# CleaveLand4 4.5 # Tue Feb 27 21:47:40 CST 2024 # Degradome Density File: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt # Query Alignment file: miRNA.fa_GSTAr.txt # Transcriptome: /public/home/zhenglw/work/sRNA_database/Sbicolor_313_v3.1.cds.fa # P-value cutoff: 1 # Category cutoff: 4 # Output Format: Pretty --------------------------------------------------- 5' AGGGAAGGCAACCU-CCAGG 3' Transcript: Sobic.001G012500.1:391-409 Slice Site:401 |o|o|| o||||| |||o 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.001G012500.1:401 MFE of perfect match: -29.60 MFE of this site: -19.30 MFEratio: 0.652027027027027 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,408-405 8-13,403-398 15-20,396-391 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,409-409 UP5: Unpaired region at 5' of query 6-7,404-404 AILq: Asymmetric internal loop with more nts on the query side 14-14,397-397 SIL: Symmetric internal loop Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999981390913 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.001G012500.1_401_TPlot.pdf Position Reads Category 12 1 4 95 1 4 102 1 4 105 1 4 292 1 4 293 1 4 370 1 4 401 1 4 <<<<<<<<<< 414 1 4 451 1 4 524 1 4 527 1 4 529 1 4 535 1 4 595 1 4 655 1 4 656 1 4 682 1 4 692 1 4 700 1 4 703 1 4 742 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGCUGAUUAGUGAAGGGGAAGAGGAGC 3' Transcript: Sobic.001G038000.2:415-442 Slice Site:432 |||||||o |||o|o|||| |||| 3' CUCGACUGU---CUUUCUCUUCA-CUCG 5' Query: miR156a-Known-3p-star SiteID: Sobic.001G038000.2:432 MFE of perfect match: -45.20 MFE of this site: -30.94 MFEratio: 0.684513274336283 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,442-439 6-15,436-427 17-24,422-415 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,438-437 AILt: Asymmetric internal loop with more nts on the transcript side 16-16,426-423 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.32487212931573 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156a-Known-3p-star_Sobic.001G038000.2_432_TPlot.pdf Position Reads Category 241 1 4 432 1 4 <<<<<<<<<< 699 1 4 737 1 4 1315 1 4 1322 1 4 1323 2 0 --------------------------------------------------- --------------------------------------------------- 5' GCGGAUGGCGAGGGAGAGGAUUCAG-GAGC 3' Transcript: Sobic.001G040500.2:447-475 Slice Site:463 |||||||o| ||oo|||| ||| |||| 3' CGCCUACUG-UCUUUCUC----GUCACUCG 5' Query: miR156g-Known-3p-star SiteID: Sobic.001G040500.2:463 MFE of perfect match: -50.00 MFE of this site: -35.30 MFEratio: 0.706 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,475-472 6-8,471-469 9-16,464-457 17-25,455-447 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,x-x BULq: Bulge on query side x-x,468-465 BULt: Bulge on transcript side x-x,456-456 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.188420879619281 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156g-Known-3p-star_Sobic.001G040500.2_463_TPlot.pdf Position Reads Category 463 1 4 <<<<<<<<<< 971 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGCUCACCGUGCGGUGGCGUGC 3' Transcript: Sobic.001G084600.1:1031-1053 Slice Site:1044 o||o|||| o|||| |||| 3' UUCGGGUGG----UCACCACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.001G084600.1:1044 MFE of perfect match: -39.80 MFE of this site: -27.30 MFEratio: 0.685929648241206 Allen et al. score: 13 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,1053-1050 6-10,1048-1044 11-18,1039-1032 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,1049-1049 SIL: Symmetric internal loop x-x,1043-1040 BULt: Bulge on transcript side 19-19,1031-1031 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.881208640737879 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-3p-star_Sobic.001G084600.1_1044_TPlot.pdf Position Reads Category 441 1 4 628 1 4 1044 1 4 <<<<<<<<<< 1199 1 4 1233 1 4 --------------------------------------------------- --------------------------------------------------- 5' UUGAAGCACAGCGGAGCACU 3' Transcript: Sobic.001G111500.1:152-171 Slice Site:162 |||o||||o| o| || 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.001G111500.1:162 MFE of perfect match: -29.60 MFE of this site: -19.40 MFEratio: 0.655405405405405 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-4,169-168 6-7,166-165 9-18,163-154 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,171-170 UP5: Unpaired region at 5' of query 5-5,167-167 SIL: Symmetric internal loop 8-8,164-164 SIL: Symmetric internal loop 19-20,153-152 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999840507703 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.001G111500.1_162_TPlot.pdf Position Reads Category 38 1 4 145 1 4 162 1 4 <<<<<<<<<< 260 1 4 347 1 4 387 1 4 441 1 4 528 1 4 570 2 2 679 2 2 685 1 4 792 1 4 892 1 4 903 1 4 905 1 4 954 1 4 983 1 4 1013 1 4 1019 1 4 1038 1 4 1039 1 4 1040 3 2 1041 4 2 1042 5 1 1043 4 2 1044 2 2 1045 1 4 1046 2 2 1050 1 4 1059 1 4 1064 2 2 1065 4 2 1066 1 4 1068 1 4 1070 1 4 1147 1 4 1187 1 4 1323 1 4 1325 2 2 1412 1 4 1486 1 4 1491 1 4 1506 1 4 1525 1 4 1542 1 4 1546 1 4 1554 1 4 1555 1 4 1561 1 4 1564 2 2 1565 1 4 1566 1 4 1567 1 4 1568 1 4 1574 2 2 1594 1 4 1603 1 4 1693 1 4 1711 1 4 1721 1 4 1728 1 4 1742 1 4 1743 1 4 1879 1 4 1896 3 2 1897 1 4 1900 2 2 1908 1 4 1913 1 4 1914 3 2 1916 1 4 1917 2 2 1919 1 4 1920 1 4 1924 1 4 1929 2 2 1930 1 4 1931 1 4 1933 1 4 1936 1 4 1941 1 4 1942 1 4 1944 1 4 1948 1 4 1949 1 4 1950 2 2 1955 1 4 1956 1 4 2034 3 2 2035 1 4 2040 1 4 2047 1 4 2048 1 4 2049 1 4 2050 1 4 2063 1 4 2089 1 4 2133 1 4 2158 1 4 2169 1 4 2216 1 4 2221 1 4 2223 1 4 2224 1 4 2225 1 4 2232 1 4 2234 1 4 2236 1 4 2237 1 4 2238 3 2 2239 3 2 2240 1 4 2241 1 4 2242 2 2 2243 1 4 2244 1 4 2248 1 4 2251 2 2 2261 1 4 2300 1 4 2304 1 4 2306 1 4 2307 1 4 2356 1 4 2358 1 4 2457 1 4 2458 1 4 2459 2 2 2567 1 4 2573 1 4 2613 1 4 2648 1 4 2668 1 4 2669 1 4 2709 1 4 2731 1 4 2733 1 4 2746 1 4 2747 1 4 2763 1 4 2778 1 4 2787 1 4 2864 1 4 2865 1 4 2868 1 4 2870 1 4 2872 3 2 2874 1 4 2875 1 4 2877 2 2 2879 1 4 2880 2 2 2881 1 4 2882 1 4 2883 1 4 2884 4 2 2885 2 2 2886 5 1 2887 1 4 2888 4 2 2889 1 4 2890 2 2 2891 2 2 2893 1 4 2894 1 4 2901 1 4 2904 1 4 2907 1 4 2914 1 4 2915 2 2 2916 3 2 2917 1 4 2986 1 4 3118 1 4 3120 1 4 3154 1 4 3156 1 4 3158 1 4 3164 1 4 3167 1 4 3177 1 4 3215 1 4 3231 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGAGAACC-UGGUGUUGCUGU 3' Transcript: Sobic.001G111800.1:678-698 Slice Site:689 ||| ||||| ||o||o|||||o 3' ACCGCUUGGAACUACGACGACG 5' Query: miR172a-Probable-5p-star SiteID: Sobic.001G111800.1:689 MFE of perfect match: -44.70 MFE of this site: -31.00 MFEratio: 0.693512304250559 Allen et al. score: 4.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-12,698-687 14-18,686-682 20-22,680-678 Unpaired Regions (query5'-query3',transcript3'-transcript5') 13-13,x-x BULq: Bulge on query side 19-19,681-681 SIL: Symmetric internal loop Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.487765537003354 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR172a-Probable-5p-star_Sobic.001G111800.1_689_TPlot.pdf Position Reads Category 577 1 4 689 1 4 <<<<<<<<<< 793 1 4 1221 1 4 1281 1 4 1422 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGAUCGAUGACAAGGAUCAC 3' Transcript: Sobic.001G117800.1:2005-2025 Slice Site:2014 ||o||| ||o|||||| ||| 3' CUUUAG-UAUUGUUCC--GUG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.001G117800.1:2014 MFE of perfect match: -27.30 MFE of this site: -19.50 MFEratio: 0.714285714285714 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,2025-2023 4-12,2020-2012 13-18,2010-2005 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,2022-2021 BULt: Bulge on transcript side x-x,2011-2011 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.922630124541865 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR8175a-Probable-5p-star_Sobic.001G117800.1_2014_TPlot.pdf Position Reads Category 396 1 4 1029 1 4 1037 1 4 1113 2 1 1170 1 4 1186 1 4 1588 1 4 1725 1 4 1835 1 4 1996 2 1 2014 1 4 <<<<<<<<<< 2017 1 4 2188 1 4 2478 1 4 2509 1 4 2540 1 4 2554 1 4 2557 1 4 2567 1 4 2582 1 4 2781 1 4 2906 1 4 2916 1 4 2919 1 4 3088 1 4 3104 1 4 3108 2 1 3111 2 1 3112 1 4 3114 1 4 3117 1 4 3118 1 4 3120 2 1 3121 1 4 3123 1 4 3124 1 4 3125 1 4 3127 1 4 3129 1 4 3131 1 4 3135 1 4 3139 1 4 3144 1 4 3152 1 4 3153 1 4 3175 1 4 3177 1 4 3187 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGAGACGCUCCACAUGGGGGGC 3' Transcript: Sobic.001G149500.1:26-48 Slice Site:38 || o|||||| |||||oo| 3' ACCGC--UGAGGUG-ACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.001G149500.1:38 MFE of perfect match: -42.90 MFE of this site: -28.48 MFEratio: 0.663869463869464 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,48-41 9-15,39-33 18-19,28-27 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,40-40 BULt: Bulge on transcript side 16-17,32-29 AILt: Asymmetric internal loop with more nts on the transcript side 20-20,26-26 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.969385797894316 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-5p-mature_Sobic.001G149500.1_38_TPlot.pdf Position Reads Category 35 1 4 37 1 4 38 1 4 <<<<<<<<<< 40 1 4 41 1 4 44 1 4 46 1 4 48 1 4 49 2 3 50 2 3 51 2 3 52 2 3 53 10 2 54 2 3 55 11 1 56 6 2 57 6 2 58 10 2 59 2 3 62 1 4 64 1 4 69 1 4 70 1 4 71 3 3 73 3 3 74 1 4 75 3 3 76 6 2 77 1 4 78 4 2 79 2 3 86 2 3 87 1 4 89 3 3 90 4 2 91 4 2 92 2 3 94 1 4 97 2 3 100 4 2 101 1 4 102 1 4 103 1 4 106 1 4 107 4 2 108 4 2 109 6 2 110 1 4 111 2 3 112 5 2 122 1 4 126 1 4 169 1 4 173 1 4 174 1 4 176 1 4 182 1 4 188 1 4 191 1 4 193 1 4 194 3 3 195 2 3 196 10 2 197 4 2 198 3 3 199 1 4 200 1 4 201 2 3 202 6 2 203 4 2 204 4 2 205 3 3 206 3 3 207 3 3 208 7 2 209 6 2 210 6 2 211 11 1 212 4 2 213 10 2 214 10 2 215 8 2 216 8 2 217 3 3 218 3 3 219 1 4 220 6 2 221 1 4 226 1 4 229 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAGCACAAGAAGGCCGAG 3' Transcript: Sobic.001G149500.1:79-99 Slice Site:89 o||o|o||||| oo||o|o 3' UUCUUUGUGUUGG-UUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.001G149500.1:89 MFE of perfect match: -29.60 MFE of this site: -20.20 MFEratio: 0.682432432432432 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,99-93 10-20,89-79 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-9,92-90 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 3 Degradome p-value: 0.0445465982792407 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.001G149500.1_89_TPlot.pdf Position Reads Category 35 1 4 37 1 4 38 1 4 40 1 4 41 1 4 44 1 4 46 1 4 48 1 4 49 2 3 50 2 3 51 2 3 52 2 3 53 10 2 54 2 3 55 11 1 56 6 2 57 6 2 58 10 2 59 2 3 62 1 4 64 1 4 69 1 4 70 1 4 71 3 3 73 3 3 74 1 4 75 3 3 76 6 2 77 1 4 78 4 2 79 2 3 86 2 3 87 1 4 89 3 3 <<<<<<<<<< 90 4 2 91 4 2 92 2 3 94 1 4 97 2 3 100 4 2 101 1 4 102 1 4 103 1 4 106 1 4 107 4 2 108 4 2 109 6 2 110 1 4 111 2 3 112 5 2 122 1 4 126 1 4 169 1 4 173 1 4 174 1 4 176 1 4 182 1 4 188 1 4 191 1 4 193 1 4 194 3 3 195 2 3 196 10 2 197 4 2 198 3 3 199 1 4 200 1 4 201 2 3 202 6 2 203 4 2 204 4 2 205 3 3 206 3 3 207 3 3 208 7 2 209 6 2 210 6 2 211 11 1 212 4 2 213 10 2 214 10 2 215 8 2 216 8 2 217 3 3 218 3 3 219 1 4 220 6 2 221 1 4 226 1 4 229 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGCGGUGCGGGGCGGCAAGGC 3' Transcript: Sobic.001G251300.1:1235-1256 Slice Site:1246 |||| o|o|o||| o|| |||| 3' ACCG-UAUGUCCC-UCGGUCCG 5' Query: miR160-Probable-5p-mature SiteID: Sobic.001G251300.1:1246 MFE of perfect match: -43.80 MFE of this site: -29.10 MFEratio: 0.664383561643836 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,1256-1253 6-8,1251-1249 9-16,1247-1240 17-20,1238-1235 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,1252-1252 SIL: Symmetric internal loop x-x,1248-1248 BULt: Bulge on transcript side x-x,1239-1239 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.991692227647592 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR160-Probable-5p-mature_Sobic.001G251300.1_1246_TPlot.pdf Position Reads Category 717 1 4 1246 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAGCAUCAUUGACAGGGCGU 3' Transcript: Sobic.001G333900.1:1617-1636 Slice Site:1627 ||o |||| |o|||o||| 3' CUU-UAGU-AUUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.001G333900.1:1627 MFE of perfect match: -27.30 MFE of this site: -17.80 MFEratio: 0.652014652014652 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-11,1634-1626 12-15,1624-1621 16-18,1619-1617 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1636-1635 UP5: Unpaired region at 5' of query x-x,1625-1625 BULt: Bulge on transcript side x-x,1620-1620 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999964962087657 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR8175g-Probable-5p-star_Sobic.001G333900.1_1627_TPlot.pdf Position Reads Category 1559 1 4 1561 1 4 1562 3 2 1563 1 4 1564 8 0 1565 3 2 1566 2 3 1567 1 4 1627 1 4 <<<<<<<<<< 1709 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGUCAUGAUAAGGCUGC 3' Transcript: Sobic.001G382000.2:971-989 Slice Site:979 ||oo||||o|o||||| o| 3' CUUUAGUAUUGUUCCG-UG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.001G382000.2:979 MFE of perfect match: -27.30 MFE of this site: -23.40 MFEratio: 0.857142857142857 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,989-988 3-18,986-971 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,987-987 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.122082597392661 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR8175a-Probable-5p-star_Sobic.001G382000.2_979_TPlot.pdf Position Reads Category 19 1 4 381 1 4 385 1 4 419 1 4 470 1 4 543 1 4 601 1 4 667 1 4 729 1 4 956 1 4 979 1 4 <<<<<<<<<< 982 1 4 --------------------------------------------------- --------------------------------------------------- 5' ACGGGUAAAGUAAUUGGUGGAA 3' Transcript: Sobic.001G391400.1:547-568 Slice Site:559 ||||||||o|||| |o o|| 3' UACCCAUUUCGUUAAGCGGUUU 5' Query: miR5564b-Known-3p-star SiteID: Sobic.001G391400.1:559 MFE of perfect match: -36.00 MFE of this site: -24.90 MFEratio: 0.691666666666667 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,568-566 5-6,564-563 8-20,561-549 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,565-565 SIL: Symmetric internal loop 7-7,562-562 SIL: Symmetric internal loop 21-22,548-547 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.389741446888442 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564b-Known-3p-star_Sobic.001G391400.1_559_TPlot.pdf Position Reads Category 261 1 4 262 1 4 269 1 4 434 1 4 436 1 4 441 3 2 471 1 4 475 1 4 483 1 4 486 1 4 491 1 4 504 1 4 506 1 4 521 1 4 533 1 4 556 2 2 557 1 4 558 1 4 559 1 4 <<<<<<<<<< 561 4 0 566 1 4 567 1 4 570 2 2 571 1 4 591 1 4 611 1 4 803 1 4 891 1 4 892 1 4 946 1 4 987 1 4 1005 1 4 1064 1 4 1083 1 4 1086 1 4 1152 1 4 1153 1 4 1154 1 4 1155 3 2 1163 1 4 1173 2 2 1174 1 4 1177 2 2 1178 2 2 --------------------------------------------------- --------------------------------------------------- 5' GUGCAGCGUCG-CAAGAAAG 3' Transcript: Sobic.001G457400.3:995-1013 Slice Site:1005 o||||||o||o ||||| 3' UACGUCGUAGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.001G457400.3:1005 MFE of perfect match: -32.70 MFE of this site: -23.70 MFEratio: 0.724770642201835 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 4-8,1010-1006 10-20,1005-995 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,1013-1011 UP5: Unpaired region at 5' of query 9-9,x-x BULq: Bulge on query side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.41390905692171 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR172b-Probable-3p-mature_Sobic.001G457400.3_1005_TPlot.pdf Position Reads Category 1003 1 4 1005 1 4 <<<<<<<<<< 1693 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGUCUGCCGGUGGCG-GC 3' Transcript: Sobic.001G510800.1:54-71 Slice Site:63 oo|o|oo||o|||| | || 3' UUCGGGUGGUCACCACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.001G510800.1:63 MFE of perfect match: -39.80 MFE of this site: -25.90 MFEratio: 0.650753768844221 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,71-70 4-4,69-69 6-19,67-54 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,x-x BULq: Bulge on query side 5-5,68-68 SIL: Symmetric internal loop Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.997041894908346 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-3p-star_Sobic.001G510800.1_63_TPlot.pdf Position Reads Category 5 1 4 14 1 4 63 1 4 <<<<<<<<<< 88 1 4 91 1 4 109 1 4 175 1 4 214 1 4 286 2 2 288 1 4 289 1 4 290 1 4 292 3 2 293 1 4 294 4 0 295 2 2 297 1 4 298 2 2 299 1 4 300 1 4 302 2 2 304 3 2 305 1 4 306 1 4 307 2 2 308 2 2 310 1 4 361 1 4 381 1 4 386 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGCUCC-AGGAGGCCGUCACCG 3' Transcript: Sobic.002G004000.2:614-634 Slice Site:624 ||||| ||||||| |o| ||| 3' ACGAGGUUCCUCCGACGG-GGC 5' Query: miR396-Probable-3p-star SiteID: Sobic.002G004000.2:624 MFE of perfect match: -48.20 MFE of this site: -32.70 MFEratio: 0.678423236514523 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,634-632 4-6,630-628 8-14,626-620 16-20,619-615 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,631-631 BULt: Bulge on transcript side 7-7,627-627 SIL: Symmetric internal loop 15-15,x-x BULq: Bulge on query side 21-21,614-614 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.8827979440382 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-3p-star_Sobic.002G004000.2_624_TPlot.pdf Position Reads Category 113 1 4 305 1 4 309 2 1 311 1 4 322 1 4 435 1 4 464 1 4 483 1 4 484 1 4 515 1 4 519 2 1 526 1 4 566 1 4 604 1 4 609 1 4 613 1 4 615 1 4 624 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGUG-UCAGAGCCGGCGGGGAGA 3' Transcript: Sobic.002G214300.1:477-498 Slice Site:488 |||| |||o|o|||o ||o||| 3' CCACUAGUUUUGGCU-CCUCUCA 5' Query: miR156h-Probable-3p-star SiteID: Sobic.002G214300.1:488 MFE of perfect match: -40.60 MFE of this site: -30.50 MFEratio: 0.751231527093596 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,497-492 8-17,490-481 19-22,480-477 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,498-498 UP5: Unpaired region at 5' of query x-x,491-491 BULt: Bulge on transcript side 18-18,x-x BULq: Bulge on query side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0899764132666885 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156h-Probable-3p-star_Sobic.002G214300.1_488_TPlot.pdf Position Reads Category 488 1 4 <<<<<<<<<< 507 1 4 515 1 4 518 1 4 523 1 4 665 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGCAGCGUCAUCUUUGUUU 3' Transcript: Sobic.002G294800.1:1396-1415 Slice Site:1406 o||||||o||||| 3' UACGUCGUAGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.002G294800.1:1406 MFE of perfect match: -32.70 MFE of this site: -22.40 MFEratio: 0.685015290519878 Allen et al. score: 14 Paired Regions (query5'-query3',transcript3'-transcript5') 8-20,1408-1396 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-7,1415-1409 UP5: Unpaired region at 5' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.786096284719762 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR172b-Probable-3p-mature_Sobic.002G294800.1_1406_TPlot.pdf Position Reads Category 421 1 4 701 1 4 705 1 4 1406 1 4 <<<<<<<<<< 1407 1 4 1411 1 4 1425 1 4 1561 1 4 1562 1 4 1590 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGAUCUGAAUGAGCAGGCAC 3' Transcript: Sobic.002G318600.1:779-799 Slice Site:790 ||o||| ||o| |||||| 3' CUUUAG---UAUUGUUCCGUG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.002G318600.1:790 MFE of perfect match: -27.30 MFE of this site: -17.90 MFEratio: 0.655677655677656 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,799-794 9-12,791-788 13-18,784-779 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-8,793-792 SIL: Symmetric internal loop x-x,787-785 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999926172649448 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR8175a-Probable-5p-star_Sobic.002G318600.1_790_TPlot.pdf Position Reads Category 182 1 4 443 1 4 444 4 0 445 1 4 446 1 4 675 1 4 681 1 4 726 1 4 731 1 4 790 1 4 <<<<<<<<<< 794 1 4 963 1 4 1035 1 4 1283 1 4 1291 1 4 1353 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGCAACACAAUCAAGCAAA 3' Transcript: Sobic.002G413400.2:306-325 Slice Site:316 o|| |||||||o||| |||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.002G413400.2:316 MFE of perfect match: -29.60 MFE of this site: -20.00 MFEratio: 0.675675675675676 Allen et al. score: 4.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,325-322 6-16,320-310 18-20,308-306 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,321-321 SIL: Symmetric internal loop 17-17,309-309 SIL: Symmetric internal loop Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999959457630976 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.002G413400.2_316_TPlot.pdf Position Reads Category 79 1 4 200 1 4 208 1 4 279 1 4 289 1 4 293 1 4 300 1 4 315 1 4 316 1 4 <<<<<<<<<< 318 2 1 319 1 4 393 1 4 394 2 1 396 1 4 406 2 1 658 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGCUCG-UCGCCAUUGUCGGC 3' Transcript: Sobic.002G414400.1:280-300 Slice Site:291 ||||||o || ||o||||oo| 3' CACGAGUGAGA-GUGACAGUUG 5' Query: miR156f-Probable-5p-mature SiteID: Sobic.002G414400.1:291 MFE of perfect match: -39.70 MFE of this site: -26.10 MFEratio: 0.657430730478589 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,300-291 12-13,288-287 15-21,286-280 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,290-289 AILt: Asymmetric internal loop with more nts on the transcript side 14-14,x-x BULq: Bulge on query side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.54215133970381 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156f-Probable-5p-mature_Sobic.002G414400.1_291_TPlot.pdf Position Reads Category 109 1 4 222 1 4 223 1 4 226 1 4 232 2 0 237 1 4 266 1 4 291 1 4 <<<<<<<<<< 292 1 4 --------------------------------------------------- --------------------------------------------------- 5' UAGAAGGGCAGCCAGCCCGC 3' Transcript: Sobic.003G039300.1:1458-1477 Slice Site:1468 ||||o o||o|||o|| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.003G039300.1:1468 MFE of perfect match: -29.60 MFE of this site: -22.90 MFEratio: 0.773648648648649 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 4-13,1474-1465 15-19,1463-1459 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,1477-1475 UP5: Unpaired region at 5' of query 14-14,1464-1464 SIL: Symmetric internal loop 20-20,1458-1458 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.563234554369088 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.003G039300.1_1468_TPlot.pdf Position Reads Category 451 1 4 464 1 4 704 1 4 932 1 4 952 1 4 1026 1 4 1055 1 4 1313 1 4 1315 1 4 1326 1 4 1327 1 4 1337 1 4 1358 1 4 1468 1 4 <<<<<<<<<< 1515 1 4 1705 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUGCUCUCUCUCUCUCUCUCU 3' Transcript: Sobic.003G291100.1:116-136 Slice Site:126 |||||||||||| ||| || 3' CACGAGAGAGAGA-AGACAGU 5' Query: miR156h-Probable-5p-mature SiteID: Sobic.003G291100.1:126 MFE of perfect match: -37.40 MFE of this site: -25.00 MFEratio: 0.668449197860963 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,135-134 5-7,132-130 8-19,128-117 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,136-136 UP5: Unpaired region at 5' of query 4-4,133-133 SIL: Symmetric internal loop x-x,129-129 BULt: Bulge on transcript side 20-20,116-116 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.195675833447841 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156h-Probable-5p-mature_Sobic.003G291100.1_126_TPlot.pdf Position Reads Category 126 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAGCUGGCAGAAACAGAAGUGCCAGAGC 3' Transcript: Sobic.003G296300.1:580-607 Slice Site:594 ||||||o|||||| |||||| |||| 3' CUCGACUGUCUUUCUCUUCA----CUCG 5' Query: miR156a-Known-3p-star SiteID: Sobic.003G296300.1:594 MFE of perfect match: -45.20 MFE of this site: -34.20 MFEratio: 0.756637168141593 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,607-604 5-10,599-594 12-24,592-580 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,603-600 BULt: Bulge on transcript side 11-11,593-593 SIL: Symmetric internal loop Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0221986541742685 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156a-Known-3p-star_Sobic.003G296300.1_594_TPlot.pdf Position Reads Category 364 1 4 464 1 4 594 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAGGAAC-C-ACCGACCAGA 3' Transcript: Sobic.003G305700.1:371-388 Slice Site:379 o||o||| | |||o||||o| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.003G305700.1:379 MFE of perfect match: -29.60 MFE of this site: -21.20 MFEratio: 0.716216216216216 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,388-379 12-12,378-378 14-20,377-371 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,x-x BULq: Bulge on query side 13-13,x-x BULq: Bulge on query side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.128341919285314 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.003G305700.1_379_TPlot.pdf Position Reads Category 11 1 4 32 1 4 33 1 4 46 1 4 171 1 4 175 1 4 176 1 4 179 1 4 185 1 4 203 1 4 208 1 4 210 1 4 213 2 2 219 1 4 220 1 4 221 1 4 245 1 4 249 1 4 253 1 4 254 1 4 255 1 4 261 1 4 262 1 4 265 1 4 266 1 4 267 1 4 282 2 2 321 1 4 357 1 4 358 1 4 366 1 4 379 2 2 <<<<<<<<<< 381 1 4 384 1 4 385 4 0 386 2 2 387 1 4 388 1 4 389 3 2 390 3 2 391 3 2 392 2 2 393 3 2 394 1 4 397 1 4 410 1 4 466 1 4 467 1 4 478 1 4 496 1 4 497 1 4 501 2 2 502 2 2 505 2 2 507 1 4 545 1 4 608 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGCUUACCUCUCAUUUGUUACC 3' Transcript: Sobic.003G317500.1:1106-1128 Slice Site:1119 |||||o| ||||| |o|||o||| 3' CACGAGU-GAGAGAAGACAGUGG 5' Query: miR156g-Known-5p-mature SiteID: Sobic.003G317500.1:1119 MFE of perfect match: -43.20 MFE of this site: -30.00 MFEratio: 0.694444444444444 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,1128-1120 11-15,1118-1114 16-22,1112-1106 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-10,1119-1119 SIL: Symmetric internal loop x-x,1113-1113 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.151152636703648 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156g-Known-5p-mature_Sobic.003G317500.1_1119_TPlot.pdf Position Reads Category 34 1 4 202 1 4 379 1 4 774 1 4 834 1 4 946 1 4 1119 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' AAGCCCGCCAAGUCCGGCGGUG-GC 3' Transcript: Sobic.003G338966.1:40-63 Slice Site:50 ||||||o|| ||| |||| || 3' UUCGGGUGG-UCA-----CCACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.003G338966.1:50 MFE of perfect match: -39.80 MFE of this site: -26.30 MFEratio: 0.660804020100503 Allen et al. score: 14.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,63-62 4-7,61-58 8-10,52-50 11-19,48-40 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,x-x BULq: Bulge on query side x-x,57-53 BULt: Bulge on transcript side x-x,49-49 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.986416997655582 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-3p-star_Sobic.003G338966.1_50_TPlot.pdf Position Reads Category 30 1 4 36 1 4 40 2 2 43 1 4 44 1 4 45 1 4 46 1 4 48 1 4 49 1 4 50 1 4 <<<<<<<<<< 51 2 2 53 1 4 54 1 4 58 1 4 59 1 4 64 1 4 67 1 4 70 1 4 72 1 4 73 1 4 74 1 4 76 1 4 79 1 4 80 1 4 141 1 4 242 3 1 244 1 4 245 3 1 262 1 4 266 1 4 272 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAGAGUACAAAACCAACCGAG 3' Transcript: Sobic.004G270200.1:1069-1089 Slice Site:1080 ||||o ||| ||||||||o| 3' UUCUU-UGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.004G270200.1:1080 MFE of perfect match: -29.60 MFE of this site: -19.90 MFEratio: 0.672297297297297 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-11,1088-1079 13-15,1077-1075 16-20,1073-1069 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1089-1089 UP5: Unpaired region at 5' of query 12-12,1078-1078 SIL: Symmetric internal loop x-x,1074-1074 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999987718747099 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.004G270200.1_1080_TPlot.pdf Position Reads Category 21 1 4 22 2 0 972 1 4 1062 1 4 1080 1 4 <<<<<<<<<< 1086 1 4 1215 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGCCGAGGGGGCUGUCGCUG 3' Transcript: Sobic.004G298100.1:237-259 Slice Site:249 |o ||o|||o|||||o| |o| 3' ACGA-GGUUCCUCCGACGG-GGC 5' Query: miR396-Probable-3p-star SiteID: Sobic.004G298100.1:249 MFE of perfect match: -48.20 MFE of this site: -31.50 MFEratio: 0.653526970954357 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,259-257 4-17,255-242 19-20,239-238 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,256-256 BULt: Bulge on transcript side 18-18,241-240 AILt: Asymmetric internal loop with more nts on the transcript side 21-21,237-237 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.986568605938293 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-3p-star_Sobic.004G298100.1_249_TPlot.pdf Position Reads Category 131 1 4 247 1 4 249 1 4 <<<<<<<<<< 252 1 4 253 1 4 262 1 4 331 2 2 332 1 4 333 2 2 334 2 2 336 5 0 349 2 2 351 1 4 355 1 4 356 4 2 358 1 4 360 1 4 383 1 4 416 1 4 444 1 4 463 1 4 465 1 4 466 1 4 491 1 4 509 1 4 567 1 4 573 1 4 574 1 4 591 1 4 --------------------------------------------------- --------------------------------------------------- 5' AUGCCCAGGCAUUAUUUCAUCAAGAUUC 3' Transcript: Sobic.004G305100.1:922-949 Slice Site:940 |||| o||| |||||||||||| 3' UACG---UCGU-----AGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.004G305100.1:940 MFE of perfect match: -32.70 MFE of this site: -22.50 MFEratio: 0.688073394495413 Allen et al. score: 13.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-12,949-938 13-16,932-929 17-20,925-922 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,937-933 BULt: Bulge on transcript side x-x,928-926 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.760687615294805 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR172b-Probable-3p-mature_Sobic.004G305100.1_940_TPlot.pdf Position Reads Category 723 1 4 940 1 4 <<<<<<<<<< 1143 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAAGUCAAGGACAAGGUGC 3' Transcript: Sobic.005G075500.1:434-452 Slice Site:443 ||o||| o||||||oo| 3' CUUUAGUA-UUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.005G075500.1:443 MFE of perfect match: -27.30 MFE of this site: -18.40 MFEratio: 0.673992673992674 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,452-443 12-17,440-435 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,442-441 AILt: Asymmetric internal loop with more nts on the transcript side 18-18,434-434 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998567452701468 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR8175g-Probable-5p-star_Sobic.005G075500.1_443_TPlot.pdf Position Reads Category 443 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CUAAUUGUAAGGGGGCAC 3' Transcript: Sobic.005G093800.1:2200-2217 Slice Site:2208 |||oo||| oo||||| 3' CUUUAGUAUUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.005G093800.1:2208 MFE of perfect match: -27.30 MFE of this site: -17.80 MFEratio: 0.652014652014652 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,2217-2211 9-16,2209-2202 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-8,2210-2210 SIL: Symmetric internal loop 17-18,2201-2200 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999969239607003 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR8175g-Probable-5p-star_Sobic.005G093800.1_2208_TPlot.pdf Position Reads Category 346 1 4 537 1 4 572 1 4 592 1 4 1140 2 0 1435 1 4 1572 1 4 1589 1 4 1648 1 4 1781 1 4 1824 1 4 1908 1 4 2201 1 4 2208 1 4 <<<<<<<<<< 2352 1 4 2448 1 4 2480 1 4 2483 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGCUCUCCAGUGGAUGUGG 3' Transcript: Sobic.006G000400.5:687-706 Slice Site:696 o||o| ||||||| |||| 3' UUCGGGUGGUCACC-ACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.006G000400.5:696 MFE of perfect match: -39.80 MFE of this site: -26.40 MFEratio: 0.663316582914573 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,705-702 6-12,700-694 14-18,692-688 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,706-706 UP5: Unpaired region at 5' of query x-x,701-701 BULt: Bulge on transcript side 13-13,693-693 SIL: Symmetric internal loop 19-19,687-687 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.981732149421559 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-3p-star_Sobic.006G000400.5_696_TPlot.pdf Position Reads Category 696 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UGGUGACUCUUCAGGGGAGG 3' Transcript: Sobic.006G095400.1:789-808 Slice Site:799 |||o|||||o | |||||o 3' ACCGCUGAGGUGACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.006G095400.1:799 MFE of perfect match: -42.90 MFE of this site: -28.10 MFEratio: 0.655011655011655 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,807-802 9-9,800-800 11-20,798-789 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,808-808 UP5: Unpaired region at 5' of query 8-8,801-801 SIL: Symmetric internal loop 10-10,799-799 SIL: Symmetric internal loop Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.987666864936999 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-5p-mature_Sobic.006G095400.1_799_TPlot.pdf Position Reads Category 111 1 4 112 3 0 113 2 2 481 1 4 649 1 4 714 1 4 799 1 4 <<<<<<<<<< 865 1 4 867 1 4 1028 1 4 1343 1 4 1344 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGGCG-GCGGCGGGGCCGGGG 3' Transcript: Sobic.006G149700.1:408-427 Slice Site:418 |||o o|o| ||o|||o|| 3' ACCGUAUGUC-CCUCGGUCCG 5' Query: miR160-Probable-5p-mature SiteID: Sobic.006G149700.1:418 MFE of perfect match: -43.80 MFE of this site: -29.50 MFEratio: 0.67351598173516 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 2-10,426-418 11-14,416-413 16-19,412-409 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,427-427 UP5: Unpaired region at 5' of query x-x,417-417 BULt: Bulge on transcript side 15-15,x-x BULq: Bulge on query side 20-20,408-408 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.970399510637729 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR160-Probable-5p-mature_Sobic.006G149700.1_418_TPlot.pdf Position Reads Category 418 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGAGGCGGAGCAGGAGGAGGAGUUCUACGAGU 3' Transcript: Sobic.006G267800.1:51-82 Slice Site:68 o||||| o|||o|o|||o|| ||||o 3' UCUCCGAC-UGUCUUUCUCUUC-----GCUCG 5' Query: miR156i-Known-3p-star SiteID: Sobic.006G267800.1:68 MFE of perfect match: -51.60 MFE of this site: -34.20 MFEratio: 0.662790697674419 Allen et al. score: 17 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,82-78 6-18,72-60 21-26,56-51 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,77-73 BULt: Bulge on transcript side 19-20,59-57 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.686702011696028 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156i-Known-3p-star_Sobic.006G267800.1_68_TPlot.pdf Position Reads Category 68 1 4 <<<<<<<<<< 1504 1 4 1672 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGCGGACUCUGGUGCUGCAGC 3' Transcript: Sobic.007G029400.1:856-878 Slice Site:869 | |||o||o ||o|||||| || 3' AC-CGCUUGGAACUACGACGACG 5' Query: miR172a-Probable-5p-star SiteID: Sobic.007G029400.1:869 MFE of perfect match: -44.70 MFE of this site: -29.40 MFEratio: 0.657718120805369 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,878-877 4-12,875-867 14-20,865-859 21-21,857-857 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,876-876 SIL: Symmetric internal loop 13-13,866-866 SIL: Symmetric internal loop x-x,858-858 BULt: Bulge on transcript side 22-22,856-856 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 1 Degradome p-value: 0.0379893421115348 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR172a-Probable-5p-star_Sobic.007G029400.1_869_TPlot.pdf Position Reads Category 3 1 4 10 1 4 206 1 4 226 1 4 244 1 4 261 1 4 262 1 4 263 3 1 274 1 4 284 1 4 292 1 4 295 1 4 328 1 4 337 1 4 480 1 4 533 1 4 559 1 4 732 1 4 770 1 4 771 1 4 782 1 4 783 1 4 853 1 4 869 3 1 <<<<<<<<<< 873 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAGACCCACAACCAGAACCAAA 3' Transcript: Sobic.007G164750.1:251-272 Slice Site:261 ||| |||||||| |||||| 3' UUCUUUGUGUUGGU--UGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.007G164750.1:261 MFE of perfect match: -29.60 MFE of this site: -19.60 MFEratio: 0.662162162162162 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,272-267 7-14,264-257 17-19,254-252 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,266-265 BULt: Bulge on transcript side 15-16,256-255 SIL: Symmetric internal loop 20-20,251-251 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999998972131954 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.007G164750.1_261_TPlot.pdf Position Reads Category 9 1 4 21 1 4 29 2 2 30 1 4 33 1 4 34 2 2 35 2 2 39 2 2 41 3 2 45 1 4 70 1 4 79 1 4 83 1 4 90 2 2 91 1 4 92 1 4 95 3 2 97 1 4 98 1 4 99 1 4 101 1 4 102 1 4 103 1 4 108 1 4 117 1 4 120 1 4 125 2 2 126 1 4 131 1 4 144 1 4 150 2 2 151 2 2 155 1 4 179 1 4 185 1 4 186 1 4 188 1 4 189 1 4 191 1 4 192 1 4 196 2 2 209 1 4 210 2 2 211 1 4 214 1 4 215 2 2 216 5 2 217 1 4 221 1 4 222 1 4 225 3 2 227 3 2 228 2 2 230 2 2 231 2 2 232 1 4 233 6 2 234 1 4 235 1 4 237 1 4 239 2 2 240 1 4 241 1 4 243 3 2 245 1 4 246 3 2 247 1 4 248 1 4 249 1 4 250 3 2 251 10 0 252 3 2 253 2 2 254 2 2 256 2 2 258 2 2 259 1 4 261 1 4 <<<<<<<<<< 262 1 4 263 4 2 264 2 2 269 1 4 271 1 4 272 1 4 273 2 2 277 1 4 280 1 4 281 2 2 282 2 2 283 1 4 286 1 4 287 7 2 288 5 2 289 2 2 292 2 2 293 4 2 296 2 2 297 2 2 298 1 4 311 2 2 312 1 4 313 1 4 314 2 2 315 1 4 317 5 2 319 2 2 323 2 2 324 1 4 325 2 2 327 1 4 333 1 4 336 1 4 345 1 4 346 1 4 347 1 4 348 1 4 354 1 4 357 1 4 358 1 4 369 1 4 399 1 4 407 1 4 441 1 4 447 2 2 456 2 2 457 1 4 458 2 2 459 1 4 470 1 4 472 1 4 475 1 4 477 1 4 479 1 4 480 1 4 495 1 4 501 2 2 502 1 4 503 2 2 505 2 2 509 1 4 516 1 4 517 1 4 529 1 4 535 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGCUCUCUCUCUUCUGUCAAC 3' Transcript: Sobic.007G210200.2:842-863 Slice Site:853 |||||| ||||| |||||||| 3' CACGAGUGAGAGU-GACAGUUG 5' Query: miR156f-Probable-5p-mature SiteID: Sobic.007G210200.2:853 MFE of perfect match: -39.70 MFE of this site: -31.50 MFEratio: 0.793450881612091 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,863-856 10-14,853-849 16-21,847-842 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-9,855-854 AILt: Asymmetric internal loop with more nts on the transcript side 15-15,848-848 SIL: Symmetric internal loop Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0417558021354872 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156f-Probable-5p-mature_Sobic.007G210200.2_853_TPlot.pdf Position Reads Category 853 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGGGGAACUCCACUGGUGGAC 3' Transcript: Sobic.007G222800.1:552-572 Slice Site:563 || | |||||||||| |o|| 3' ACCGC-UGAGGUGACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.007G222800.1:563 MFE of perfect match: -42.90 MFE of this site: -29.00 MFEratio: 0.675990675990676 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,572-569 6-15,567-558 16-16,556-556 18-19,554-553 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,568-568 SIL: Symmetric internal loop x-x,557-557 BULt: Bulge on transcript side 17-17,555-555 SIL: Symmetric internal loop 20-20,552-552 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.908648174422627 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-5p-mature_Sobic.007G222800.1_563_TPlot.pdf Position Reads Category 563 1 4 <<<<<<<<<< 566 1 4 592 1 4 593 1 4 693 1 4 954 1 4 1086 1 4 1272 1 4 1447 1 4 1449 1 4 1544 1 4 1593 1 4 1597 1 4 1616 1 4 1631 1 4 1639 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAACACAACCAUGGGCUAAG 3' Transcript: Sobic.008G003400.1:289-311 Slice Site:299 o||o|||||||||| o|o|| 3' UUCUUUGUGUUGGU---UGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.008G003400.1:299 MFE of perfect match: -29.60 MFE of this site: -22.90 MFEratio: 0.773648648648649 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 2-6,310-306 7-20,302-289 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,311-311 UP5: Unpaired region at 5' of query x-x,305-303 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.584281205092492 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.008G003400.1_299_TPlot.pdf Position Reads Category 166 1 4 299 1 4 <<<<<<<<<< 301 2 0 309 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCGCAGC-UCAUCAGGACGA 3' Transcript: Sobic.008G053300.1:451-469 Slice Site:460 ||||| ||||||o|| 3' UACGUCGUAGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.008G053300.1:460 MFE of perfect match: -32.70 MFE of this site: -22.00 MFEratio: 0.672782874617737 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 4-12,466-458 14-18,457-453 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,469-467 UP5: Unpaired region at 5' of query 13-13,x-x BULq: Bulge on query side 19-20,452-451 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.879597785895994 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR172b-Probable-3p-mature_Sobic.008G053300.1_460_TPlot.pdf Position Reads Category 121 1 4 460 1 4 <<<<<<<<<< 1022 1 4 1029 1 4 1033 1 4 1083 1 4 1086 1 4 1096 1 4 1100 2 0 1113 1 4 1174 1 4 1250 1 4 1383 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAAGU-AUGAUGAGGCAC 3' Transcript: Sobic.008G130000.1:1209-1225 Slice Site:1216 |||o| ||o|oo|||||| 3' CUUUAGUAUUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.008G130000.1:1216 MFE of perfect match: -27.30 MFE of this site: -19.60 MFEratio: 0.717948717948718 Allen et al. score: 4.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-12,1225-1214 14-18,1213-1209 Unpaired Regions (query5'-query3',transcript3'-transcript5') 13-13,x-x BULq: Bulge on query side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.895944851638587 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR8175g-Probable-5p-star_Sobic.008G130000.1_1216_TPlot.pdf Position Reads Category 762 1 4 780 1 4 794 1 4 815 1 4 864 1 4 1110 1 4 1212 1 4 1213 1 4 1214 1 4 1216 1 4 <<<<<<<<<< 1217 1 4 1227 2 1 1229 2 1 1232 1 4 1237 1 4 1239 1 4 1270 1 4 1311 1 4 1319 1 4 1393 1 4 1399 1 4 1400 1 4 1501 1 4 1646 1 4 1726 1 4 1727 1 4 1734 1 4 1735 1 4 1744 2 1 1840 1 4 1952 1 4 1978 1 4 2004 1 4 2011 1 4 2200 1 4 2204 1 4 2209 1 4 2345 1 4 2351 1 4 2352 1 4 2359 1 4 2386 1 4 2396 1 4 2596 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGCACAGCCACCGUGUGUGUGUGC 3' Transcript: Sobic.008G192300.1:108-132 Slice Site:121 |o|| |||||o ||| |||||| 3' UUCG----GGUGGU-CAC-CACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.008G192300.1:121 MFE of perfect match: -39.80 MFE of this site: -26.30 MFEratio: 0.660804020100503 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,132-127 7-9,125-123 10-15,121-116 16-19,111-108 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,126-126 BULt: Bulge on transcript side x-x,122-122 BULt: Bulge on transcript side x-x,115-112 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.98653842026539 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-3p-star_Sobic.008G192300.1_121_TPlot.pdf Position Reads Category 121 1 4 <<<<<<<<<< 212 1 4 213 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGCUCCACCGGUGGUG-GU 3' Transcript: Sobic.009G122201.1:182-200 Slice Site:192 o||| |||||o|||||| |o 3' UUCG-GGUGGUCACCACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.009G122201.1:192 MFE of perfect match: -39.80 MFE of this site: -30.60 MFEratio: 0.768844221105528 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,200-199 4-15,198-187 16-19,185-182 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,x-x BULq: Bulge on query side x-x,186-186 BULt: Bulge on transcript side Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.173714064010928 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5072-Probable-3p-star_Sobic.009G122201.1_192_TPlot.pdf Position Reads Category 192 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UCCUUGCGCCACUGCCGACGUUCC 3' Transcript: Sobic.009G252000.1:68-91 Slice Site:82 |||o| |||| |||o||o|||| 3' CGGAGCUCGGU--CGGUUGUAAGG 5' Query: miR166-Known-5p-star SiteID: Sobic.009G252000.1:82 MFE of perfect match: -46.60 MFE of this site: -32.00 MFEratio: 0.686695278969957 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-11,91-81 12-15,78-75 17-21,73-69 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,80-79 BULt: Bulge on transcript side 16-16,74-74 SIL: Symmetric internal loop 22-22,68-68 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.46783939390564 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166-Known-5p-star_Sobic.009G252000.1_82_TPlot.pdf Position Reads Category 82 1 4 <<<<<<<<<< 146 1 4 --------------------------------------------------- --------------------------------------------------- 5' UACAAGGAGGAGCUGUGGGAG 3' Transcript: Sobic.010G005500.1:901-921 Slice Site:911 ||||o|o| ||||||o|| 3' AAGUUCUUUCG-GACACCUUC 5' Query: miR396-Probable-5p-mature SiteID: Sobic.010G005500.1:911 MFE of perfect match: -34.10 MFE of this site: -23.70 MFEratio: 0.695014662756598 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,921-913 11-18,910-903 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-10,912-911 AILt: Asymmetric internal loop with more nts on the transcript side 19-20,902-901 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.770164923495071 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.010G005500.1_911_TPlot.pdf Position Reads Category 180 1 4 190 1 4 383 1 4 500 1 4 597 1 4 667 1 4 669 1 4 705 1 4 707 2 2 708 1 4 710 1 4 714 1 4 716 2 2 717 1 4 718 3 2 719 1 4 720 1 4 722 5 1 723 1 4 724 4 2 726 1 4 727 1 4 733 1 4 762 1 4 768 1 4 770 2 2 776 1 4 781 2 2 786 1 4 822 1 4 830 1 4 850 1 4 855 1 4 863 1 4 889 1 4 899 1 4 907 1 4 911 1 4 <<<<<<<<<< 914 1 4 923 1 4 928 1 4 929 3 2 930 2 2 931 4 2 933 1 4 935 1 4 938 2 2 939 1 4 940 4 2 942 3 2 943 3 2 944 1 4 950 1 4 951 1 4 952 4 2 953 1 4 954 1 4 957 1 4 958 2 2 960 2 2 962 1 4 966 1 4 973 1 4 974 1 4 975 1 4 976 1 4 977 2 2 978 2 2 980 1 4 981 1 4 982 1 4 983 1 4 984 2 2 986 1 4 987 2 2 988 2 2 989 1 4 990 1 4 991 1 4 992 1 4 993 2 2 994 1 4 995 1 4 996 2 2 997 2 2 998 1 4 1001 1 4 1002 1 4 1011 1 4 1015 1 4 1016 2 2 1018 1 4 1019 2 2 1020 3 2 1021 1 4 1022 2 2 1023 1 4 1026 1 4 1027 2 2 1029 1 4 1030 2 2 1032 1 4 1033 1 4 1034 1 4 1037 2 2 1038 2 2 1039 4 2 1040 1 4 1041 1 4 1042 5 1 1043 2 2 1044 5 1 1045 1 4 1046 1 4 1047 1 4 1048 3 2 1049 3 2 1050 1 4 1051 3 2 --------------------------------------------------- --------------------------------------------------- 5' UUGUGUGGUAUUGAGAUUGAGG 3' Transcript: Sobic.010G105200.1:9856-9877 Slice Site:9868 ||||||o|| |||o| |||o| 3' CACACACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.010G105200.1:9868 MFE of perfect match: -33.70 MFE of this site: -22.00 MFEratio: 0.652818991097923 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,9877-9873 7-11,9871-9867 13-21,9865-9857 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,9872-9872 SIL: Symmetric internal loop 12-12,9866-9866 SIL: Symmetric internal loop 22-22,9856-9856 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.565191126695774 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156f-Probable-3p-star_Sobic.010G105200.1_9868_TPlot.pdf Position Reads Category 128 1 4 190 1 4 434 1 4 682 1 4 1089 1 4 1297 1 4 1977 1 4 2480 1 4 2560 1 4 2564 1 4 2567 1 4 2570 1 4 2571 1 4 2676 1 4 2842 1 4 3833 1 4 3840 1 4 4113 1 4 4160 1 4 4808 1 4 4829 1 4 6035 1 4 6179 1 4 7877 1 4 8509 1 4 8667 1 4 8736 1 4 9374 1 4 9844 1 4 9866 1 4 9868 1 4 <<<<<<<<<< 9870 1 4 10168 1 4 11209 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGAAUAACACAACCAGCUGCA 3' Transcript: Sobic.K005200.2:132-153 Slice Site:144 o|| ||||||||||o|o 3' UUCU--UUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.K005200.2:144 MFE of perfect match: -29.60 MFE of this site: -20.10 MFEratio: 0.679054054054054 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 4-16,150-138 17-19,135-133 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,153-151 UP5: Unpaired region at 5' of query x-x,137-136 BULt: Bulge on transcript side 20-20,132-132 UP3: Unpaired region at 3' of query Degradome data file: Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999901596802536 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564a-Probable-5p-star_Sobic.K005200.2_144_TPlot.pdf Position Reads Category 144 1 4 <<<<<<<<<< ---------------------------------------------------