regions (query5'-query3',transcript3'-transcript5') NA Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00307572674836032 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171i-Probable-3p-mature_Sobic.004G290800.1_1142_TPlot.pdf Position Reads Category 782 1 4 783 1 4 797 1 4 847 1 4 853 1 4 857 1 4 1142 1 4 <<<<<<<<<< 1532 1 4 1621 1 4 2075 1 4 --------------------------------------------------- --------------------------------------------------- 5' UCUCCAC-GGGAUUGCACUUG 3' Transcript: Sobic.004G303200.1:267-286 Slice Site:277 |||| ||||||||||| 3' UAAGGUUUCCCUAACGUGACU 5' Query: miR393-Known-3p-star SiteID: Sobic.004G303200.1:277 MFE of perfect match: -36.00 MFE of this site: -24.20 MFEratio: 0.672222222222222 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 3-13,284-274 16-19,272-269 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,286-285 UP5: Unpaired region at 5' of query 14-15,273-273 AILq: Asymmetric internal loop with more nts on the query side 20-21,268-267 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.489079715898032 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR393-Known-3p-star_Sobic.004G303200.1_277_TPlot.pdf Position Reads Category 147 1 4 154 1 4 169 1 4 178 1 4 179 1 4 180 1 4 181 1 4 182 3 1 183 2 2 184 3 1 185 2 2 186 2 2 187 2 2 188 1 4 222 1 4 256 1 4 259 1 4 260 1 4 264 1 4 266 2 2 270 1 4 271 1 4 277 1 4 <<<<<<<<<< 317 1 4 349 1 4 367 1 4 384 1 4 389 1 4 550 1 4 615 1 4 644 1 4 676 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGAAAUCAUUGCCAGACUGUCG 3' Transcript: Sobic.004G321800.1:2707-2730 Slice Site:2721 |||||||o |||||||| o|| 3' CUACUUUG---ACGGUCUGCUAGA 5' Query: miR167c-Known-3p-star SiteID: Sobic.004G321800.1:2721 MFE of perfect match: -37.50 MFE of this site: -25.30 MFEratio: 0.674666666666667 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-4,2729-2727 6-13,2725-2718 14-21,2714-2707 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,2730-2730 UP5: Unpaired region at 5' of query 5-5,2726-2726 SIL: Symmetric internal loop x-x,2717-2715 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.684997575684821 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167c-Known-3p-star_Sobic.004G321800.1_2721_TPlot.pdf Position Reads Category 47 1 4 64 1 4 181 1 4 278 1 4 322 2 1 377 1 4 380 1 4 390 1 4 394 1 4 935 1 4 949 1 4 1108 1 4 1410 1 4 1477 1 4 1480 1 4 1522 1 4 1528 1 4 1531 1 4 1532 1 4 1607 1 4 1614 2 1 1615 1 4 1653 1 4 1680 1 4 1730 1 4 1811 1 4 2181 1 4 2427 2 1 2428 1 4 2525 1 4 2656 1 4 2684 1 4 2708 1 4 2710 2 1 2711 1 4 2713 1 4 2715 1 4 2716 1 4 2721 1 4 <<<<<<<<<< 2850 1 4 2857 1 4 2895 1 4 3070 1 4 3112 2 1 3153 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUCAUUCAA-GCUGGACUCAG 3' Transcript: Sobic.004G335500.1:1194-1214 Slice Site:1205 ||||| |||| |||| |||||o 3' CGAGU-AGUUGCGACGUGAGUU 5' Query: miR397-Known-5p-mature SiteID: Sobic.004G335500.1:1205 MFE of perfect match: -39.40 MFE of this site: -26.40 MFEratio: 0.67005076142132 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,1214-1209 8-11,1207-1204 13-16,1203-1200 17-21,1198-1194 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,1208-1208 SIL: Symmetric internal loop 12-12,x-x BULq: Bulge on query side x-x,1199-1199 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.95476430764022 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR397-Known-5p-mature_Sobic.004G335500.1_1205_TPlot.pdf Position Reads Category 1 1 4 160 1 4 217 1 4 227 1 4 250 1 4 255 1 4 256 3 2 257 2 2 258 1 4 261 3 2 265 2 2 266 1 4 267 1 4 268 1 4 275 1 4 343 1 4 412 1 4 413 1 4 415 1 4 416 1 4 418 1 4 421 1 4 429 1 4 430 1 4 432 1 4 436 1 4 441 1 4 442 1 4 443 1 4 445 1 4 446 1 4 448 1 4 450 1 4 457 1 4 462 1 4 465 1 4 466 1 4 468 2 2 469 1 4 471 1 4 474 2 2 475 1 4 478 1 4 502 1 4 529 1 4 541 1 4 542 1 4 544 1 4 546 1 4 563 1 4 564 1 4 569 1 4 570 1 4 571 1 4 573 1 4 584 2 2 585 1 4 605 1 4 614 1 4 619 1 4 623 1 4 643 1 4 644 1 4 645 1 4 646 1 4 648 1 4 649 1 4 650 1 4 651 1 4 664 1 4 665 1 4 668 1 4 676 1 4 679 1 4 681 1 4 696 1 4 698 1 4 701 2 2 705 1 4 791 1 4 864 2 2 870 1 4 871 1 4 875 1 4 879 1 4 883 1 4 884 1 4 886 1 4 887 1 4 888 1 4 889 1 4 891 1 4 894 1 4 897 1 4 898 1 4 899 1 4 902 1 4 903 1 4 906 1 4 907 3 2 908 1 4 910 1 4 913 1 4 916 1 4 959 1 4 987 1 4 988 1 4 1005 1 4 1009 2 2 1012 1 4 1015 1 4 1016 2 2 1017 6 2 1018 4 2 1019 6 2 1020 7 2 1021 6 2 1022 4 2 1023 2 2 1024 1 4 1026 1 4 1027 3 2 1028 5 2 1029 4 2 1030 1 4 1031 2 2 1032 1 4 1033 2 2 1034 1 4 1035 2 2 1036 2 2 1037 7 2 1038 19 0 1039 8 2 1040 5 2 1041 4 2 1042 5 2 1043 1 4 1045 5 2 1046 2 2 1047 5 2 1048 3 2 1050 2 2 1051 2 2 1052 1 4 1053 3 2 1054 5 2 1055 2 2 1056 2 2 1057 1 4 1059 1 4 1061 1 4 1064 1 4 1065 1 4 1067 1 4 1068 1 4 1069 1 4 1094 2 2 1096 2 2 1099 1 4 1100 1 4 1105 1 4 1106 1 4 1107 1 4 1108 1 4 1110 1 4 1112 2 2 1113 1 4 1114 2 2 1115 1 4 1116 2 2 1117 2 2 1118 6 2 1119 3 2 1127 1 4 1129 1 4 1180 2 2 1187 2 2 1188 2 2 1196 1 4 1198 1 4 1202 2 2 1205 1 4 <<<<<<<<<< 1294 1 4 1297 1 4 1318 1 4 1336 1 4 1356 1 4 1409 1 4 1421 1 4 1455 1 4 1456 1 4 1484 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCUACGUGACCAUCGACGACA 3' Transcript: Sobic.004G335500.1:244-265 Slice Site:256 || || o||||||o|o||o| 3' CCAAUUUACUGGUGGUUGUUUU 5' Query: miR827-Known-5p-star SiteID: Sobic.004G335500.1:256 MFE of perfect match: -33.70 MFE of this site: -22.70 MFEratio: 0.673590504451039 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-16,263-250 18-19,248-247 21-22,245-244 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,265-264 UP5: Unpaired region at 5' of query 17-17,249-249 SIL: Symmetric internal loop 20-20,246-246 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.0808242720910619 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR827-Known-5p-star_Sobic.004G335500.1_256_TPlot.pdf Position Reads Category 1 1 4 160 1 4 217 1 4 227 1 4 250 1 4 255 1 4 256 3 2 <<<<<<<<<< 257 2 2 258 1 4 261 3 2 265 2 2 266 1 4 267 1 4 268 1 4 275 1 4 343 1 4 412 1 4 413 1 4 415 1 4 416 1 4 418 1 4 421 1 4 429 1 4 430 1 4 432 1 4 436 1 4 441 1 4 442 1 4 443 1 4 445 1 4 446 1 4 448 1 4 450 1 4 457 1 4 462 1 4 465 1 4 466 1 4 468 2 2 469 1 4 471 1 4 474 2 2 475 1 4 478 1 4 502 1 4 529 1 4 541 1 4 542 1 4 544 1 4 546 1 4 563 1 4 564 1 4 569 1 4 570 1 4 571 1 4 573 1 4 584 2 2 585 1 4 605 1 4 614 1 4 619 1 4 623 1 4 643 1 4 644 1 4 645 1 4 646 1 4 648 1 4 649 1 4 650 1 4 651 1 4 664 1 4 665 1 4 668 1 4 676 1 4 679 1 4 681 1 4 696 1 4 698 1 4 701 2 2 705 1 4 791 1 4 864 2 2 870 1 4 871 1 4 875 1 4 879 1 4 883 1 4 884 1 4 886 1 4 887 1 4 888 1 4 889 1 4 891 1 4 894 1 4 897 1 4 898 1 4 899 1 4 902 1 4 903 1 4 906 1 4 907 3 2 908 1 4 910 1 4 913 1 4 916 1 4 959 1 4 987 1 4 988 1 4 1005 1 4 1009 2 2 1012 1 4 1015 1 4 1016 2 2 1017 6 2 1018 4 2 1019 6 2 1020 7 2 1021 6 2 1022 4 2 1023 2 2 1024 1 4 1026 1 4 1027 3 2 1028 5 2 1029 4 2 1030 1 4 1031 2 2 1032 1 4 1033 2 2 1034 1 4 1035 2 2 1036 2 2 1037 7 2 1038 19 0 1039 8 2 1040 5 2 1041 4 2 1042 5 2 1043 1 4 1045 5 2 1046 2 2 1047 5 2 1048 3 2 1050 2 2 1051 2 2 1052 1 4 1053 3 2 1054 5 2 1055 2 2 1056 2 2 1057 1 4 1059 1 4 1061 1 4 1064 1 4 1065 1 4 1067 1 4 1068 1 4 1069 1 4 1094 2 2 1096 2 2 1099 1 4 1100 1 4 1105 1 4 1106 1 4 1107 1 4 1108 1 4 1110 1 4 1112 2 2 1113 1 4 1114 2 2 1115 1 4 1116 2 2 1117 2 2 1118 6 2 1119 3 2 1127 1 4 1129 1 4 1180 2 2 1187 2 2 1188 2 2 1196 1 4 1198 1 4 1202 2 2 1205 1 4 1294 1 4 1297 1 4 1318 1 4 1336 1 4 1356 1 4 1409 1 4 1421 1 4 1455 1 4 1456 1 4 1484 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGGACAGGAGGAGAGGAGAGGA 3' Transcript: Sobic.005G101100.2:643-666 Slice Site:657 ||| |||||o|o||||o| ||| | 3' CGA-CUGUCUUUCUCUUCGCUCGU 5' Query: miR156j-Known-3p-star SiteID: Sobic.005G101100.2:657 MFE of perfect match: -43.80 MFE of this site: -30.70 MFEratio: 0.700913242009132 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-1,666-666 3-5,664-662 7-20,660-647 21-23,645-643 Unpaired Regions (query5'-query3',transcript3'-transcript5') 2-2,665-665 SIL: Symmetric internal loop 6-6,661-661 SIL: Symmetric internal loop x-x,646-646 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.513651174707227 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156j-Known-3p-star_Sobic.005G101100.2_657_TPlot.pdf Position Reads Category 533 1 4 539 1 4 608 1 4 610 1 4 611 1 4 613 1 4 657 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGUGGAGGAGAUGAUGCAGGUG 3' Transcript: Sobic.006G013300.1:3138-3159 Slice Site:3149 |||||||o||||| ||| o|| 3' CCACCUCUUCUACC-CGUGUAC 5' Query: miR164b-Known-3p-star SiteID: Sobic.006G013300.1:3149 MFE of perfect match: -41.90 MFE of this site: -31.30 MFEratio: 0.747016706443914 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,3159-3157 5-7,3155-3153 9-21,3150-3138 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,3156-3156 SIL: Symmetric internal loop 8-8,3152-3151 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.329988663931556 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164b-Known-3p-star_Sobic.006G013300.1_3149_TPlot.pdf Position Reads Category 2366 1 4 3149 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' AACCCCGCAGCUAGCUAUAUGACC 3' Transcript: Sobic.006G043700.1:889-912 Slice Site:900 |||o||||| || ||||| 3' GAAGGGUGUCGAAAGA---ACUGG 5' Query: miR396-Probable-3p-star SiteID: Sobic.006G043700.1:900 MFE of perfect match: -39.10 MFE of this site: -26.20 MFEratio: 0.670076726342711 Allen et al. score: 13.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,912-908 6-7,904-903 10-18,900-892 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,907-905 BULt: Bulge on transcript side 8-9,902-901 SIL: Symmetric internal loop 19-21,891-889 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.262851699509028 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-3p-star_Sobic.006G043700.1_900_TPlot.pdf Position Reads Category 394 1 4 426 1 4 427 2 1 429 1 4 437 1 4 444 1 4 445 2 1 446 1 4 484 1 4 498 1 4 555 1 4 567 1 4 586 1 4 812 1 4 837 1 4 890 1 4 894 1 4 895 1 4 899 1 4 900 1 4 <<<<<<<<<< 904 2 1 905 1 4 907 1 4 908 1 4 912 1 4 915 1 4 921 1 4 923 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGAUGGACAUGGCAGCAGUGGGA 3' Transcript: Sobic.006G047100.1:1756-1780 Slice Site:1771 |||||oo|| |o| |||||||o| 3' CUACUGUCU--AUC-UCGUCACUCG 5' Query: miR156e-Known-3p-star SiteID: Sobic.006G047100.1:1771 MFE of perfect match: -41.50 MFE of this site: -27.30 MFEratio: 0.657831325301205 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 2-10,1779-1771 11-13,1769-1767 14-22,1764-1756 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1780-1780 UP5: Unpaired region at 5' of query x-x,1770-1770 BULt: Bulge on transcript side x-x,1766-1765 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.719794683580908 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156e-Known-3p-star_Sobic.006G047100.1_1771_TPlot.pdf Position Reads Category 535 1 4 912 1 4 1233 1 4 1367 1 4 1374 1 4 1625 1 4 1752 1 4 1753 1 4 1771 1 4 <<<<<<<<<< 1774 2 0 1837 1 4 1988 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCCCG-GCCAGAUCAGCCCGACGAUCC 3' Transcript: Sobic.006G082000.1:1499-1525 Slice Site:1510 o |||| |||||| |o||o|||| 3' UGGGGCUCGGUCU------GUUGUUAGG 5' Query: miR166i-Known-5p-star SiteID: Sobic.006G082000.1:1510 MFE of perfect match: -44.90 MFE of this site: -29.80 MFEratio: 0.66369710467706 Allen et al. score: 16.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,1525-1517 10-15,1510-1505 17-20,1504-1501 22-22,1499-1499 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1516-1511 BULt: Bulge on transcript side 16-16,x-x BULq: Bulge on query side 21-21,1500-1500 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.931648128596705 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166i-Known-5p-star_Sobic.006G082000.1_1510_TPlot.pdf Position Reads Category 1508 1 4 1510 1 4 <<<<<<<<<< 1512 3 0 1513 1 4 2010 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGGAGCUCCCAACAGUCCUCG 3' Transcript: Sobic.006G096900.1:151-171 Slice Site:162 |o|||||||| ||o||| 3' GUCUCGAGGGAAGUUAGGUUU 5' Query: miR159-Known-3p-mature SiteID: Sobic.006G096900.1:162 MFE of perfect match: -37.80 MFE of this site: -28.60 MFEratio: 0.756613756613757 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 4-9,168-163 12-21,160-151 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,171-169 UP5: Unpaired region at 5' of query 10-11,162-161 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0938722047714007 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR159-Known-3p-mature_Sobic.006G096900.1_162_TPlot.pdf Position Reads Category 162 1 4 <<<<<<<<<< 209 1 4 227 1 4 281 1 4 417 1 4 418 1 4 813 1 4 1006 1 4 1285 1 4 1369 1 4 1477 2 0 --------------------------------------------------- --------------------------------------------------- 5' AAGUGAGCAAGAAAGUUGUGGUU 3' Transcript: Sobic.006G104800.1:1289-1311 Slice Site:1302 |||| ||||||||o||||| 3' UUCAA--GUUCUUUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.006G104800.1:1302 MFE of perfect match: -33.40 MFE of this site: -22.30 MFEratio: 0.667664670658683 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 3-16,1309-1296 18-21,1292-1289 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1311-1310 UP5: Unpaired region at 5' of query 17-17,1295-1293 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.911189170493154 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-5p-mature_Sobic.006G104800.1_1302_TPlot.pdf Position Reads Category 1029 1 4 1302 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CACACGUGACCUGCUUCUCCG 3' Transcript: Sobic.006G107400.1:665-685 Slice Site:676 |||||| ||||||||||| 3' ACGUGCACGGGACGAAGAGGU 5' Query: miR164c-Probable-5p-mature SiteID: Sobic.006G107400.1:676 MFE of perfect match: -44.30 MFE of this site: -33.10 MFEratio: 0.747178329571106 Allen et al. score: 4 Paired Regions (query5'-query3',transcript3'-transcript5') 2-12,684-674 14-19,672-667 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,685-685 UP5: Unpaired region at 5' of query 13-13,673-673 SIL: Symmetric internal loop 20-21,666-665 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0994376357107827 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164c-Probable-5p-mature_Sobic.006G107400.1_676_TPlot.pdf Position Reads Category 258 1 4 574 1 4 676 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' ACUGGUGGAGAGGGAGGCGCGGCA 3' Transcript: Sobic.006G108832.1:771-794 Slice Site:784 |||ooo||o||o||o||| o||| 3' CGACUGUCUUUCUCUUCGC-UCGU 5' Query: miR156j-Known-3p-star SiteID: Sobic.006G108832.1:784 MFE of perfect match: -43.80 MFE of this site: -29.70 MFEratio: 0.678082191780822 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,794-791 5-22,789-772 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,790-790 BULt: Bulge on transcript side 23-23,771-771 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.742157222040096 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156j-Known-3p-star_Sobic.006G108832.1_784_TPlot.pdf Position Reads Category 533 1 4 763 1 4 784 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CC-GCCUCGGAGGAGGGCGGCC 3' Transcript: Sobic.006G110900.7:479-499 Slice Site:490 || ||| o||||||o|| ||| 3' GGACGG--UCUCCUCUCGACGG 5' Query: miR399b-Probable-5p-star SiteID: Sobic.006G110900.7:490 MFE of perfect match: -45.40 MFE of this site: -31.30 MFEratio: 0.68942731277533 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,499-497 5-14,495-486 15-17,483-481 19-20,480-479 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,496-496 SIL: Symmetric internal loop x-x,485-484 BULt: Bulge on transcript side 18-18,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.878402527832232 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399b-Probable-5p-star_Sobic.006G110900.7_490_TPlot.pdf Position Reads Category 490 1 4 <<<<<<<<<< 639 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGGCAGAGAAGGGGGUGGAC 3' Transcript: Sobic.006G121100.1:897-918 Slice Site:909 ||||o|||||| o|oo|||o 3' CGACUGUCUCUCUCUUCACUCG 5' Query: miR156c-Known-5p-star SiteID: Sobic.006G121100.1:909 MFE of perfect match: -43.40 MFE of this site: -30.00 MFEratio: 0.691244239631336 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-10,916-909 12-22,907-897 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,918-917 UP5: Unpaired region at 5' of query 11-11,908-908 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.481149436129757 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156c-Known-5p-star_Sobic.006G121100.1_909_TPlot.pdf Position Reads Category 903 1 4 909 1 4 <<<<<<<<<< 934 1 4 1085 1 4 1091 1 4 1203 2 1 1213 1 4 1231 1 4 1246 1 4 1366 2 1 1431 1 4 1486 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAGGAGGAGAGGAGGCGGAGG 3' Transcript: Sobic.006G157300.2:390-411 Slice Site:402 |||o||| | ||||o ||| 3' UUACCUUCUC-CGUCCGUGUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.006G157300.2:402 MFE of perfect match: -42.10 MFE of this site: -28.60 MFEratio: 0.679334916864608 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,411-409 5-9,407-403 11-11,401-401 12-18,399-393 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,408-408 SIL: Symmetric internal loop 10-10,402-402 SIL: Symmetric internal loop x-x,400-400 BULt: Bulge on transcript side 19-21,392-390 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999674704386913 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR528-Known-3p-star_Sobic.006G157300.2_402_TPlot.pdf Position Reads Category 355 1 4 402 1 4 <<<<<<<<<< 409 1 4 418 1 4 425 1 4 432 1 4 444 1 4 447 1 4 449 1 4 451 2 1 453 1 4 456 1 4 463 1 4 475 1 4 481 1 4 483 1 4 486 1 4 488 1 4 489 1 4 508 1 4 619 1 4 624 1 4 627 1 4 641 1 4 643 1 4 645 2 1 665 1 4 722 1 4 724 1 4 743 1 4 882 1 4 --------------------------------------------------- --------------------------------------------------- 5' GA-GGAGGAGGAGUACGAGCGCGUA 3' Transcript: Sobic.006G178000.1:409-432 Slice Site:419 || ||||o|||| ||o|o||| 3' CUACCUCUUCCU----CUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.006G178000.1:419 MFE of perfect match: -39.00 MFE of this site: -26.30 MFEratio: 0.674358974358974 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-9,431-424 10-18,419-411 20-21,410-409 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,432-432 UP5: Unpaired region at 5' of query x-x,423-420 BULt: Bulge on transcript side 19-19,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998750000768301 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164a-Known-3p-star_Sobic.006G178000.1_419_TPlot.pdf Position Reads Category 373 1 4 419 1 4 <<<<<<<<<< 578 1 4 637 1 4 --------------------------------------------------- --------------------------------------------------- 5' UAUCCGGCCGGAGUUCGACAGGCC 3' Transcript: Sobic.006G190000.1:57-80 Slice Site:68 ||||o||o|| |o||| || 3' AGAGGCUGGUCU---GUUGUAAGG 5' Query: miR166d-Known-5p-star SiteID: Sobic.006G190000.1:68 MFE of perfect match: -39.70 MFE of this site: -26.00 MFEratio: 0.654911838790932 Allen et al. score: 14.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,80-79 5-9,76-72 10-19,68-59 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-4,78-77 SIL: Symmetric internal loop x-x,71-69 BULt: Bulge on transcript side 20-21,58-57 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.939385705485529 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166d-Known-5p-star_Sobic.006G190000.1_68_TPlot.pdf Position Reads Category 67 1 4 68 1 4 <<<<<<<<<< 173 1 4 614 1 4 617 1 4 944 2 0 --------------------------------------------------- --------------------------------------------------- 5' UGUUUGCAAAUGGUGAUCUGA 3' Transcript: Sobic.006G195800.1:2462-2482 Slice Site:2473 ||||||| ||||| ||||o| 3' ACAAACGACUACCAGUAGAUU 5' Query: miR827-Known-3p-mature SiteID: Sobic.006G195800.1:2473 MFE of perfect match: -34.20 MFE of this site: -23.60 MFEratio: 0.690058479532164 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,2482-2477 8-12,2475-2471 15-21,2468-2462 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,2476-2476 SIL: Symmetric internal loop 13-14,2470-2469 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.188987428025815 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR827-Known-3p-mature_Sobic.006G195800.1_2473_TPlot.pdf Position Reads Category 419 1 4 446 1 4 453 1 4 552 1 4 649 1 4 974 1 4 1231 1 4 1506 1 4 1750 1 4 1764 1 4 1826 1 4 1998 1 4 2108 1 4 2111 1 4 2117 1 4 2131 1 4 2208 1 4 2209 1 4 2268 1 4 2406 1 4 2462 1 4 2463 1 4 2465 1 4 2466 1 4 2470 1 4 2471 1 4 2472 1 4 2473 1 4 <<<<<<<<<< 2622 1 4 2655 1 4 2662 1 4 2771 1 4 2868 1 4 2873 1 4 2874 1 4 2975 1 4 2982 1 4 2986 1 4 2997 1 4 3116 1 4 3397 1 4 3538 1 4 3872 1 4 3903 1 4 4075 1 4 4088 1 4 4104 1 4 4107 1 4 4111 1 4 4113 1 4 4228 1 4 4410 1 4 4425 1 4 4568 1 4 4723 1 4 4750 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAAGCCAGGAGAGAGUUCAACUGCCC 3' Transcript: Sobic.006G249200.1:60-85 Slice Site:71 ||||o||o|||| |||| 3' GGACGGUUCUUUCUCUU-----CGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.006G249200.1:71 MFE of perfect match: -41.40 MFE of this site: -27.40 MFEratio: 0.66183574879227 Allen et al. score: 18.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,85-82 7-18,74-63 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-6,81-75 AILt: Asymmetric internal loop with more nts on the transcript side 19-21,62-60 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.997699617744712 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.006G249200.1_71_TPlot.pdf Position Reads Category 71 1 4 <<<<<<<<<< 707 1 4 1112 1 4 1147 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGGCGACCAGGAAGAUGAGGAUGAGC 3' Transcript: Sobic.007G000500.1:613-640 Slice Site:629 ||||o| ||o|||| ||o| ||||| 3' CGACUG----UCUUUCU-CUUC-ACUCG 5' Query: miR156a-Known-3p-star SiteID: Sobic.007G000500.1:629 MFE of perfect match: -40.70 MFE of this site: -28.00 MFEratio: 0.687960687960688 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,640-636 6-9,634-631 10-16,629-623 17-22,618-613 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,635-635 BULt: Bulge on transcript side x-x,630-630 BULt: Bulge on transcript side x-x,622-619 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.69076622757345 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156a-Known-3p-star_Sobic.007G000500.1_629_TPlot.pdf Position Reads Category 354 1 4 388 1 4 600 1 4 626 1 4 629 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CGUGCUGGAGGAUGAGCU-CC 3' Transcript: Sobic.007G009600.1:464-483 Slice Site:474 | |||oo||||| ||||| || 3' GGACGGUCUCCU-CUCGACGG 5' Query: miR399b-Probable-5p-star SiteID: Sobic.007G009600.1:474 MFE of perfect match: -45.40 MFE of this site: -29.60 MFEratio: 0.651982378854626 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,483-482 4-8,481-477 9-18,475-466 20-20,464-464 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,x-x BULq: Bulge on query side x-x,476-476 BULt: Bulge on transcript side 19-19,465-465 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.996721687013968 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399b-Probable-5p-star_Sobic.007G009600.1_474_TPlot.pdf Position Reads Category 474 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GCUG-CAGGAGGAGAGGCACGUCCGGAGCG 3' Transcript: Sobic.007G035000.1:1152-1180 Slice Site:1164 |||| |||o|o||||o|| |||| 3' CGACUGUCUUUCUCUUCG-------CUCGU 5' Query: miR156j-Known-3p-star SiteID: Sobic.007G035000.1:1164 MFE of perfect match: -43.80 MFE of this site: -31.50 MFEratio: 0.719178082191781 Allen et al. score: 18 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,1179-1176 6-18,1168-1156 20-23,1155-1152 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1180-1180 UP5: Unpaired region at 5' of query x-x,1175-1169 BULt: Bulge on transcript side 19-19,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.293966587726868 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156j-Known-3p-star_Sobic.007G035000.1_1164_TPlot.pdf Position Reads Category 1164 1 4 <<<<<<<<<< 1198 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGGGCA-GGGAUGG-UGGCG 3' Transcript: Sobic.007G069700.1:1795-1813 Slice Site:1805 ||o|| o||||o| |o||| 3' ACCUCGAGUCCUAUCUAUCGC 5' Query: miR390-Known-3p-star SiteID: Sobic.007G069700.1:1805 MFE of perfect match: -40.30 MFE of this site: -26.40 MFEratio: 0.655086848635236 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,1813-1809 7-13,1808-1802 16-20,1800-1796 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,x-x BULq: Bulge on query side 14-15,1801-1801 AILq: Asymmetric internal loop with more nts on the query side 21-21,1795-1795 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.894792535310174 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR390-Known-3p-star_Sobic.007G069700.1_1805_TPlot.pdf Position Reads Category 85 1 4 90 1 4 318 1 4 396 1 4 455 1 4 458 1 4 484 1 4 634 1 4 712 1 4 786 1 4 795 1 4 797 1 4 829 1 4 839 1 4 864 2 2 867 1 4 868 1 4 869 1 4 870 1 4 871 1 4 925 1 4 944 1 4 968 1 4 1003 1 4 1010 1 4 1141 1 4 1145 1 4 1147 2 2 1148 3 1 1150 3 1 1151 2 2 1152 2 2 1153 1 4 1163 1 4 1177 1 4 1178 1 4 1179 2 2 1184 1 4 1185 1 4 1322 1 4 1330 1 4 1331 1 4 1347 2 2 1425 1 4 1575 1 4 1669 1 4 1673 1 4 1674 1 4 1772 1 4 1802 1 4 1805 1 4 <<<<<<<<<< 1807 2 2 1810 1 4 1814 1 4 1815 1 4 1819 2 2 1820 1 4 1822 1 4 1846 1 4 --------------------------------------------------- --------------------------------------------------- 5' UACGGGCCGGCGACGACGUUCACG 3' Transcript: Sobic.007G102800.1:43-66 Slice Site:56 |o||||o o||o||o ||||| 3' GUACUCGGCU-UUGUUGU-AGUGC 5' Query: miR171f-Known-5p-star SiteID: Sobic.007G102800.1:56 MFE of perfect match: -38.70 MFE of this site: -26.20 MFEratio: 0.677002583979328 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,66-62 6-12,60-54 13-19,52-46 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,61-61 BULt: Bulge on transcript side x-x,53-53 BULt: Bulge on transcript side 20-22,45-43 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.776911604541284 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171f-Known-5p-star_Sobic.007G102800.1_56_TPlot.pdf Position Reads Category 51 1 4 56 1 4 <<<<<<<<<< 402 1 4 405 1 4 407 1 4 593 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAGUUCAAGAAGUUUGUGGUG 3' Transcript: Sobic.007G197800.1:211-231 Slice Site:222 |||||||||||o o||||| 3' UUCAAGUUCUUUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.007G197800.1:222 MFE of perfect match: -33.40 MFE of this site: -22.60 MFEratio: 0.676646706586826 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 3-8,229-224 10-21,222-211 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,231-230 UP5: Unpaired region at 5' of query 9-9,223-223 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.825638494157176 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-5p-mature_Sobic.007G197800.1_222_TPlot.pdf Position Reads Category 2 1 4 16 1 4 114 1 4 164 1 4 165 1 4 166 2 2 167 3 1 168 1 4 169 3 1 170 1 4 173 1 4 183 1 4 185 1 4 197 1 4 211 1 4 215 2 2 216 1 4 219 1 4 220 2 2 221 2 2 222 1 4 <<<<<<<<<< 223 2 2 224 1 4 225 2 2 226 1 4 228 1 4 244 1 4 278 1 4 280 1 4 373 1 4 --------------------------------------------------- --------------------------------------------------- 5' CACUGGAGCGG-AGGAGCUC 3' Transcript: Sobic.007G220500.1:6-24 Slice Site:16 || ||||o |o |||||||| 3' GUAACCUUACUAUCCUCGAG 5' Query: miR159-Known-5p-star SiteID: Sobic.007G220500.1:16 MFE of perfect match: -34.50 MFE of this site: -23.30 MFEratio: 0.67536231884058 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,24-17 10-11,16-15 13-17,13-9 19-20,7-6 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-9,x-x BULq: Bulge on query side 12-12,14-14 SIL: Symmetric internal loop 18-18,8-8 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.686932318496481 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR159-Known-5p-star_Sobic.007G220500.1_16_TPlot.pdf Position Reads Category 16 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UGAUCAUGCAAGUGGCAGUGGCU 3' Transcript: Sobic.007G227000.1:1500-1522 Slice Site:1513 |||||||| ||||||o | 3' UCUAGUACG---ACCGUCGAAGU 5' Query: miR167h-Probable-5p-mature SiteID: Sobic.007G227000.1:1513 MFE of perfect match: -37.60 MFE of this site: -25.30 MFEratio: 0.672872340425532 Allen et al. score: 13 Paired Regions (query5'-query3',transcript3'-transcript5') 2-2,1521-1521 5-11,1518-1512 12-19,1508-1501 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1522-1522 UP5: Unpaired region at 5' of query 3-4,1520-1519 SIL: Symmetric internal loop x-x,1511-1509 BULt: Bulge on transcript side 20-20,1500-1500 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.778963756555632 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167h-Probable-5p-mature_Sobic.007G227000.1_1513_TPlot.pdf Position Reads Category 333 1 4 334 1 4 342 1 4 361 1 4 362 3 0 437 1 4 511 1 4 524 1 4 525 1 4 691 1 4 783 1 4 862 1 4 870 1 4 951 1 4 1005 1 4 1048 1 4 1131 1 4 1221 1 4 1486 1 4 1513 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAUGAUAGAAAGA--UAGUUGCU 3' Transcript: Sobic.008G054500.1:1135-1155 Slice Site:1148 |||o|||||||o| ||o|||| 3' CUAUUAUCUUUUUUAAUUAACGU 5' Query: miR156g-Probable-3p-star SiteID: Sobic.008G054500.1:1148 MFE of perfect match: -26.30 MFE of this site: -20.40 MFEratio: 0.775665399239544 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-8,1154-1148 11-23,1147-1135 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1155-1155 UP5: Unpaired region at 5' of query 9-10,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0712644080165088 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156g-Probable-3p-star_Sobic.008G054500.1_1148_TPlot.pdf Position Reads Category 276 1 4 526 1 4 658 1 4 760 1 4 780 1 4 1009 1 4 1016 1 4 1040 1 4 1056 1 4 1059 1 4 1082 1 4 1087 1 4 1111 1 4 1122 1 4 1148 1 4 <<<<<<<<<< 1152 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGAAGGGGGCAGGCAAAGG 3' Transcript: Sobic.008G078300.1:969-989 Slice Site:980 oo|| |o|o|||||||| ||| 3' UUACCUUCUCCGUCCGUGUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.008G078300.1:980 MFE of perfect match: -42.10 MFE of this site: -28.80 MFEratio: 0.684085510688836 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,989-987 5-16,985-974 18-21,972-969 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,986-986 SIL: Symmetric internal loop 17-17,973-973 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999149486826359 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR528-Known-3p-star_Sobic.008G078300.1_980_TPlot.pdf Position Reads Category 361 1 4 362 1 4 364 1 4 368 1 4 378 1 4 385 1 4 437 2 2 440 1 4 448 1 4 455 2 2 456 1 4 457 1 4 462 1 4 463 1 4 467 1 4 474 1 4 475 1 4 505 1 4 603 1 4 724 1 4 848 1 4 878 1 4 879 1 4 897 1 4 913 1 4 921 1 4 925 1 4 927 1 4 934 1 4 939 1 4 946 2 2 952 1 4 958 1 4 961 1 4 962 1 4 963 1 4 967 1 4 969 2 2 970 1 4 971 1 4 972 1 4 975 1 4 980 1 4 <<<<<<<<<< 981 1 4 988 1 4 993 1 4 994 1 4 997 1 4 1004 1 4 1093 1 4 1194 1 4 1197 1 4 1199 1 4 1201 1 4 1202 7 0 1204 3 2 1205 2 2 1206 1 4 1207 6 2 1208 2 2 1209 2 2 1210 3 2 1213 2 2 1214 1 4 1217 2 2 1219 1 4 1222 1 4 1231 3 2 1234 1 4 1240 1 4 1324 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAAGAAGAAAGAGGCG-GCGGC 3' Transcript: Sobic.008G131200.1:543-563 Slice Site:554 |||||||| ||||| | o|o|| 3' CUUCUUCUCUCUCC-CAUGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.008G131200.1:554 MFE of perfect match: -40.10 MFE of this site: -26.10 MFEratio: 0.650872817955112 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,563-559 7-7,558-558 8-12,556-552 14-21,550-543 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,x-x BULq: Bulge on query side x-x,557-557 BULt: Bulge on transcript side 13-13,551-551 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999565455567691 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR529-Probable-3p-star_Sobic.008G131200.1_554_TPlot.pdf Position Reads Category 126 1 4 133 1 4 136 4 1 137 3 2 139 2 2 167 1 4 182 1 4 272 1 4 476 1 4 498 1 4 502 1 4 509 1 4 514 1 4 516 1 4 520 1 4 521 1 4 522 2 2 535 1 4 542 2 2 544 1 4 547 1 4 548 1 4 549 1 4 551 2 2 552 3 2 553 1 4 554 1 4 <<<<<<<<<< 555 1 4 572 1 4 574 1 4 580 2 2 588 1 4 589 1 4 605 1 4 622 1 4 641 2 2 642 1 4 643 2 2 644 2 2 645 1 4 649 4 1 655 1 4 656 1 4 657 1 4 659 2 2 661 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCGGAGGAGGAGGGCAAGAA 3' Transcript: Sobic.008G131200.1:561-581 Slice Site:572 |o ||||o|||||oo|| 3' CUACCUCUUCCUCUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.008G131200.1:572 MFE of perfect match: -39.00 MFE of this site: -25.40 MFEratio: 0.651282051282051 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 5-18,577-564 20-21,562-561 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-4,581-578 UP5: Unpaired region at 5' of query 19-19,563-563 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999984871359086 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164a-Known-3p-star_Sobic.008G131200.1_572_TPlot.pdf Position Reads Category 126 1 4 133 1 4 136 4 1 137 3 2 139 2 2 167 1 4 182 1 4 272 1 4 476 1 4 498 1 4 502 1 4 509 1 4 514 1 4 516 1 4 520 1 4 521 1 4 522 2 2 535 1 4 542 2 2 544 1 4 547 1 4 548 1 4 549 1 4 551 2 2 552 3 2 553 1 4 554 1 4 555 1 4 572 1 4 <<<<<<<<<< 574 1 4 580 2 2 588 1 4 589 1 4 605 1 4 622 1 4 641 2 2 642 1 4 643 2 2 644 2 2 645 1 4 649 4 1 655 1 4 656 1 4 657 1 4 659 2 2 661 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGUUGCCAGACGACGAUCC 3' Transcript: Sobic.008G133100.1:578-598 Slice Site:589 || o||||||o||o|o|| 3' GGAACUUGGUCUGUUGUUGGG 5' Query: miR166f-Probable-5p-star SiteID: Sobic.008G133100.1:589 MFE of perfect match: -38.90 MFE of this site: -26.88 MFEratio: 0.691002570694087 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-15,598-584 19-20,580-579 Unpaired Regions (query5'-query3',transcript3'-transcript5') 16-18,583-581 SIL: Symmetric internal loop 21-21,578-578 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.754557538478944 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166f-Probable-5p-star_Sobic.008G133100.1_589_TPlot.pdf Position Reads Category 586 1 4 587 1 4 589 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CCGUGCCAGGUUUGAGGAGCUC 3' Transcript: Sobic.008G136000.1:912-933 Slice Site:924 || |||||o| |||o|||o| 3' GG-ACGGUUCUUUCUCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.008G136000.1:924 MFE of perfect match: -41.40 MFE of this site: -28.48 MFEratio: 0.68792270531401 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,933-925 13-19,921-915 20-21,913-912 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-12,924-922 SIL: Symmetric internal loop x-x,914-914 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.958502492436528 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.008G136000.1_924_TPlot.pdf Position Reads Category 92 1 4 127 1 4 167 1 4 170 1 4 179 1 4 182 1 4 286 1 4 287 1 4 289 1 4 293 1 4 314 1 4 317 1 4 318 1 4 321 1 4 325 1 4 332 1 4 337 1 4 368 1 4 429 1 4 430 1 4 431 2 3 433 1 4 434 1 4 451 1 4 461 2 3 462 1 4 463 2 3 464 1 4 465 1 4 466 1 4 471 1 4 474 1 4 522 1 4 523 1 4 524 1 4 527 1 4 529 1 4 531 1 4 532 3 2 533 1 4 569 1 4 650 1 4 651 1 4 652 3 2 653 2 3 655 1 4 662 1 4 683 1 4 684 1 4 685 1 4 686 2 3 687 6 2 688 4 2 689 1 4 691 2 3 693 1 4 696 1 4 697 2 3 699 2 3 700 1 4 701 1 4 702 2 3 703 1 4 706 2 3 708 2 3 709 1 4 717 1 4 723 1 4 724 1 4 751 1 4 758 1 4 760 1 4 799 1 4 806 1 4 813 1 4 816 1 4 823 1 4 841 1 4 856 1 4 857 1 4 865 1 4 896 1 4 899 1 4 906 1 4 907 1 4 910 1 4 911 1 4 912 1 4 913 1 4 914 2 3 923 1 4 924 1 4 <<<<<<<<<< 933 1 4 934 4 2 935 1 4 936 1 4 937 5 2 938 3 2 956 1 4 966 1 4 1092 1 4 1176 1 4 1193 1 4 1219 1 4 1220 1 4 1254 1 4 1306 1 4 1345 1 4 1490 1 4 1494 1 4 1497 1 4 1498 1 4 1501 1 4 1507 1 4 1512 2 3 1515 3 2 1516 8 2 1517 3 2 1518 2 3 1519 6 2 1520 4 2 1521 13 2 1522 9 2 1523 7 2 1524 21 2 1525 22 0 1526 4 2 1527 17 2 1528 7 2 1529 7 2 1530 20 2 1531 14 2 1532 10 2 1533 11 2 1534 16 2 1535 8 2 1536 6 2 1537 20 2 1538 4 2 1539 5 2 1541 3 2 1543 2 3 1552 1 4 1553 1 4 1556 1 4 1557 2 3 1565 2 3 1568 1 4 1574 1 4 1580 1 4 1581 1 4 1582 3 2 1584 3 2 1585 4 2 1586 4 2 1587 2 3 1588 7 2 1589 7 2 1590 6 2 1591 8 2 1592 10 2 1593 11 2 1594 11 2 1595 5 2 1597 3 2 1598 1 4 1599 2 3 1601 1 4 1602 2 3 1603 1 4 1604 1 4 1605 1 4 1609 1 4 1613 1 4 1615 1 4 1620 1 4 1621 3 2 1623 1 4 1628 1 4 1630 1 4 1641 1 4 1643 1 4 1646 1 4 1652 1 4 1655 1 4 1656 1 4 1667 1 4 1670 1 4 1672 2 3 1675 1 4 1683 1 4 1700 1 4 1762 1 4 1790 1 4 1791 1 4 1792 1 4 1805 1 4 1808 1 4 1914 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGCAGGUGCCCUGCUUCUCCA 3' Transcript: Sobic.008G164800.2:686-706 Slice Site:697 ||| |||||||||||||||| 3' ACGUGCACGGGACGAAGAGGU 5' Query: miR164c-Probable-5p-mature SiteID: Sobic.008G164800.2:697 MFE of perfect match: -44.30 MFE of this site: -41.80 MFEratio: 0.943566591422122 Allen et al. score: 2 Paired Regions (query5'-query3',transcript3'-transcript5') 1-16,706-691 18-20,689-687 Unpaired Regions (query5'-query3',transcript3'-transcript5') 17-17,690-690 SIL: Symmetric internal loop 21-21,686-686 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 0 Degradome p-value: 6.93666646784941e-05 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164c-Probable-5p-mature_Sobic.008G164800.2_697_TPlot.pdf Position Reads Category 62 1 4 697 4 0 <<<<<<<<<< 708 1 4 936 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCUGCUAUGAAAG-GAGGCCG 3' Transcript: Sobic.009G015800.4:469-488 Slice Site:480 |||||o| ||||| ||o||| 3' GGACGGUUCUUUCUCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.009G015800.4:480 MFE of perfect match: -41.40 MFE of this site: -29.00 MFEratio: 0.70048309178744 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,487-482 9-13,481-477 15-21,475-469 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,488-488 UP5: Unpaired region at 5' of query 8-8,x-x BULq: Bulge on query side 14-14,476-476 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.898297780864474 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.009G015800.4_480_TPlot.pdf Position Reads Category 453 1 4 455 1 4 457 1 4 470 1 4 480 1 4 <<<<<<<<<< 495 1 4 612 3 0 614 1 4 615 1 4 619 1 4 622 1 4 623 2 2 635 1 4 638 1 4 674 2 2 676 2 2 693 1 4 745 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGCGAAAAGAACUGAAGGAGCAGCUGGGC 3' Transcript: Sobic.009G050200.2:377-408 Slice Site:398 |o||o|o |||o|||||| ||o|| 3' CUACUGU---------CUUUCUCGUC-ACUCG 5' Query: miR156f-Known-3p-star SiteID: Sobic.009G050200.2:398 MFE of perfect match: -40.90 MFE of this site: -28.20 MFEratio: 0.689486552567237 Allen et al. score: 14.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,408-404 6-15,402-393 16-22,383-377 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,403-403 BULt: Bulge on transcript side x-x,392-384 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.664980189673863 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Known-3p-star_Sobic.009G050200.2_398_TPlot.pdf Position Reads Category 309 1 4 367 1 4 398 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CCUGUGAAGAAAGAGGCUGAGUCU 3' Transcript: Sobic.009G076400.1:469-492 Slice Site:480 ||||o ||||||||| o||o|o 3' GGACGGUUCUUUCUC---UUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.009G076400.1:480 MFE of perfect match: -41.40 MFE of this site: -27.30 MFEratio: 0.659420289855073 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,492-487 7-15,483-475 17-21,473-469 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,486-484 BULt: Bulge on transcript side 16-16,474-474 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998810116417629 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399a-Probable-5p-star_Sobic.009G076400.1_480_TPlot.pdf Position Reads Category 2 1 4 10 1 4 13 1 4 271 1 4 333 1 4 339 1 4 416 1 4 461 1 4 474 1 4 475 1 4 480 1 4 <<<<<<<<<< 490 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGCUGUAUGGCGAGUUCCUG 3' Transcript: Sobic.009G132900.1:1025-1044 Slice Site:1035 |||||o||oo| ||o||| 3' UCGACGUAUUGGUCGAGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.009G132900.1:1035 MFE of perfect match: -39.10 MFE of this site: -27.90 MFEratio: 0.713554987212276 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-8,1042-1037 10-20,1035-1025 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1044-1043 UP5: Unpaired region at 5' of query 9-9,1036-1036 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.830406132333243 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166j-Probable-5p-star_Sobic.009G132900.1_1035_TPlot.pdf Position Reads Category 151 1 4 177 1 4 224 1 4 239 1 4 240 3 2 242 1 4 244 1 4 254 1 4 271 1 4 274 1 4 355 1 4 424 1 4 670 3 2 674 1 4 677 1 4 678 3 2 679 1 4 680 1 4 681 2 2 685 3 2 686 1 4 687 2 2 688 1 4 690 1 4 808 1 4 865 1 4 975 1 4 977 1 4 986 1 4 999 2 2 1027 1 4 1029 1 4 1030 1 4 1035 1 4 <<<<<<<<<< 1038 1 4 1040 1 4 1052 1 4 1131 1 4 1140 1 4 1157 1 4 1162 1 4 1168 1 4 1169 1 4 1171 2 2 1173 1 4 1177 1 4 1184 1 4 1191 1 4 1193 1 4 1198 1 4 1201 3 2 1203 1 4 1204 2 2 1206 2 2 1207 1 4 1213 1 4 1214 1 4 1215 1 4 1231 1 4 1240 1 4 1242 1 4 1243 1 4 1244 2 2 1245 2 2 1247 1 4 1254 1 4 1258 1 4 1270 1 4 1275 1 4 1283 1 4 1302 1 4 1378 1 4 1414 1 4 1451 1 4 1530 1 4 1531 3 2 1532 1 4 1535 2 2 1536 1 4 1538 1 4 1540 1 4 1542 1 4 1543 2 2 1544 2 2 1545 1 4 1546 1 4 1547 1 4 1601 1 4 1654 1 4 1672 1 4 1675 1 4 1770 1 4 1853 1 4 1854 2 2 1855 1 4 1856 1 4 1857 1 4 1858 1 4 1859 1 4 1875 1 4 1882 2 2 1917 1 4 1935 1 4 2009 1 4 2011 1 4 2015 1 4 2016 1 4 2037 1 4 2043 1 4 2107 1 4 2108 1 4 2111 4 2 2112 5 0 2113 1 4 2114 2 2 2115 1 4 2116 2 2 2122 1 4 2123 1 4 2124 1 4 2127 1 4 2128 1 4 2131 2 2 2132 2 2 2133 1 4 2134 1 4 2143 1 4 2144 1 4 2145 1 4 2146 2 2 2323 1 4 2328 1 4 2329 1 4 2339 1 4 2350 1 4 2364 1 4 2368 1 4 2383 1 4 2418 1 4 2426 1 4 2427 2 2 2434 1 4 2444 2 2 2447 1 4 2449 2 2 2450 2 2 2507 1 4 2522 1 4 2523 4 2 2524 2 2 2525 1 4 2526 1 4 2528 1 4 2532 2 2 2535 1 4 2537 1 4 2538 1 4 2539 1 4 2540 2 2 2541 2 2 2545 1 4 2546 1 4 2547 2 2 2548 3 2 2549 3 2 2550 1 4 2613 1 4 2631 1 4 2649 1 4 2704 1 4 2709 1 4 2762 1 4 2780 1 4 2786 1 4 2787 1 4 2789 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUGUUCAGGAGAACAGGCUGUGGAU 3' Transcript: Sobic.009G132900.1:1199-1223 Slice Site:1214 |||||o|| |o|||||||| 3' UUCAAGUUCU----UUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.009G132900.1:1214 MFE of perfect match: -33.40 MFE of this site: -25.80 MFEratio: 0.772455089820359 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-11,1222-1213 12-19,1208-1201 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1223-1223 UP5: Unpaired region at 5' of query x-x,1212-1209 BULt: Bulge on transcript side 20-21,1200-1199 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.163615679483801 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-5p-mature_Sobic.009G132900.1_1214_TPlot.pdf Position Reads Category 151 1 4 177 1 4 224 1 4 239 1 4 240 3 2 242 1 4 244 1 4 254 1 4 271 1 4 274 1 4 355 1 4 424 1 4 670 3 2 674 1 4 677 1 4 678 3 2 679 1 4 680 1 4 681 2 2 685 3 2 686 1 4 687 2 2 688 1 4 690 1 4 808 1 4 865 1 4 975 1 4 977 1 4 986 1 4 999 2 2 1027 1 4 1029 1 4 1030 1 4 1035 1 4 1038 1 4 1040 1 4 1052 1 4 1131 1 4 1140 1 4 1157 1 4 1162 1 4 1168 1 4 1169 1 4 1171 2 2 1173 1 4 1177 1 4 1184 1 4 1191 1 4 1193 1 4 1198 1 4 1201 3 2 1203 1 4 1204 2 2 1206 2 2 1207 1 4 1213 1 4 1214 1 4 <<<<<<<<<< 1215 1 4 1231 1 4 1240 1 4 1242 1 4 1243 1 4 1244 2 2 1245 2 2 1247 1 4 1254 1 4 1258 1 4 1270 1 4 1275 1 4 1283 1 4 1302 1 4 1378 1 4 1414 1 4 1451 1 4 1530 1 4 1531 3 2 1532 1 4 1535 2 2 1536 1 4 1538 1 4 1540 1 4 1542 1 4 1543 2 2 1544 2 2 1545 1 4 1546 1 4 1547 1 4 1601 1 4 1654 1 4 1672 1 4 1675 1 4 1770 1 4 1853 1 4 1854 2 2 1855 1 4 1856 1 4 1857 1 4 1858 1 4 1859 1 4 1875 1 4 1882 2 2 1917 1 4 1935 1 4 2009 1 4 2011 1 4 2015 1 4 2016 1 4 2037 1 4 2043 1 4 2107 1 4 2108 1 4 2111 4 2 2112 5 0 2113 1 4 2114 2 2 2115 1 4 2116 2 2 2122 1 4 2123 1 4 2124 1 4 2127 1 4 2128 1 4 2131 2 2 2132 2 2 2133 1 4 2134 1 4 2143 1 4 2144 1 4 2145 1 4 2146 2 2 2323 1 4 2328 1 4 2329 1 4 2339 1 4 2350 1 4 2364 1 4 2368 1 4 2383 1 4 2418 1 4 2426 1 4 2427 2 2 2434 1 4 2444 2 2 2447 1 4 2449 2 2 2450 2 2 2507 1 4 2522 1 4 2523 4 2 2524 2 2 2525 1 4 2526 1 4 2528 1 4 2532 2 2 2535 1 4 2537 1 4 2538 1 4 2539 1 4 2540 2 2 2541 2 2 2545 1 4 2546 1 4 2547 2 2 2548 3 2 2549 3 2 2550 1 4 2613 1 4 2631 1 4 2649 1 4 2704 1 4 2709 1 4 2762 1 4 2780 1 4 2786 1 4 2787 1 4 2789 1 4 --------------------------------------------------- --------------------------------------------------- 5' UCUCGACC-AGAGAGGAGUGGGC 3' Transcript: Sobic.009G132900.1:2637-2658 Slice Site:2649 ||| ||| ||||||o||||o|| 3' AGA-CUGUCUCUCUCUUCACUCG 5' Query: miR156h-Known-3p-star SiteID: Sobic.009G132900.1:2649 MFE of perfect match: -41.90 MFE of this site: -29.20 MFEratio: 0.696897374701671 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-14,2658-2645 17-19,2643-2641 20-22,2639-2637 Unpaired Regions (query5'-query3',transcript3'-transcript5') 15-16,2644-2644 AILq: Asymmetric internal loop with more nts on the query side x-x,2640-2640 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.356289837206745 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156h-Known-3p-star_Sobic.009G132900.1_2649_TPlot.pdf Position Reads Category 151 1 4 177 1 4 224 1 4 239 1 4 240 3 2 242 1 4 244 1 4 254 1 4 271 1 4 274 1 4 355 1 4 424 1 4 670 3 2 674 1 4 677 1 4 678 3 2 679 1 4 680 1 4 681 2 2 685 3 2 686 1 4 687 2 2 688 1 4 690 1 4 808 1 4 865 1 4 975 1 4 977 1 4 986 1 4 999 2 2 1027 1 4 1029 1 4 1030 1 4 1035 1 4 1038 1 4 1040 1 4 1052 1 4 1131 1 4 1140 1 4 1157 1 4 1162 1 4 1168 1 4 1169 1 4 1171 2 2 1173 1 4 1177 1 4 1184 1 4 1191 1 4 1193 1 4 1198 1 4 1201 3 2 1203 1 4 1204 2 2 1206 2 2 1207 1 4 1213 1 4 1214 1 4 1215 1 4 1231 1 4 1240 1 4 1242 1 4 1243 1 4 1244 2 2 1245 2 2 1247 1 4 1254 1 4 1258 1 4 1270 1 4 1275 1 4 1283 1 4 1302 1 4 1378 1 4 1414 1 4 1451 1 4 1530 1 4 1531 3 2 1532 1 4 1535 2 2 1536 1 4 1538 1 4 1540 1 4 1542 1 4 1543 2 2 1544 2 2 1545 1 4 1546 1 4 1547 1 4 1601 1 4 1654 1 4 1672 1 4 1675 1 4 1770 1 4 1853 1 4 1854 2 2 1855 1 4 1856 1 4 1857 1 4 1858 1 4 1859 1 4 1875 1 4 1882 2 2 1917 1 4 1935 1 4 2009 1 4 2011 1 4 2015 1 4 2016 1 4 2037 1 4 2043 1 4 2107 1 4 2108 1 4 2111 4 2 2112 5 0 2113 1 4 2114 2 2 2115 1 4 2116 2 2 2122 1 4 2123 1 4 2124 1 4 2127 1 4 2128 1 4 2131 2 2 2132 2 2 2133 1 4 2134 1 4 2143 1 4 2144 1 4 2145 1 4 2146 2 2 2323 1 4 2328 1 4 2329 1 4 2339 1 4 2350 1 4 2364 1 4 2368 1 4 2383 1 4 2418 1 4 2426 1 4 2427 2 2 2434 1 4 2444 2 2 2447 1 4 2449 2 2 2450 2 2 2507 1 4 2522 1 4 2523 4 2 2524 2 2 2525 1 4 2526 1 4 2528 1 4 2532 2 2 2535 1 4 2537 1 4 2538 1 4 2539 1 4 2540 2 2 2541 2 2 2545 1 4 2546 1 4 2547 2 2 2548 3 2 2549 3 2 2550 1 4 2613 1 4 2631 1 4 2649 1 4 <<<<<<<<<< 2704 1 4 2709 1 4 2762 1 4 2780 1 4 2786 1 4 2787 1 4 2789 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCCUGGGGAGCAGCUGCUGGUGG 3' Transcript: Sobic.009G182600.1:4831-4853 Slice Site:4843 ||o| ||||| ||o||||o 3' UUAACUCA-CGUCG-CGGCCACU 5' Query: miR397-Known-3p-star SiteID: Sobic.009G182600.1:4843 MFE of perfect match: -41.20 MFE of this site: -27.00 MFEratio: 0.655339805825243 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,4853-4846 9-13,4844-4840 15-18,4837-4834 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,4845-4845 BULt: Bulge on transcript side 14-14,4839-4838 AILt: Asymmetric internal loop with more nts on the transcript side 19-21,4833-4831 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.994185843446549 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR397-Known-3p-star_Sobic.009G182600.1_4843_TPlot.pdf Position Reads Category 78 1 4 79 1 4 122 1 4 130 2 2 141 1 4 143 1 4 146 3 1 147 1 4 148 1 4 150 1 4 151 1 4 152 2 2 153 1 4 154 1 4 160 1 4 165 1 4 167 2 2 169 3 1 170 1 4 171 1 4 172 1 4 177 1 4 179 1 4 184 1 4 186 1 4 188 1 4 192 1 4 197 1 4 198 1 4 199 1 4 217 1 4 218 1 4 219 1 4 220 2 2 221 1 4 223 3 1 224 1 4 226 1 4 228 1 4 229 1 4 231 1 4 241 1 4 242 1 4 244 1 4 245 1 4 249 1 4 368 1 4 391 1 4 393 1 4 415 1 4 469 1 4 481 1 4 488 1 4 501 1 4 514 2 2 516 1 4 518 2 2 521 1 4 522 1 4 524 2 2 527 1 4 531 1 4 534 1 4 535 1 4 546 1 4 568 1 4 570 1 4 571 1 4 579 2 2 580 2 2 582 1 4 583 1 4 585 2 2 590 1 4 601 1 4 604 1 4 713 1 4 748 1 4 831 1 4 895 1 4 898 2 2 930 1 4 1097 1 4 1131 1 4 1230 1 4 1238 1 4 1282 1 4 1283 1 4 1486 1 4 1766 1 4 1817 1 4 1881 1 4 1882 2 2 2111 1 4 2198 1 4 2211 1 4 2359 1 4 2474 1 4 2483 1 4 2503 1 4 2796 1 4 3054 1 4 3120 1 4 3168 1 4 3243 1 4 3284 1 4 3577 1 4 3713 1 4 3778 1 4 3896 1 4 3901 1 4 3918 1 4 3919 2 2 3937 1 4 3991 1 4 4026 1 4 4028 1 4 4066 1 4 4069 1 4 4070 1 4 4073 1 4 4075 1 4 4082 1 4 4083 1 4 4085 1 4 4087 1 4 4089 1 4 4093 1 4 4135 1 4 4227 1 4 4297 1 4 4327 1 4 4330 1 4 4375 1 4 4387 1 4 4398 2 2 4426 1 4 4435 1 4 4437 2 2 4544 1 4 4559 1 4 4560 1 4 4565 1 4 4572 1 4 4573 2 2 4574 2 2 4576 3 1 4577 1 4 4578 1 4 4579 2 2 4580 1 4 4581 1 4 4582 3 1 4587 1 4 4596 1 4 4614 1 4 4615 1 4 4621 1 4 4637 1 4 4669 1 4 4670 1 4 4692 1 4 4729 1 4 4736 1 4 4753 1 4 4765 1 4 4843 1 4 <<<<<<<<<< 4857 1 4 4865 1 4 4868 1 4 4872 1 4 4873 1 4 4878 1 4 4883 1 4 4892 1 4 4899 1 4 4905 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGAUGCUGAGAUGAAUACCACG 3' Transcript: Sobic.009G189100.1:397-420 Slice Site:410 ||| ||o||o|o ||||||||| 3' GUACU-CGGCUUUG-UUAUGGUGC 5' Query: miR171g-Known-5p-star SiteID: Sobic.009G189100.1:410 MFE of perfect match: -38.80 MFE of this site: -25.70 MFEratio: 0.662371134020619 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,420-412 10-17,410-403 18-20,401-399 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,411-411 BULt: Bulge on transcript side x-x,402-402 BULt: Bulge on transcript side 21-22,398-397 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.926629666923187 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR171g-Known-5p-star_Sobic.009G189100.1_410_TPlot.pdf Position Reads Category 403 1 4 406 1 4 407 1 4 408 1 4 410 1 4 <<<<<<<<<< 414 1 4 415 1 4 416 1 4 647 1 4 934 1 4 1253 1 4 1267 1 4 1373 2 2 1374 1 4 1375 4 0 1376 1 4 1796 1 4 1797 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCCGUCGCC-CAAGCCCGUGCCG 3' Transcript: Sobic.009G200700.1:144-165 Slice Site:153 ||||||||| | ||| |||| 3' CGGCAGCGGCGAUCG---ACGGA 5' Query: miR167g-Probable-5p-star SiteID: Sobic.009G200700.1:153 MFE of perfect match: -45.90 MFE of this site: -30.10 MFEratio: 0.655773420479303 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,164-161 6-8,157-155 10-10,153-153 12-20,152-144 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,165-165 UP5: Unpaired region at 5' of query x-x,160-158 BULt: Bulge on transcript side 9-9,154-154 SIL: Symmetric internal loop 11-11,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999999985824 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167g-Probable-5p-star_Sobic.009G200700.1_153_TPlot.pdf Position Reads Category 153 1 4 <<<<<<<<<< 385 1 4 717 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCUUGAACCAAAUUUUGAUGAUGACGACUC 3' Transcript: Sobic.009G201600.1:651-680 Slice Site:671 |||||||||| ||oo||o||o| 3' GGAACUUGGU---------CUGUUGUUGGG 5' Query: miR166f-Probable-5p-star SiteID: Sobic.009G201600.1:671 MFE of perfect match: -38.90 MFE of this site: -26.10 MFEratio: 0.670951156812339 Allen et al. score: 22 Paired Regions (query5'-query3',transcript3'-transcript5') 1-11,680-670 12-21,660-651 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,669-661 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.898610589100237 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166f-Probable-5p-star_Sobic.009G201600.1_671_TPlot.pdf Position Reads Category 317 1 4 379 1 4 390 1 4 414 1 4 664 1 4 668 1 4 671 1 4 <<<<<<<<<< 744 1 4 817 1 4 844 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGGGGCGACCA-AGGACACG 3' Transcript: Sobic.009G215700.1:80-99 Slice Site:91 |||||||||| ||o||||o 3' GCCCCCGCUGGACUCUUGUGU 5' Query: miR398-Known-3p-mature SiteID: Sobic.009G215700.1:91 MFE of perfect match: -45.30 MFE of this site: -34.20 MFEratio: 0.754966887417219 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,99-92 11-20,90-81 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-10,91-91 AILq: Asymmetric internal loop with more nts on the query side 21-21,80-80 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.115929670001882 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR398-Known-3p-mature_Sobic.009G215700.1_91_TPlot.pdf Position Reads Category 28 1 4 39 2 2 40 1 4 45 6 1 46 3 2 47 1 4 49 1 4 50 1 4 53 3 2 54 1 4 55 2 2 57 3 2 58 3 2 60 1 4 61 1 4 65 1 4 66 1 4 68 1 4 90 3 2 91 1 4 <<<<<<<<<< 92 1 4 93 1 4 97 1 4 188 1 4 199 1 4 203 1 4 205 1 4 207 1 4 217 1 4 218 1 4 281 1 4 283 1 4 297 1 4 311 1 4 316 1 4 320 1 4 321 1 4 472 2 2 495 1 4 497 2 2 502 2 2 503 1 4 508 1 4 513 1 4 514 1 4 522 1 4 523 1 4 529 1 4 530 1 4 537 1 4 539 1 4 544 3 2 546 2 2 547 4 2 550 2 2 553 1 4 556 1 4 557 1 4 562 3 2 563 1 4 564 1 4 565 1 4 566 3 2 567 3 2 568 6 1 570 3 2 574 2 2 575 1 4 576 1 4 578 1 4 580 2 2 --------------------------------------------------- --------------------------------------------------- 5' UGGGGGCGACCA-AGGACACG 3' Transcript: Sobic.009G215700.2:74-93 Slice Site:85 |||||||||| ||o||||o 3' GCCCCCGCUGGACUCUUGUGU 5' Query: miR398-Known-3p-mature SiteID: Sobic.009G215700.2:85 MFE of perfect match: -45.30 MFE of this site: -34.20 MFEratio: 0.754966887417219 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,93-86 11-20,84-75 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-10,85-85 AILq: Asymmetric internal loop with more nts on the query side 21-21,74-74 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.0067922052997289 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR398-Known-3p-mature_Sobic.009G215700.2_85_TPlot.pdf Position Reads Category 78 1 4 80 1 4 81 1 4 85 2 2 <<<<<<<<<< 107 1 4 155 1 4 180 2 2 183 1 4 200 1 4 208 2 2 272 1 4 278 1 4 280 1 4 282 1 4 284 1 4 288 1 4 302 1 4 310 1 4 311 1 4 313 1 4 318 1 4 329 1 4 364 1 4 372 1 4 466 1 4 479 1 4 480 1 4 485 1 4 496 3 2 497 1 4 504 1 4 506 1 4 514 1 4 527 1 4 533 1 4 535 1 4 537 1 4 538 1 4 540 1 4 541 2 2 544 2 2 548 2 2 550 1 4 551 1 4 552 1 4 554 1 4 555 1 4 556 2 2 558 3 2 559 1 4 560 1 4 561 1 4 562 7 0 569 1 4 570 1 4 571 2 2 574 1 4 575 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUUCGGGCCGCCUCACCACGGCGGCAUGGC 3' Transcript: Sobic.009G236500.1:245-275 Slice Site:266 o| ||o||| ||| ||o|||||o| 3' UC-AGUCCGACGG--------CGUCGUACUG 5' Query: miR167h-Probable-3p-star SiteID: Sobic.009G236500.1:266 MFE of perfect match: -47.20 MFE of this site: -30.80 MFEratio: 0.652542372881356 Allen et al. score: 21 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,275-266 11-13,257-255 15-20,253-248 21-22,246-245 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,265-258 BULt: Bulge on transcript side 14-14,254-254 SIL: Symmetric internal loop x-x,247-247 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.970154817116405 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167h-Probable-3p-star_Sobic.009G236500.1_266_TPlot.pdf Position Reads Category 265 3 0 266 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAAGGAGCGGGAGAGGGUGGAUGAGGUCGGC 3' Transcript: Sobic.009G250900.2:699-729 Slice Site:712 ||||o|| o||||||||o |o|| 3' CUUCUUC--UCUCUCCCAU--------GUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.009G250900.2:712 MFE of perfect match: -40.10 MFE of this site: -27.00 MFEratio: 0.673316708229426 Allen et al. score: 21 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,729-726 5-14,717-708 15-21,705-699 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,725-718 BULt: Bulge on transcript side x-x,707-706 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.988999372706973 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR529-Probable-3p-star_Sobic.009G250900.2_712_TPlot.pdf Position Reads Category 415 1 4 416 1 4 426 2 0 446 1 4 650 1 4 655 1 4 685 1 4 712 1 4 <<<<<<<<<< 723 1 4 730 1 4 773 1 4 778 1 4 1171 1 4 1172 1 4 1177 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGAGGCUGUACAAGGUGAUG 3' Transcript: Sobic.010G038800.2:910-931 Slice Site:922 o||||o|||| ||| o|||| 3' UCACUUCGAC--GUUGUACUAG 5' Query: miR167k-Known-3p-star SiteID: Sobic.010G038800.2:922 MFE of perfect match: -34.60 MFE of this site: -23.60 MFEratio: 0.682080924855491 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 2-6,930-926 8-10,924-922 11-20,919-910 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,931-931 UP5: Unpaired region at 5' of query 7-7,925-925 SIL: Symmetric internal loop x-x,921-920 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.858154348227826 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR167k-Known-3p-star_Sobic.010G038800.2_922_TPlot.pdf Position Reads Category 1 1 4 225 1 4 234 1 4 300 1 4 302 1 4 310 1 4 319 1 4 324 1 4 361 1 4 621 1 4 623 1 4 651 1 4 733 1 4 786 1 4 796 1 4 845 1 4 900 1 4 902 1 4 909 2 2 922 1 4 <<<<<<<<<< 923 1 4 925 1 4 927 2 2 928 2 2 932 1 4 935 2 2 936 1 4 937 1 4 938 2 2 939 3 2 940 1 4 941 1 4 942 1 4 943 1 4 945 1 4 952 1 4 953 1 4 963 1 4 967 1 4 974 1 4 976 1 4 979 2 2 983 1 4 985 3 2 986 1 4 988 2 2 989 1 4 990 1 4 991 1 4 993 1 4 997 4 0 1000 1 4 1003 1 4 1015 1 4 1020 1 4 1058 1 4 1113 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGGAGGAGGAGAGGGGGAA 3' Transcript: Sobic.010G065400.3:774-794 Slice Site:785 |||||||o||||||o o | 3' CUACCUCUUCCUCUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.010G065400.3:785 MFE of perfect match: -39.00 MFE of this site: -29.20 MFEratio: 0.748717948717949 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-3,792-792 5-5,790-790 7-21,788-774 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,794-793 UP5: Unpaired region at 5' of query 4-4,791-791 SIL: Symmetric internal loop 6-6,789-789 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.594476595531589 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR164a-Known-3p-star_Sobic.010G065400.3_785_TPlot.pdf Position Reads Category 666 1 4 749 1 4 777 1 4 784 1 4 785 1 4 <<<<<<<<<< 792 1 4 794 1 4 801 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCGGCCGGAGGAGAGCUAUGGGUC 3' Transcript: Sobic.010G094800.1:486-509 Slice Site:496 || |||o|||||||||| |o| 3' GGACGGUCUCCUCUCGA----CGG 5' Query: miR399b-Probable-5p-star SiteID: Sobic.010G094800.1:496 MFE of perfect match: -45.40 MFE of this site: -33.20 MFEratio: 0.731277533039648 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,509-507 4-17,502-489 19-20,487-486 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,506-503 BULt: Bulge on transcript side 18-18,488-488 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.466563462061153 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR399b-Probable-5p-star_Sobic.010G094800.1_496_TPlot.pdf Position Reads Category 341 1 4 357 1 4 379 1 4 384 1 4 388 1 4 393 1 4 405 1 4 495 2 2 496 1 4 <<<<<<<<<< 499 1 4 595 1 4 600 1 4 608 1 4 633 1 4 634 1 4 635 1 4 636 2 2 637 1 4 644 1 4 646 1 4 647 1 4 648 1 4 650 1 4 651 1 4 652 1 4 654 1 4 655 2 2 656 4 0 664 1 4 665 2 2 670 1 4 674 1 4 679 1 4 683 1 4 684 1 4 685 1 4 697 1 4 705 1 4 706 1 4 707 2 2 708 3 2 709 1 4 711 1 4 713 1 4 722 1 4 731 1 4 732 1 4 737 1 4 740 1 4 741 1 4 742 1 4 744 1 4 745 1 4 748 1 4 749 1 4 752 3 2 763 1 4 767 1 4 769 1 4 772 2 2 775 1 4 778 1 4 780 1 4 782 1 4 791 1 4 808 2 2 810 2 2 812 1 4 813 2 2 814 1 4 815 1 4 817 2 2 818 2 2 819 1 4 822 1 4 823 2 2 828 1 4 833 1 4 834 1 4 836 1 4 838 2 2 840 1 4 841 3 2 842 1 4 843 2 2 844 3 2 845 1 4 848 1 4 850 1 4 852 2 2 857 1 4 858 1 4 861 1 4 862 1 4 864 2 2 865 2 2 866 1 4 880 1 4 884 1 4 891 1 4 948 1 4 950 1 4 953 2 2 958 2 2 964 1 4 970 1 4 979 2 2 982 1 4 983 1 4 985 1 4 986 1 4 987 1 4 996 1 4 999 1 4 1000 2 2 1001 2 2 1002 2 2 1004 2 2 1006 1 4 1007 2 2 1008 1 4 1010 1 4 1012 2 2 1013 1 4 1015 1 4 1016 1 4 1017 2 2 1021 1 4 1067 1 4 1077 1 4 1085 1 4 1097 1 4 1098 2 2 --------------------------------------------------- --------------------------------------------------- 5' GUGGAGGAGAGCUAUGGAUCAGGGUACGGC 3' Transcript: Sobic.010G094800.1:685-714 Slice Site:705 | o||o||||| |||||||o|| 3' CUUCUUCUCUC---------UCCCAUGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.010G094800.1:705 MFE of perfect match: -40.10 MFE of this site: -29.00 MFEratio: 0.723192019950125 Allen et al. score: 21 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,714-705 11-19,695-687 21-21,685-685 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,704-696 BULt: Bulge on transcript side 20-20,686-686 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.748433773912502 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR529-Probable-3p-star_Sobic.010G094800.1_705_TPlot.pdf Position Reads Category 341 1 4 357 1 4 379 1 4 384 1 4 388 1 4 393 1 4 405 1 4 495 2 2 496 1 4 499 1 4 595 1 4 600 1 4 608 1 4 633 1 4 634 1 4 635 1 4 636 2 2 637 1 4 644 1 4 646 1 4 647 1 4 648 1 4 650 1 4 651 1 4 652 1 4 654 1 4 655 2 2 656 4 0 664 1 4 665 2 2 670 1 4 674 1 4 679 1 4 683 1 4 684 1 4 685 1 4 697 1 4 705 1 4 <<<<<<<<<< 706 1 4 707 2 2 708 3 2 709 1 4 711 1 4 713 1 4 722 1 4 731 1 4 732 1 4 737 1 4 740 1 4 741 1 4 742 1 4 744 1 4 745 1 4 748 1 4 749 1 4 752 3 2 763 1 4 767 1 4 769 1 4 772 2 2 775 1 4 778 1 4 780 1 4 782 1 4 791 1 4 808 2 2 810 2 2 812 1 4 813 2 2 814 1 4 815 1 4 817 2 2 818 2 2 819 1 4 822 1 4 823 2 2 828 1 4 833 1 4 834 1 4 836 1 4 838 2 2 840 1 4 841 3 2 842 1 4 843 2 2 844 3 2 845 1 4 848 1 4 850 1 4 852 2 2 857 1 4 858 1 4 861 1 4 862 1 4 864 2 2 865 2 2 866 1 4 880 1 4 884 1 4 891 1 4 948 1 4 950 1 4 953 2 2 958 2 2 964 1 4 970 1 4 979 2 2 982 1 4 983 1 4 985 1 4 986 1 4 987 1 4 996 1 4 999 1 4 1000 2 2 1001 2 2 1002 2 2 1004 2 2 1006 1 4 1007 2 2 1008 1 4 1010 1 4 1012 2 2 1013 1 4 1015 1 4 1016 1 4 1017 2 2 1021 1 4 1067 1 4 1077 1 4 1085 1 4 1097 1 4 1098 2 2 --------------------------------------------------- --------------------------------------------------- 5' UGCUUUAGUCAUUGACCGGCUCCAC 3' Transcript: Sobic.010G153100.1:318-342 Slice Site:333 ||| | || |o|||o||||||| 3' UCGA---C-GU-AUUGGUCGAGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.010G153100.1:333 MFE of perfect match: -39.10 MFE of this site: -26.10 MFEratio: 0.667519181585678 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-13,342-330 14-15,328-327 16-16,325-325 17-19,321-319 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,329-329 BULt: Bulge on transcript side x-x,326-326 BULt: Bulge on transcript side x-x,324-322 BULt: Bulge on transcript side 20-20,318-318 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999231696754644 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166j-Probable-5p-star_Sobic.010G153100.1_333_TPlot.pdf Position Reads Category 53 1 4 327 1 4 332 2 2 333 1 4 <<<<<<<<<< 345 2 2 346 5 0 347 4 2 349 2 2 350 1 4 351 1 4 352 1 4 353 2 2 354 3 2 355 4 2 356 1 4 357 1 4 358 1 4 359 1 4 360 2 2 361 1 4 362 1 4 373 1 4 390 3 2 398 2 2 403 1 4 416 1 4 418 1 4 425 1 4 450 1 4 458 1 4 459 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGGAGAAGUUUGCGGUGGG 3' Transcript: Sobic.010G266200.1:621-641 Slice Site:632 |o|||||||||| o|o|| 3' CAAUCUCUUCAAACUGUAUCC 5' Query: miR6285-Probable-5p-star SiteID: Sobic.010G266200.1:632 MFE of perfect match: -32.90 MFE of this site: -23.20 MFEratio: 0.70516717325228 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,641-637 8-19,634-623 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-7,636-635 SIL: Symmetric internal loop 20-21,622-621 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.00959493747194928 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR6285-Probable-5p-star_Sobic.010G266200.1_632_TPlot.pdf Position Reads Category 81 1 4 458 1 4 469 1 4 503 1 4 506 1 4 507 2 2 524 1 4 531 2 2 534 2 2 536 1 4 540 1 4 544 1 4 548 1 4 586 1 4 595 1 4 601 1 4 602 1 4 603 1 4 605 1 4 609 1 4 610 2 2 611 2 2 613 4 0 615 2 2 620 1 4 622 2 2 624 1 4 625 1 4 627 1 4 628 1 4 629 1 4 630 1 4 631 1 4 632 2 2 <<<<<<<<<< 639 1 4 645 2 2 647 2 2 648 2 2 650 1 4 653 1 4 665 1 4 766 1 4 796 1 4 843 1 4 845 1 4 905 1 4 ---------------------------------------------------