# CleaveLand4 4.5 # Fri Mar 22 17:37:54 CST 2024 # Degradome Density File: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt # Query Alignment file: miRNA.fa_GSTAr.txt # Transcriptome: /public/home/zhenglw/work/sRNA_database/Sbicolor_313_v3.1.cds.fa # P-value cutoff: 1 # Category cutoff: 4 # Output Format: Pretty --------------------------------------------------- 5' GAGGAGGAG-GAGGAGGAGCAGC 3' Transcript: Sobic.001G008900.1:454-475 Slice Site:464 ||o||o||| |||| | o|||| 3' CUUCUUCUCUCUCC-CA-UGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.001G008900.1:464 MFE of perfect match: -40.10 MFE of this site: -28.00 MFEratio: 0.698254364089775 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,475-471 7-7,468-468 8-11,466-463 13-21,462-454 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,470-469 AILt: Asymmetric internal loop with more nts on the transcript side x-x,467-467 BULt: Bulge on transcript side 12-12,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.853300402141162 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR529-Probable-3p-star_Sobic.001G008900.1_464_TPlot.pdf Position Reads Category 136 1 4 464 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CAUGGG-CGAGACCAACGUCACC 3' Transcript: Sobic.001G012200.1:1674-1695 Slice Site:1686 ||||o| |||o| ||||o|||| 3' GUACUCGGCUUU-GUUGUAGUGC 5' Query: miR171f-Known-5p-star SiteID: Sobic.001G012200.1:1686 MFE of perfect match: -38.70 MFE of this site: -26.00 MFEratio: 0.671834625322997 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-10,1694-1686 11-15,1684-1680 17-22,1679-1674 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1695-1695 UP5: Unpaired region at 5' of query x-x,1685-1685 BULt: Bulge on transcript side 16-16,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.743440429816012 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171f-Known-5p-star_Sobic.001G012200.1_1686_TPlot.pdf Position Reads Category 169 1 4 176 1 4 185 1 4 188 1 4 195 1 4 197 2 2 199 1 4 202 1 4 204 1 4 207 2 2 210 2 2 642 1 4 819 1 4 899 1 4 939 1 4 941 1 4 1061 1 4 1088 1 4 1166 1 4 1171 1 4 1178 1 4 1246 1 4 1266 1 4 1272 2 2 1274 3 2 1279 1 4 1361 1 4 1401 1 4 1623 1 4 1679 1 4 1683 1 4 1686 1 4 <<<<<<<<<< 1687 2 2 1690 2 2 1695 4 0 1696 3 2 1697 2 2 1699 1 4 1703 2 2 1707 1 4 1712 1 4 1736 1 4 1747 1 4 1750 1 4 1751 2 2 1752 2 2 1755 1 4 1757 1 4 --------------------------------------------------- --------------------------------------------------- 5' UUCCAGGGGUGGAGGCGCUGCA 3' Transcript: Sobic.001G028100.1:1992-2013 Slice Site:2004 ||||||o o|||||o |||| 3' UCGGUCCCU-UCUCCGUCACGU 5' Query: miR408-Known-3p-mature SiteID: Sobic.001G028100.1:2004 MFE of perfect match: -45.10 MFE of this site: -29.40 MFEratio: 0.651884700665188 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,2013-2010 6-12,2008-2002 13-19,2000-1994 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,2009-2009 SIL: Symmetric internal loop x-x,2001-2001 BULt: Bulge on transcript side 20-21,1993-1992 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.997863771307869 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR408-Known-3p-mature_Sobic.001G028100.1_2004_TPlot.pdf Position Reads Category 440 1 4 453 1 4 467 1 4 511 1 4 552 1 4 845 1 4 1001 1 4 1040 1 4 1045 1 4 1127 1 4 1346 1 4 1356 1 4 1474 1 4 1523 1 4 1524 1 4 1542 1 4 1570 1 4 1571 1 4 1576 1 4 1583 2 0 1603 1 4 1604 1 4 1624 1 4 1625 1 4 1634 1 4 2004 1 4 <<<<<<<<<< 2130 1 4 2136 1 4 2138 1 4 2139 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGAUUAGUGAAGGGGAAGAGGAGC 3' Transcript: Sobic.001G038000.2:417-442 Slice Site:432 |||||o |||o|o|||| |||| 3' CGACUGU---CUUUCUCUUCA-CUCG 5' Query: miR156d-Known-3p-star SiteID: Sobic.001G038000.2:432 MFE of perfect match: -40.70 MFE of this site: -26.64 MFEratio: 0.654545454545455 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,442-439 6-15,436-427 17-22,422-417 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,438-437 AILt: Asymmetric internal loop with more nts on the transcript side 16-16,426-423 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.882534544505095 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156d-Known-3p-star_Sobic.001G038000.2_432_TPlot.pdf Position Reads Category 241 1 4 432 1 4 <<<<<<<<<< 699 1 4 737 1 4 1315 1 4 1322 1 4 1323 2 0 --------------------------------------------------- --------------------------------------------------- 5' UCGGGUCAUGCUGGUA--UUCU 3' Transcript: Sobic.001G048400.1:960-979 Slice Site:972 ||o|o|||||||||o| ||| 3' AGUCUAGUACGACCGUCGAAGU 5' Query: miR167e-Probable-5p-mature SiteID: Sobic.001G048400.1:972 MFE of perfect match: -42.10 MFE of this site: -27.70 MFEratio: 0.657957244655582 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 2-4,978-976 7-22,975-960 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,979-979 UP5: Unpaired region at 5' of query 5-6,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.408622553160923 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167e-Probable-5p-mature_Sobic.001G048400.1_972_TPlot.pdf Position Reads Category 972 1 4 <<<<<<<<<< 1247 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUGCUGUGUCUCUCUCUCAUCG 3' Transcript: Sobic.001G086200.1:678-699 Slice Site:690 |||||o ||||||||| || 3' UCCGACAU-GAGAGAGAGAAGA 5' Query: miR529-Probable-5p-mature SiteID: Sobic.001G086200.1:690 MFE of perfect match: -39.10 MFE of this site: -26.80 MFEratio: 0.685421994884911 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,698-697 5-13,695-687 14-19,685-680 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,699-699 UP5: Unpaired region at 5' of query 4-4,696-696 SIL: Symmetric internal loop x-x,686-686 BULt: Bulge on transcript side 20-21,679-678 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.137708385993378 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR529-Probable-5p-mature_Sobic.001G086200.1_690_TPlot.pdf Position Reads Category 87 1 4 89 1 4 97 1 4 125 1 4 127 1 4 130 2 1 155 1 4 196 1 4 223 1 4 344 1 4 348 2 1 352 1 4 365 1 4 453 1 4 456 1 4 461 1 4 465 2 1 484 1 4 659 1 4 690 1 4 <<<<<<<<<< 697 1 4 700 1 4 701 1 4 702 1 4 738 1 4 778 1 4 786 1 4 926 1 4 927 1 4 954 1 4 978 1 4 983 1 4 990 1 4 996 1 4 1001 1 4 1031 1 4 1035 1 4 1041 1 4 1083 1 4 1114 1 4 1191 1 4 1218 1 4 1290 1 4 1323 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGUCUCUACAGUCAUGACCU 3' Transcript: Sobic.001G089100.3:793-814 Slice Site:804 |o|| |||||| |||||||| 3' CUACUUUGAUGUC-GUACUGGA 5' Query: miR167j-Known-3p-star SiteID: Sobic.001G089100.3:804 MFE of perfect match: -35.90 MFE of this site: -25.48 MFEratio: 0.70974930362117 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,814-807 9-14,805-800 18-21,796-793 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,806-806 BULt: Bulge on transcript side 15-17,799-797 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 1 Degradome p-value: 0.00998798269639756 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167j-Known-3p-star_Sobic.001G089100.3_804_TPlot.pdf Position Reads Category 297 1 4 373 1 4 394 1 4 417 1 4 440 1 4 442 1 4 450 1 4 454 1 4 461 1 4 500 1 4 575 1 4 617 1 4 649 1 4 671 1 4 673 1 4 679 1 4 681 2 1 683 1 4 690 1 4 702 1 4 704 1 4 709 1 4 781 1 4 784 1 4 797 1 4 803 1 4 804 2 1 <<<<<<<<<< 806 2 1 808 1 4 841 1 4 843 1 4 883 1 4 937 1 4 958 1 4 962 1 4 972 1 4 1033 1 4 1043 1 4 1051 1 4 1324 1 4 1328 1 4 1330 1 4 1333 1 4 1335 1 4 1344 1 4 1558 1 4 1567 1 4 1705 1 4 1755 1 4 1836 1 4 --------------------------------------------------- --------------------------------------------------- 5' CACAAAAUGACCACCAAGAAAC 3' Transcript: Sobic.001G109800.2:1955-1976 Slice Site:1967 ||||||||||||| ||| 3' CCAAUUUACUGGUGGUUGUUUU 5' Query: miR827-Known-5p-star SiteID: Sobic.001G109800.2:1967 MFE of perfect match: -33.70 MFE of this site: -22.60 MFEratio: 0.670623145400593 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 2-4,1975-1973 6-18,1971-1959 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1976-1976 UP5: Unpaired region at 5' of query 5-5,1972-1972 SIL: Symmetric internal loop 19-22,1958-1955 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.714250688885618 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR827-Known-5p-star_Sobic.001G109800.2_1967_TPlot.pdf Position Reads Category 607 1 4 1808 1 4 1825 1 4 1967 1 4 <<<<<<<<<< 2215 1 4 2272 1 4 2294 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUUUGCUGAUGGUGUAGCUGU 3' Transcript: Sobic.001G116100.1:974-995 Slice Site:985 ||||||||||||| ||o 3' ACAAACGACUACCAGUA-GAUU 5' Query: miR827-Known-3p-mature SiteID: Sobic.001G116100.1:985 MFE of perfect match: -34.20 MFE of this site: -23.72 MFEratio: 0.693567251461988 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 2-4,994-992 8-20,987-975 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,995-995 UP5: Unpaired region at 5' of query 5-7,991-988 AILt: Asymmetric internal loop with more nts on the transcript side 21-21,974-974 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.126015392242255 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR827-Known-3p-mature_Sobic.001G116100.1_985_TPlot.pdf Position Reads Category 530 1 4 578 1 4 742 1 4 799 1 4 860 1 4 985 1 4 <<<<<<<<<< 1429 1 4 1474 1 4 1720 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGUUCAAGUUUGGCUGGAGGAC 3' Transcript: Sobic.001G125800.1:1114-1136 Slice Site:1126 o|||||||| o|||| ||| 3' UUCAAGUUCUU-UCGACA-CCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.001G125800.1:1126 MFE of perfect match: -33.40 MFE of this site: -22.00 MFEratio: 0.658682634730539 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-4,1135-1133 6-10,1130-1126 13-21,1122-1114 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1136-1136 UP5: Unpaired region at 5' of query 5-5,1132-1131 AILt: Asymmetric internal loop with more nts on the transcript side 11-12,1125-1123 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.879327194337513 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.001G125800.1_1126_TPlot.pdf Position Reads Category 673 1 4 704 1 4 709 1 4 1126 1 4 <<<<<<<<<< 2001 1 4 2024 1 4 2382 1 4 2490 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUUUGAGGCCUGGUUCCAUU 3' Transcript: Sobic.001G138000.1:1144-1164 Slice Site:1155 || |||o|||||||o| 3' CCUUACUUCGGACCAGGCUCU 5' Query: miR166k-Known-3p-mature SiteID: Sobic.001G138000.1:1155 MFE of perfect match: -42.00 MFE of this site: -27.50 MFEratio: 0.654761904761905 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 5-17,1160-1148 20-21,1145-1144 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-4,1164-1161 UP5: Unpaired region at 5' of query 18-19,1147-1146 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.442151335459338 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166k-Known-3p-mature_Sobic.001G138000.1_1155_TPlot.pdf Position Reads Category 180 1 4 182 1 4 195 1 4 212 1 4 339 1 4 341 1 4 378 2 2 406 1 4 407 1 4 412 1 4 431 1 4 433 1 4 435 3 2 443 1 4 490 1 4 491 1 4 492 1 4 493 1 4 496 1 4 523 1 4 585 1 4 630 1 4 662 1 4 677 1 4 680 1 4 686 1 4 688 1 4 753 1 4 772 1 4 991 1 4 1019 1 4 1022 1 4 1029 1 4 1042 1 4 1044 1 4 1055 1 4 1058 1 4 1063 1 4 1093 1 4 1155 1 4 <<<<<<<<<< 1207 1 4 1210 1 4 1211 2 2 1212 1 4 1217 4 0 1218 3 2 1220 1 4 1251 1 4 1286 1 4 1288 1 4 1298 1 4 1620 1 4 1708 1 4 1731 1 4 1732 1 4 1734 1 4 1738 2 2 1743 1 4 1756 1 4 1766 1 4 1770 1 4 1777 1 4 1780 1 4 1816 1 4 1821 1 4 1823 1 4 1831 1 4 1832 2 2 1843 1 4 1846 1 4 1850 1 4 1851 1 4 1853 1 4 1854 1 4 1896 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCGUUCAAGAAAGCCUGUGGAA 3' Transcript: Sobic.001G139800.1:603-624 Slice Site:614 ||||||||||| |||||||| 3' UUCAAGUUCUUUC-GACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.001G139800.1:614 MFE of perfect match: -33.40 MFE of this site: -29.20 MFEratio: 0.874251497005988 Allen et al. score: 4 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,624-617 9-19,615-605 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,616-616 BULt: Bulge on transcript side 20-21,604-603 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00447968662873477 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.001G139800.1_614_TPlot.pdf Position Reads Category 614 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UGCUGC---ACCGGCUCGGC 3' Transcript: Sobic.001G145700.1:538-554 Slice Site:545 ||||| |||o|||| o| 3' UCGACGUAUUGGUCGAGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.001G145700.1:545 MFE of perfect match: -39.10 MFE of this site: -26.60 MFEratio: 0.680306905370844 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,554-553 4-11,551-544 15-19,543-539 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,552-552 SIL: Symmetric internal loop 12-14,x-x BULq: Bulge on query side 20-20,538-538 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.976244997981213 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166j-Probable-5p-star_Sobic.001G145700.1_545_TPlot.pdf Position Reads Category 47 1 4 67 1 4 82 1 4 127 1 4 320 1 4 354 1 4 355 1 4 356 1 4 361 1 4 363 1 4 374 1 4 385 1 4 545 1 4 <<<<<<<<<< 579 1 4 583 1 4 584 1 4 587 1 4 589 1 4 590 1 4 591 3 0 592 1 4 593 2 2 595 1 4 599 1 4 605 1 4 606 1 4 607 1 4 608 1 4 612 1 4 617 1 4 618 1 4 625 1 4 626 1 4 627 1 4 639 1 4 653 2 2 656 1 4 658 2 2 677 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGGGGCGACCACAAGAAGGACGACGAGCACA 3' Transcript: Sobic.001G149500.1:42-73 Slice Site:53 |||||||||| || ||o|||| 3' GCCCCCGCUGGA----------CU-CUUGUGU 5' Query: miR398-Known-3p-mature SiteID: Sobic.001G149500.1:53 MFE of perfect match: -45.30 MFE of this site: -29.62 MFEratio: 0.653863134657837 Allen et al. score: 26 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,73-67 8-9,65-64 11-20,52-43 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,66-66 BULt: Bulge on transcript side 10-10,63-53 AILt: Asymmetric internal loop with more nts on the transcript side 21-21,42-42 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.0772891943355589 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR398-Known-3p-mature_Sobic.001G149500.1_53_TPlot.pdf Position Reads Category 35 1 4 37 1 4 38 1 4 40 1 4 41 1 4 44 1 4 46 1 4 48 1 4 49 2 3 50 2 3 51 2 3 52 2 3 53 10 2 <<<<<<<<<< 54 2 3 55 11 1 56 6 2 57 6 2 58 10 2 59 2 3 62 1 4 64 1 4 69 1 4 70 1 4 71 3 3 73 3 3 74 1 4 75 3 3 76 6 2 77 1 4 78 4 2 79 2 3 86 2 3 87 1 4 89 3 3 90 4 2 91 4 2 92 2 3 94 1 4 97 2 3 100 4 2 101 1 4 102 1 4 103 1 4 106 1 4 107 4 2 108 4 2 109 6 2 110 1 4 111 2 3 112 5 2 122 1 4 126 1 4 169 1 4 173 1 4 174 1 4 176 1 4 182 1 4 188 1 4 191 1 4 193 1 4 194 3 3 195 2 3 196 10 2 197 4 2 198 3 3 199 1 4 200 1 4 201 2 3 202 6 2 203 4 2 204 4 2 205 3 3 206 3 3 207 3 3 208 7 2 209 6 2 210 6 2 211 11 1 212 4 2 213 10 2 214 10 2 215 8 2 216 8 2 217 3 3 218 3 3 219 1 4 220 6 2 221 1 4 226 1 4 229 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUUGGGAUGAAGCCUGGUCCGG 3' Transcript: Sobic.001G157400.1:594-616 Slice Site:607 || ||o||||||||||||||| 3' CC--CCUUACUUCGGACCAGGCU 5' Query: miR166e-Probable-3p-mature SiteID: Sobic.001G157400.1:607 MFE of perfect match: -44.10 MFE of this site: -37.90 MFEratio: 0.859410430839002 Allen et al. score: 3.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-19,615-598 20-21,595-594 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,616-616 UP5: Unpaired region at 5' of query x-x,597-596 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00224235739771694 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166e-Probable-3p-mature_Sobic.001G157400.1_607_TPlot.pdf Position Reads Category 607 1 4 <<<<<<<<<< 1199 1 4 1274 1 4 1284 1 4 1322 1 4 2021 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGGAUUGGACCGUGUCUAUG 3' Transcript: Sobic.001G178400.1:1043-1063 Slice Site:1054 o|o||||o||||o|o| 3' AGCUUAACUUGGCGCGGUUAU 5' Query: miR171i-Probable-5p-star SiteID: Sobic.001G178400.1:1054 MFE of perfect match: -36.20 MFE of this site: -24.30 MFEratio: 0.671270718232044 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 5-20,1059-1044 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-4,1063-1060 UP5: Unpaired region at 5' of query 21-21,1043-1043 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.617415832880741 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171i-Probable-5p-star_Sobic.001G178400.1_1054_TPlot.pdf Position Reads Category 118 1 4 124 1 4 125 1 4 130 1 4 136 1 4 139 1 4 261 1 4 563 1 4 718 1 4 1031 1 4 1054 1 4 <<<<<<<<<< 1055 1 4 1631 1 4 1716 1 4 1767 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGGCGGCGGGCGCGAGCAG-GAGC 3' Transcript: Sobic.001G198800.1:300-324 Slice Site:316 ||||o|o| |o |||||| |||| 3' CUACUGUCACU----CUCGUCUCUCG 5' Query: miR156b-Probable-3p-star SiteID: Sobic.001G198800.1:316 MFE of perfect match: -43.60 MFE of this site: -28.80 MFEratio: 0.660550458715596 Allen et al. score: 13 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,324-321 6-11,320-315 12-13,310-309 15-22,307-300 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,x-x BULq: Bulge on query side x-x,314-311 BULt: Bulge on transcript side 14-14,308-308 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.825227135621353 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156b-Probable-3p-star_Sobic.001G198800.1_316_TPlot.pdf Position Reads Category 316 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGAGGAAUUCGAUGAACGGCU 3' Transcript: Sobic.001G204100.3:135-155 Slice Site:146 ||||| ||||| o||||o||| 3' CCUCCGUAAGCAGCUUGUCGA 5' Query: miR5564d-Probable-3p-star SiteID: Sobic.001G204100.3:146 MFE of perfect match: -41.00 MFE of this site: -27.70 MFEratio: 0.675609756097561 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,155-147 11-15,145-141 17-21,139-135 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-10,146-146 SIL: Symmetric internal loop 16-16,140-140 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.745733894235213 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564d-Probable-3p-star_Sobic.001G204100.3_146_TPlot.pdf Position Reads Category 146 1 4 <<<<<<<<<< 213 1 4 499 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAUGGUGUGGACCAUGCCGUGC 3' Transcript: Sobic.001G342600.1:1142-1163 Slice Site:1154 ||o| ||o||||||||o 3' AAACUA-ACUUGGUACGGUUGU 5' Query: miR171a-Probable-5p-star SiteID: Sobic.001G342600.1:1154 MFE of perfect match: -33.50 MFE of this site: -22.20 MFEratio: 0.662686567164179 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 4-15,1160-1149 16-19,1147-1144 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,1163-1161 UP5: Unpaired region at 5' of query x-x,1148-1148 BULt: Bulge on transcript side 20-21,1143-1142 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.630084150816902 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171a-Probable-5p-star_Sobic.001G342600.1_1154_TPlot.pdf Position Reads Category 220 1 4 423 1 4 426 1 4 428 2 2 432 1 4 480 1 4 485 1 4 496 1 4 499 1 4 547 1 4 557 1 4 586 2 2 587 1 4 588 1 4 591 1 4 619 1 4 626 1 4 628 1 4 640 1 4 676 1 4 690 1 4 703 1 4 715 1 4 840 1 4 877 1 4 907 1 4 910 1 4 911 1 4 912 3 0 913 1 4 914 1 4 915 1 4 916 1 4 1040 1 4 1047 1 4 1049 1 4 1154 1 4 <<<<<<<<<< 1172 1 4 1180 1 4 1195 1 4 1199 1 4 1200 1 4 1230 1 4 1343 1 4 1451 1 4 1455 1 4 1462 2 2 1464 1 4 1487 1 4 1550 1 4 1568 1 4 1576 1 4 1644 1 4 1648 1 4 1654 2 2 1656 1 4 1666 1 4 1671 1 4 1686 1 4 1718 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGUGGGGUGACCUGGAAAUUUAUGAAUACA 3' Transcript: Sobic.001G421700.1:1241-1270 Slice Site:1253 || ||||o||||||o |||o||| 3' GC-CCCCGCUGGACU--------CUUGUGU 5' Query: miR398-Known-3p-mature SiteID: Sobic.001G421700.1:1253 MFE of perfect match: -45.30 MFE of this site: -30.50 MFEratio: 0.673289183222958 Allen et al. score: 19.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,1270-1264 8-19,1255-1244 20-21,1242-1241 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1263-1256 BULt: Bulge on transcript side x-x,1243-1243 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.699109316054044 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR398-Known-3p-mature_Sobic.001G421700.1_1253_TPlot.pdf Position Reads Category 287 1 4 288 1 4 290 1 4 300 1 4 316 1 4 330 1 4 870 1 4 1004 1 4 1011 1 4 1158 1 4 1253 1 4 <<<<<<<<<< 1254 1 4 1297 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCGGUAUCCCUCCUACGGAC 3' Transcript: Sobic.001G433400.1:350-370 Slice Site:361 |||| |||||||||| 3' CCGCGAUAGGGAGGACUCGAA 5' Query: miR390-Known-5p-mature SiteID: Sobic.001G433400.1:361 MFE of perfect match: -44.30 MFE of this site: -29.00 MFEratio: 0.654627539503386 Allen et al. score: 12 Paired Regions (query5'-query3',transcript3'-transcript5') 7-16,364-355 18-21,353-350 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-6,370-365 UP5: Unpaired region at 5' of query 17-17,354-354 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.835505755553189 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR390-Known-5p-mature_Sobic.001G433400.1_361_TPlot.pdf Position Reads Category 357 1 4 361 1 4 <<<<<<<<<< 440 1 4 598 1 4 644 1 4 694 1 4 698 1 4 791 1 4 890 1 4 915 1 4 916 1 4 917 1 4 1083 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGUUGGUGAGGACGGGGAGCUC 3' Transcript: Sobic.001G438500.1:276-297 Slice Site:287 |o|||| || o||||||| 3' GUAACCUUA-CUA-UCCUCGAG 5' Query: miR159-Known-5p-star SiteID: Sobic.001G438500.1:287 MFE of perfect match: -34.50 MFE of this site: -23.42 MFEratio: 0.678840579710145 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,297-290 10-11,287-286 15-20,281-276 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-9,289-288 AILt: Asymmetric internal loop with more nts on the transcript side 12-14,285-282 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.535942742244618 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR159-Known-5p-star_Sobic.001G438500.1_287_TPlot.pdf Position Reads Category 163 1 4 287 1 4 <<<<<<<<<< 394 1 4 459 1 4 470 1 4 727 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUCAUCAACCUUGGGCUCCC 3' Transcript: Sobic.001G524900.1:531-551 Slice Site:542 |||||||||| o|| o||| 3' CGAGUAGUUGCGACGUGAGUU 5' Query: miR397-Known-5p-mature SiteID: Sobic.001G524900.1:542 MFE of perfect match: -39.40 MFE of this site: -26.30 MFEratio: 0.66751269035533 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 3-6,549-546 8-10,544-542 12-21,540-531 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,551-550 UP5: Unpaired region at 5' of query 7-7,545-545 SIL: Symmetric internal loop 11-11,541-541 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.906992766563412 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR397-Known-5p-mature_Sobic.001G524900.1_542_TPlot.pdf Position Reads Category 316 1 4 463 1 4 485 1 4 488 1 4 500 1 4 541 2 0 542 1 4 <<<<<<<<<< 759 1 4 765 1 4 766 1 4 768 1 4 769 1 4 784 1 4 789 1 4 796 1 4 797 1 4 815 1 4 816 1 4 817 1 4 824 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGCCAUGGGGAGGGCUGCC 3' Transcript: Sobic.002G000600.1:1291-1311 Slice Site:1302 |||| |o||||o|||||| 3' GGACGGU-CUCCUCUCGACGG 5' Query: miR399b-Probable-5p-star SiteID: Sobic.002G000600.1:1302 MFE of perfect match: -45.40 MFE of this site: -35.10 MFEratio: 0.773127753303965 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-13,1311-1299 14-17,1297-1294 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1298-1298 BULt: Bulge on transcript side 18-20,1293-1291 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0920170113884967 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR399b-Probable-5p-star_Sobic.002G000600.1_1302_TPlot.pdf Position Reads Category 576 1 4 673 1 4 675 1 4 676 1 4 962 1 4 1117 1 4 1302 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGCGGCGAUCGUCG-GCAGCU 3' Transcript: Sobic.002G030500.1:732-751 Slice Site:743 || |||o |||||| o||||| 3' CCUCCGUAAGCAGCUUGUCGA 5' Query: miR5564d-Probable-3p-star SiteID: Sobic.002G030500.1:743 MFE of perfect match: -41.00 MFE of this site: -28.20 MFEratio: 0.68780487804878 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,751-746 8-13,745-740 15-18,738-735 20-21,733-732 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,x-x BULq: Bulge on query side 14-14,739-739 SIL: Symmetric internal loop 19-19,734-734 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.612227849833315 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564d-Probable-3p-star_Sobic.002G030500.1_743_TPlot.pdf Position Reads Category 342 1 4 743 1 4 <<<<<<<<<< 748 1 4 922 1 4 --------------------------------------------------- --------------------------------------------------- 5' AUUCGGGCCAGAUGAUACGCC 3' Transcript: Sobic.002G045300.1:120-140 Slice Site:131 o|||o||||||oo|o| || 3' GGAGCUCGGUCUGUUGUAAGG 5' Query: miR166h-Known-5p-star SiteID: Sobic.002G045300.1:131 MFE of perfect match: -41.10 MFE of this site: -27.30 MFEratio: 0.664233576642336 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,140-139 5-20,136-121 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-4,138-137 SIL: Symmetric internal loop 21-21,120-120 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.686702011696028 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166h-Known-5p-star_Sobic.002G045300.1_131_TPlot.pdf Position Reads Category 119 1 4 131 1 4 <<<<<<<<<< 250 1 4 285 1 4 287 1 4 315 1 4 324 1 4 335 1 4 347 1 4 368 2 0 375 1 4 379 1 4 408 1 4 --------------------------------------------------- --------------------------------------------------- 5' AG-GAGGCAAACGUGCUGCCGCAGC-UGGC 3' Transcript: Sobic.002G066800.1:3368-3395 Slice Site:3387 || ||||| ||||||||| ||o| 3' UCACUCCG--------ACGGCGUCGUACUG 5' Query: miR167a-Probable-3p-star SiteID: Sobic.002G066800.1:3387 MFE of perfect match: -47.20 MFE of this site: -30.80 MFEratio: 0.652542372881356 Allen et al. score: 12 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,3395-3392 6-14,3391-3383 15-19,3374-3370 21-22,3369-3368 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,x-x BULq: Bulge on query side x-x,3382-3375 BULt: Bulge on transcript side 20-20,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.941822519744774 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167a-Probable-3p-star_Sobic.002G066800.1_3387_TPlot.pdf Position Reads Category 795 1 4 3387 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UUCCAGGUGCUUGAUUCCAUGGGGAGC 3' Transcript: Sobic.002G201600.1:834-860 Slice Site:845 |o|||||||| o||||o| 3' GUACUUCACGAACU------UCCCUUG 5' Query: miR395a-Known-3p-star SiteID: Sobic.002G201600.1:845 MFE of perfect match: -36.90 MFE of this site: -24.10 MFEratio: 0.653116531165312 Allen et al. score: 18.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,860-854 8-17,847-838 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,853-848 BULt: Bulge on transcript side 18-21,837-834 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.606086220335809 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR395a-Known-3p-star_Sobic.002G201600.1_845_TPlot.pdf Position Reads Category 616 1 4 620 1 4 841 1 4 842 1 4 845 1 4 <<<<<<<<<< 854 1 4 862 1 4 865 1 4 935 1 4 941 1 4 971 1 4 973 1 4 1033 1 4 1386 1 4 1744 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUG-UCAGAGCCGGCGGGGAGA 3' Transcript: Sobic.002G214300.1:477-498 Slice Site:488 |||| |||o|o|||o ||o||| 3' CCACUAGUUUUGGCU-CCUCUCA 5' Query: miR156i-Probable-3p-star SiteID: Sobic.002G214300.1:488 MFE of perfect match: -40.60 MFE of this site: -30.50 MFEratio: 0.751231527093596 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,497-492 8-17,490-481 19-22,480-477 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,498-498 UP5: Unpaired region at 5' of query x-x,491-491 BULt: Bulge on transcript side 18-18,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.087931229111059 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156i-Probable-3p-star_Sobic.002G214300.1_488_TPlot.pdf Position Reads Category 488 1 4 <<<<<<<<<< 507 1 4 515 1 4 518 1 4 523 1 4 665 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCACCCGAGCCCCGGGGCGACGAUCA 3' Transcript: Sobic.002G218000.1:30-55 Slice Site:46 o| |||||||| o|o|o||o||| 3' UG-GGGCUCGG---UCUGUUGUUAGG 5' Query: miR166i-Known-5p-star SiteID: Sobic.002G218000.1:46 MFE of perfect match: -44.90 MFE of this site: -33.20 MFEratio: 0.739420935412027 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-12,54-44 13-20,40-33 21-22,31-30 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,55-55 UP5: Unpaired region at 5' of query x-x,43-41 BULt: Bulge on transcript side x-x,32-32 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.104164867675347 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166i-Known-5p-star_Sobic.002G218000.1_46_TPlot.pdf Position Reads Category 46 1 4 <<<<<<<<<< 47 2 0 --------------------------------------------------- --------------------------------------------------- 5' GAGAGCAAGAAAGCAGUGGAG 3' Transcript: Sobic.002G243200.1:1408-1428 Slice Site:1419 o|| ||||||||| ||||| 3' UUCAAGUUCUUUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.002G243200.1:1419 MFE of perfect match: -33.40 MFE of this site: -23.60 MFEratio: 0.706586826347305 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-6,1427-1423 8-16,1421-1413 19-21,1410-1408 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1428-1428 UP5: Unpaired region at 5' of query 7-7,1422-1422 SIL: Symmetric internal loop 17-18,1412-1411 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.463039338421615 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.002G243200.1_1419_TPlot.pdf Position Reads Category 70 1 4 212 1 4 236 1 4 477 1 4 536 1 4 625 1 4 626 1 4 637 1 4 638 1 4 644 1 4 648 2 2 652 1 4 655 1 4 658 1 4 663 2 2 666 1 4 667 1 4 673 1 4 679 1 4 682 1 4 685 1 4 691 1 4 692 1 4 697 1 4 701 1 4 702 1 4 705 3 0 707 1 4 711 1 4 715 1 4 720 1 4 818 1 4 842 1 4 895 1 4 994 1 4 1376 1 4 1388 1 4 1390 1 4 1398 1 4 1405 1 4 1419 1 4 <<<<<<<<<< 1543 1 4 1563 1 4 1586 1 4 1594 1 4 1596 1 4 1601 1 4 1604 1 4 1624 1 4 2054 1 4 2072 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGCCAUGAAGGAAGCUGUGGCC 3' Transcript: Sobic.002G264800.1:292-315 Slice Site:306 o|| || ||o||||||||| 3' UUCAAGU---UCUUUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.002G264800.1:306 MFE of perfect match: -33.40 MFE of this site: -21.80 MFEratio: 0.652694610778443 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-14,313-302 15-16,298-297 19-21,294-292 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,315-314 UP5: Unpaired region at 5' of query x-x,301-299 BULt: Bulge on transcript side 17-18,296-295 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.91285478310303 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.002G264800.1_306_TPlot.pdf Position Reads Category 13 1 4 15 1 4 42 1 4 61 1 4 90 1 4 211 1 4 212 1 4 233 1 4 243 1 4 246 1 4 258 1 4 286 1 4 304 1 4 305 2 0 306 1 4 <<<<<<<<<< 309 1 4 --------------------------------------------------- --------------------------------------------------- 5' UUUGACUGGACCAUUGCCACCA 3' Transcript: Sobic.002G383100.1:1434-1455 Slice Site:1445 ||||| ||o|||| ||||| || 3' AAACUAACUUGGU-ACGGUUGU 5' Query: miR171a-Probable-5p-star SiteID: Sobic.002G383100.1:1445 MFE of perfect match: -33.50 MFE of this site: -22.40 MFEratio: 0.66865671641791 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,1455-1454 4-8,1452-1448 9-15,1446-1440 17-21,1438-1434 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,1453-1453 SIL: Symmetric internal loop x-x,1447-1447 BULt: Bulge on transcript side 16-16,1439-1439 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.572930159451919 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171a-Probable-5p-star_Sobic.002G383100.1_1445_TPlot.pdf Position Reads Category 427 1 4 436 1 4 484 1 4 1018 1 4 1305 1 4 1445 1 4 <<<<<<<<<< 1461 1 4 2068 1 4 2071 1 4 2147 2 0 2371 1 4 2381 1 4 2412 1 4 2729 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAUGGCAAACAAGGCUCUCUUUUGGCA 3' Transcript: Sobic.002G412700.2:933-959 Slice Site:950 |||| o|||||o||||||| 3' GUCCCGU------UGAGAGGAAACCGU 5' Query: miR399a-Probable-3p-mature SiteID: Sobic.002G412700.2:950 MFE of perfect match: -41.90 MFE of this site: -27.30 MFEratio: 0.651551312649165 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-14,959-946 15-18,939-936 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,945-940 BULt: Bulge on transcript side 19-21,935-933 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.623380818944599 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR399a-Probable-3p-mature_Sobic.002G412700.2_950_TPlot.pdf Position Reads Category 509 1 4 642 1 4 950 1 4 <<<<<<<<<< 973 1 4 1079 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGUGCGUGGCCAAGCCGUCCGC 3' Transcript: Sobic.003G000900.1:118-140 Slice Site:128 | |||o|oo|| ||| |||o| 3' UCGACGUAUUGG-UCG--AGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.003G000900.1:128 MFE of perfect match: -39.10 MFE of this site: -25.60 MFEratio: 0.654731457800512 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,140-136 6-8,133-131 9-17,129-121 19-19,119-119 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,135-134 BULt: Bulge on transcript side x-x,130-130 BULt: Bulge on transcript side 18-18,120-120 SIL: Symmetric internal loop 20-20,118-118 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999216839210786 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166j-Probable-5p-star_Sobic.003G000900.1_128_TPlot.pdf Position Reads Category 118 4 0 128 1 4 <<<<<<<<<< 312 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCCCACGGCGGCGGGCACAGG 3' Transcript: Sobic.003G011200.1:1038-1058 Slice Site:1049 o| |||o|||||||| 3' UUACCUUCUCCGUCCGUGUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.003G011200.1:1049 MFE of perfect match: -42.10 MFE of this site: -28.20 MFEratio: 0.669833729216152 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-12,1058-1047 14-15,1045-1044 Unpaired Regions (query5'-query3',transcript3'-transcript5') 13-13,1046-1046 SIL: Symmetric internal loop 16-21,1043-1038 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999271125169307 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR528-Known-3p-star_Sobic.003G011200.1_1049_TPlot.pdf Position Reads Category 1049 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CGGGA-UGAAGCCUGGUCCGG 3' Transcript: Sobic.003G028300.1:561-580 Slice Site:571 |||| |||||||||||||| 3' UCCCUAACUUCGGACCAGGCU 5' Query: miR166f-Probable-3p-mature SiteID: Sobic.003G028300.1:571 MFE of perfect match: -42.40 MFE of this site: -37.10 MFEratio: 0.875 Allen et al. score: 3 Paired Regions (query5'-query3',transcript3'-transcript5') 2-15,579-566 17-20,565-562 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,580-580 UP5: Unpaired region at 5' of query 16-16,x-x BULq: Bulge on query side 21-21,561-561 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00224235739771694 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166f-Probable-3p-mature_Sobic.003G028300.1_571_TPlot.pdf Position Reads Category 571 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CAAUUGCUGAUGGUGAUCUAG 3' Transcript: Sobic.003G104350.1:713-733 Slice Site:724 ||||||||||| ||||| 3' ACAAACGACUACCAGUAGAUU 5' Query: miR827-Known-3p-mature SiteID: Sobic.003G104350.1:724 MFE of perfect match: -34.20 MFE of this site: -26.00 MFEratio: 0.760233918128655 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 2-6,732-728 8-18,726-716 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,733-733 UP5: Unpaired region at 5' of query 7-7,727-727 SIL: Symmetric internal loop 19-21,715-713 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0200011464953582 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR827-Known-3p-mature_Sobic.003G104350.1_724_TPlot.pdf Position Reads Category 380 1 4 447 1 4 488 1 4 490 1 4 544 1 4 555 1 4 569 1 4 627 1 4 628 1 4 639 1 4 652 1 4 710 1 4 718 1 4 720 1 4 723 1 4 724 1 4 <<<<<<<<<< 731 1 4 735 1 4 737 1 4 1419 1 4 1561 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUUCAUCGACGCCAUGCGCAAGA 3' Transcript: Sobic.003G140400.1:900-922 Slice Site:911 |o|||||o|||| |||o| 3' CGAGUAGUUGCG--ACGUGAGUU 5' Query: miR397-Known-5p-mature SiteID: Sobic.003G140400.1:911 MFE of perfect match: -39.40 MFE of this site: -26.30 MFEratio: 0.66751269035533 Allen et al. score: 13 Paired Regions (query5'-query3',transcript3'-transcript5') 5-9,918-914 10-21,911-900 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-4,922-919 UP5: Unpaired region at 5' of query x-x,913-912 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.908030877769125 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR397-Known-5p-mature_Sobic.003G140400.1_911_TPlot.pdf Position Reads Category 911 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GCUGCCCUACAGGGAGAGAAGCUGAAGC 3' Transcript: Sobic.003G190600.1:79-106 Slice Site:95 |||| ||||o|||||||| || ||| 3' CGAC----UGUCUCUCUCUUC-AC-UCG 5' Query: miR156c-Known-5p-star SiteID: Sobic.003G190600.1:95 MFE of perfect match: -43.40 MFE of this site: -30.90 MFEratio: 0.711981566820276 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,106-104 4-5,102-101 6-18,99-87 19-22,82-79 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,103-103 BULt: Bulge on transcript side x-x,100-100 BULt: Bulge on transcript side x-x,86-83 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.20286593302654 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156c-Known-5p-star_Sobic.003G190600.1_95_TPlot.pdf Position Reads Category 95 1 4 <<<<<<<<<< 314 1 4 509 1 4 514 1 4 556 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGAAGGCGGCGCCGACGGCAUGAC 3' Transcript: Sobic.003G194600.1:1208-1232 Slice Site:1222 || |||| |||| |o||||||| 3' UCAGUCCGA--CGGC-GUCGUACUG 5' Query: miR167h-Probable-3p-star SiteID: Sobic.003G194600.1:1222 MFE of perfect match: -47.20 MFE of this site: -31.00 MFEratio: 0.656779661016949 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,1232-1224 10-13,1222-1219 15-18,1215-1212 21-22,1209-1208 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1223-1223 BULt: Bulge on transcript side 14-14,1218-1216 AILt: Asymmetric internal loop with more nts on the transcript side 19-20,1211-1210 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.901402685453079 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167h-Probable-3p-star_Sobic.003G194600.1_1222_TPlot.pdf Position Reads Category 1222 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' ACCAGAAGAGGC-GGCGCAGG 3' Transcript: Sobic.003G222600.1:191-210 Slice Site:202 |||||||| |||o|||| 3' UUACCUUCUCCGUCCGUGUCC 5' Query: miR528-Known-3p-star SiteID: Sobic.003G222600.1:202 MFE of perfect match: -42.10 MFE of this site: -31.60 MFEratio: 0.750593824228029 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,210-203 10-17,202-195 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-9,x-x BULq: Bulge on query side 18-21,194-191 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.534899821418497 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR528-Known-3p-star_Sobic.003G222600.1_202_TPlot.pdf Position Reads Category 202 1 4 <<<<<<<<<< 238 1 4 274 1 4 277 1 4 292 1 4 298 1 4 308 1 4 381 1 4 391 1 4 983 1 4 991 1 4 994 1 4 1004 1 4 1007 1 4 1020 1 4 1140 1 4 1146 1 4 1229 1 4 1318 1 4 1341 1 4 1342 1 4 1376 1 4 1387 2 2 1390 1 4 1391 1 4 1397 3 0 1398 1 4 1496 1 4 1561 1 4 1579 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAAGGAGGGCCAGGGGGCGGCAGC 3' Transcript: Sobic.003G234200.6:30-53 Slice Site:43 ||||o||o| ||o||| o|||| 3' CUUCUUCUC--UCUCCCA-UGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.003G234200.6:43 MFE of perfect match: -40.10 MFE of this site: -29.40 MFEratio: 0.733167082294264 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,53-49 7-12,46-41 13-21,38-30 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,48-47 AILt: Asymmetric internal loop with more nts on the transcript side x-x,40-39 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.526471631986268 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR529-Probable-3p-star_Sobic.003G234200.6_43_TPlot.pdf Position Reads Category 43 1 4 <<<<<<<<<< 70 1 4 71 2 2 72 1 4 74 1 4 75 3 2 76 1 4 79 1 4 118 1 4 122 1 4 153 1 4 167 1 4 171 1 4 178 1 4 210 1 4 212 1 4 213 1 4 261 1 4 292 1 4 318 1 4 321 1 4 329 1 4 331 1 4 336 1 4 337 1 4 344 1 4 356 1 4 473 1 4 492 1 4 495 2 2 496 3 2 497 2 2 498 2 2 499 2 2 501 2 2 502 2 2 504 4 0 505 2 2 506 3 2 507 2 2 523 1 4 641 2 2 642 1 4 644 1 4 646 1 4 648 1 4 649 1 4 819 1 4 823 1 4 858 1 4 875 1 4 880 1 4 929 1 4 932 1 4 937 1 4 1028 1 4 1062 1 4 1083 2 2 1086 1 4 1091 1 4 1096 1 4 1107 1 4 1112 1 4 1113 1 4 1114 1 4 1115 1 4 1121 1 4 1133 1 4 1146 1 4 1147 1 4 1152 1 4 1153 1 4 1155 1 4 1162 1 4 1164 1 4 1167 1 4 1170 1 4 1174 1 4 1175 1 4 1183 1 4 1184 2 2 1198 1 4 1199 1 4 1205 1 4 1238 1 4 1259 1 4 1266 1 4 1284 1 4 1285 1 4 1288 1 4 1289 1 4 1313 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAGAGCUUCCAUUCUUUGCGUCCAAG 3' Transcript: Sobic.003G238500.1:1283-1308 Slice Site:1295 |||||||o|| ||| o|||||o 3' GUCUCGAGGG-AAGU----UAGGUUU 5' Query: miR159-Known-3p-mature SiteID: Sobic.003G238500.1:1295 MFE of perfect match: -37.80 MFE of this site: -24.68 MFEratio: 0.652910052910053 Allen et al. score: 14 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,1308-1302 9-11,1296-1294 12-21,1292-1283 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-8,1301-1297 AILt: Asymmetric internal loop with more nts on the transcript side x-x,1293-1293 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.725567003721479 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR159-Known-3p-mature_Sobic.003G238500.1_1295_TPlot.pdf Position Reads Category 301 1 4 641 1 4 795 1 4 844 1 4 846 1 4 847 1 4 869 1 4 873 1 4 990 1 4 1082 1 4 1083 1 4 1084 1 4 1093 1 4 1103 1 4 1104 1 4 1105 1 4 1120 1 4 1219 1 4 1295 1 4 <<<<<<<<<< 1298 2 0 1299 1 4 1300 1 4 1307 1 4 1351 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUGCUCUCUCUCUCUCUCUCU 3' Transcript: Sobic.003G291100.1:116-136 Slice Site:126 |||||||||||| ||| || 3' CACGAGAGAGAGA-AGACAGU 5' Query: miR156i-Probable-5p-mature SiteID: Sobic.003G291100.1:126 MFE of perfect match: -37.40 MFE of this site: -25.00 MFEratio: 0.668449197860963 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,135-134 5-7,132-130 8-19,128-117 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,136-136 UP5: Unpaired region at 5' of query 4-4,133-133 SIL: Symmetric internal loop x-x,129-129 BULt: Bulge on transcript side 20-20,116-116 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.195675833447841 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156i-Probable-5p-mature_Sobic.003G291100.1_126_TPlot.pdf Position Reads Category 126 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GCUGGCAGAAACAGAAGUGCCAGAGC 3' Transcript: Sobic.003G296300.1:582-607 Slice Site:594 ||||o|||||| |||||| |||| 3' CGACUGUCUUUCUCUUCA----CUCG 5' Query: miR156d-Known-3p-star SiteID: Sobic.003G296300.1:594 MFE of perfect match: -40.70 MFE of this site: -29.90 MFEratio: 0.734643734643735 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,607-604 5-10,599-594 12-22,592-582 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,603-600 BULt: Bulge on transcript side 11-11,593-593 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.147332955545844 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156d-Known-3p-star_Sobic.003G296300.1_594_TPlot.pdf Position Reads Category 364 1 4 464 1 4 594 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAAGAAGAGAGAGGAGAUGGC 3' Transcript: Sobic.003G351000.1:261-281 Slice Site:272 |||||||||||||| |oo|| 3' CUUCUUCUCUCUCCCAUGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.003G351000.1:272 MFE of perfect match: -40.10 MFE of this site: -31.60 MFEratio: 0.788029925187032 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,281-277 8-21,274-261 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-7,276-275 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.149244939800765 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR529-Probable-3p-star_Sobic.003G351000.1_272_TPlot.pdf Position Reads Category 259 1 4 260 1 4 265 1 4 272 1 4 <<<<<<<<<< 278 1 4 286 1 4 287 1 4 289 1 4 294 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAGGAGAAGGCUGCAGAGCGGGUG 3' Transcript: Sobic.003G359900.1:1077-1101 Slice Site:1092 |o |||||||| |||o|o ||| 3' CUACCUCUUCC----UCUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.003G359900.1:1092 MFE of perfect match: -39.00 MFE of this site: -26.30 MFEratio: 0.674358974358974 Allen et al. score: 13.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,1101-1099 5-10,1097-1092 11-18,1087-1080 20-21,1078-1077 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,1098-1098 SIL: Symmetric internal loop x-x,1091-1088 BULt: Bulge on transcript side 19-19,1079-1079 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.992673642288242 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR164a-Known-3p-star_Sobic.003G359900.1_1092_TPlot.pdf Position Reads Category 232 1 4 484 1 4 768 1 4 831 1 4 863 1 4 920 1 4 934 1 4 938 1 4 942 1 4 947 1 4 950 1 4 955 1 4 963 1 4 991 1 4 1016 1 4 1019 1 4 1042 1 4 1057 2 0 1072 1 4 1087 1 4 1092 1 4 <<<<<<<<<< 1103 1 4 1123 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGCGAUGG-GAACAUGUG 3' Transcript: Sobic.003G402900.1:1294-1313 Slice Site:1305 |o||| || || |||||o||| 3' CUACCUCUUCCUCUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.003G402900.1:1305 MFE of perfect match: -39.00 MFE of this site: -25.50 MFEratio: 0.653846153846154 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,1313-1305 11-12,1304-1303 14-15,1301-1300 17-21,1298-1294 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-10,x-x BULq: Bulge on query side 13-13,1302-1302 SIL: Symmetric internal loop 16-16,1299-1299 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999578528374484 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR164a-Known-3p-star_Sobic.003G402900.1_1305_TPlot.pdf Position Reads Category 677 1 4 718 1 4 942 1 4 1165 1 4 1190 1 4 1305 1 4 <<<<<<<<<< 1404 1 4 1491 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAU-AGCCAAGCCAAUGCUAUG 3' Transcript: Sobic.003G442900.1:58-78 Slice Site:69 ||| ||||||| ||||o|o||| 3' CUACUCGGUUCAGUUAUGGUAC 5' Query: miR171e-Known-5p-star SiteID: Sobic.003G442900.1:69 MFE of perfect match: -38.60 MFE of this site: -26.30 MFEratio: 0.681347150259067 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,78-69 12-18,67-61 20-22,60-58 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,68-68 SIL: Symmetric internal loop 19-19,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.23786372807055 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171e-Known-5p-star_Sobic.003G442900.1_69_TPlot.pdf Position Reads Category 5 1 4 44 1 4 69 1 4 <<<<<<<<<< 70 1 4 73 1 4 76 1 4 87 1 4 127 1 4 129 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGUGCUCAAGAAGGUGGAGCCU 3' Transcript: Sobic.004G000500.1:687-708 Slice Site:699 o ||| ||||||o| |o||||o 3' GGACG-GUUCUUUCUCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.004G000500.1:699 MFE of perfect match: -41.40 MFE of this site: -27.00 MFEratio: 0.652173913043478 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,708-702 9-16,700-693 17-19,691-689 21-21,687-687 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-8,701-701 SIL: Symmetric internal loop x-x,692-692 BULt: Bulge on transcript side 20-20,688-688 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.996771237211687 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR399a-Probable-5p-star_Sobic.004G000500.1_699_TPlot.pdf Position Reads Category 164 1 4 169 1 4 186 1 4 196 1 4 291 1 4 401 1 4 479 1 4 510 1 4 512 1 4 513 1 4 551 1 4 555 1 4 561 1 4 562 1 4 563 1 4 576 1 4 579 1 4 661 1 4 699 1 4 <<<<<<<<<< 716 1 4 723 1 4 728 1 4 734 1 4 737 1 4 742 1 4 743 1 4 744 1 4 747 1 4 836 1 4 1065 1 4 1170 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUUGACCGGGCGAGAGAAGCCA 3' Transcript: Sobic.004G030100.2:1426-1447 Slice Site:1438 |o|| ||oo| o||||||||| 3' GGAC-GGUUCUUUCUCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.004G030100.2:1438 MFE of perfect match: -41.40 MFE of this site: -28.90 MFEratio: 0.698067632850242 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-11,1446-1437 13-17,1435-1431 18-21,1429-1426 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1447-1447 UP5: Unpaired region at 5' of query 12-12,1436-1436 SIL: Symmetric internal loop x-x,1430-1430 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.815966217055779 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR399a-Probable-5p-star_Sobic.004G030100.2_1438_TPlot.pdf Position Reads Category 1180 1 4 1427 1 4 1438 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGCGGAGGACGUGGGCACCAC 3' Transcript: Sobic.004G053700.1:735-755 Slice Site:746 || ||||o| o||||||| 3' CCACCUCUUCUACCCGUGUAC 5' Query: miR164b-Known-3p-star SiteID: Sobic.004G053700.1:746 MFE of perfect match: -41.90 MFE of this site: -28.00 MFEratio: 0.668257756563246 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 4-11,752-745 13-18,743-738 20-21,736-735 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,755-753 UP5: Unpaired region at 5' of query 12-12,744-744 SIL: Symmetric internal loop 19-19,737-737 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.903591413141218 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR164b-Known-3p-star_Sobic.004G053700.1_746_TPlot.pdf Position Reads Category 746 1 4 <<<<<<<<<< 1045 1 4 1139 1 4 1144 1 4 1148 2 1 1152 1 4 1159 2 1 1164 1 4 1165 1 4 1166 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAAGGAGUGC-UGGAGGGAGA 3' Transcript: Sobic.004G102000.2:1583-1602 Slice Site:1593 |o||||| ||o|||||o 3' GUACUUCACGAACUUCCCUUG 5' Query: miR395a-Known-3p-star SiteID: Sobic.004G102000.2:1593 MFE of perfect match: -36.90 MFE of this site: -25.20 MFEratio: 0.682926829268293 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-10,1601-1593 12-18,1592-1586 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1602-1602 UP5: Unpaired region at 5' of query 11-11,x-x BULq: Bulge on query side 19-21,1585-1583 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.326386007290963 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR395a-Known-3p-star_Sobic.004G102000.2_1593_TPlot.pdf Position Reads Category 110 1 4 143 1 4 682 1 4 684 1 4 742 1 4 775 1 4 1593 1 4 <<<<<<<<<< 1657 2 0 1668 1 4 1669 1 4 1683 1 4 1711 1 4 1732 1 4 1739 1 4 1740 1 4 1747 1 4 1758 1 4 1795 1 4 1810 1 4 1816 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGGAGAUGGA-CCUGGUCCAA 3' Transcript: Sobic.004G157600.1:42-62 Slice Site:53 ||||| ||o| |||||||| 3' UCCCUA-ACUUCGGACCAGGCU 5' Query: miR166f-Probable-3p-mature SiteID: Sobic.004G157600.1:53 MFE of perfect match: -42.40 MFE of this site: -28.10 MFEratio: 0.662735849056604 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-10,60-53 12-15,52-49 17-21,46-42 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,62-61 UP5: Unpaired region at 5' of query 11-11,x-x BULq: Bulge on query side 16-16,48-47 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.309544956584059 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166f-Probable-3p-mature_Sobic.004G157600.1_53_TPlot.pdf Position Reads Category 53 1 4 <<<<<<<<<< 288 1 4 764 1 4 805 1 4 806 1 4 818 1 4 877 1 4 1238 1 4 1259 1 4 1323 1 4 1336 1 4 1341 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUUCCAGAGGUUUGGUCGUUGCACUGU 3' Transcript: Sobic.004G167600.16:60-86 Slice Site:77 o|||||o||| o|||||||| 3' UAAGGUUUCCC------UAACGUGACU 5' Query: miR393-Known-3p-star SiteID: Sobic.004G167600.16:77 MFE of perfect match: -36.00 MFE of this site: -24.16 MFEratio: 0.671111111111111 Allen et al. score: 17 Paired Regions (query5'-query3',transcript3'-transcript5') 2-10,85-77 12-21,69-60 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,86-86 UP5: Unpaired region at 5' of query 11-11,76-70 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.407293493341041 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR393-Known-3p-star_Sobic.004G167600.16_77_TPlot.pdf Position Reads Category 77 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGCCGGGUACCGGACACCGUUCC 3' Transcript: Sobic.004G283800.1:537-559 Slice Site:550 ||| |||||||| |o|||| 3' GAAGCC--UGGCCUGUAGUAAGG 5' Query: miR166a-Probable-5p-star SiteID: Sobic.004G283800.1:550 MFE of perfect match: -40.60 MFE of this site: -26.70 MFEratio: 0.657635467980295 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,559-554 8-15,552-545 16-18,542-540 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,553-553 SIL: Symmetric internal loop x-x,544-543 BULt: Bulge on transcript side 19-21,539-537 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.428204538409406 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166a-Probable-5p-star_Sobic.004G283800.1_550_TPlot.pdf Position Reads Category 187 1 4 550 1 4 <<<<<<<<<< 984 1 4 992 1 4 1834 1 4 1843 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUCAUUCAA-GCUGGACUCAG 3' Transcript: Sobic.004G335500.1:1194-1214 Slice Site:1205 ||||| |||| |||| |||||o 3' CGAGU-AGUUGCGACGUGAGUU 5' Query: miR397-Known-5p-mature SiteID: Sobic.004G335500.1:1205 MFE of perfect match: -39.40 MFE of this site: -26.40 MFEratio: 0.67005076142132 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,1214-1209 8-11,1207-1204 13-16,1203-1200 17-21,1198-1194 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,1208-1208 SIL: Symmetric internal loop 12-12,x-x BULq: Bulge on query side x-x,1199-1199 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.080681260303673 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR397-Known-5p-mature_Sobic.004G335500.1_1205_TPlot.pdf Position Reads Category 1 2 2 2 1 4 140 1 4 247 1 4 250 1 4 256 1 4 259 2 2 261 1 4 262 2 2 265 1 4 415 1 4 424 1 4 426 1 4 428 1 4 436 1 4 437 1 4 462 1 4 467 2 2 470 1 4 471 1 4 472 1 4 474 1 4 475 1 4 477 1 4 478 1 4 479 1 4 496 1 4 506 1 4 530 1 4 567 1 4 569 3 2 570 2 2 571 2 2 572 1 4 574 1 4 575 1 4 580 1 4 614 1 4 615 1 4 625 1 4 639 1 4 649 1 4 663 1 4 667 1 4 670 1 4 672 1 4 674 1 4 682 2 2 698 2 2 794 1 4 795 1 4 864 1 4 870 1 4 871 1 4 884 1 4 890 1 4 894 1 4 895 1 4 896 1 4 898 1 4 901 1 4 995 1 4 1005 1 4 1006 1 4 1009 1 4 1012 1 4 1016 6 2 1017 1 4 1018 3 2 1019 2 2 1021 2 2 1022 5 2 1023 1 4 1025 1 4 1026 1 4 1028 3 2 1029 1 4 1030 2 2 1031 1 4 1033 1 4 1034 1 4 1037 1 4 1038 6 2 1039 8 0 1040 3 2 1041 2 2 1042 1 4 1045 2 2 1047 3 2 1048 2 2 1051 1 4 1054 3 2 1055 1 4 1056 1 4 1057 1 4 1063 1 4 1092 1 4 1093 2 2 1097 1 4 1098 1 4 1101 1 4 1102 1 4 1104 1 4 1105 1 4 1106 1 4 1107 1 4 1108 1 4 1111 1 4 1112 1 4 1114 2 2 1117 2 2 1118 5 2 1129 1 4 1131 1 4 1135 1 4 1142 1 4 1143 1 4 1170 1 4 1174 1 4 1187 1 4 1205 2 2 <<<<<<<<<< 1213 1 4 1303 1 4 1304 1 4 1305 1 4 1316 1 4 1319 1 4 1330 1 4 1348 1 4 1442 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCUACGUGACCAUCGACGACA 3' Transcript: Sobic.004G335500.1:244-265 Slice Site:256 || || o||||||o|o||o| 3' CCAAUUUACUGGUGGUUGUUUU 5' Query: miR827-Known-5p-star SiteID: Sobic.004G335500.1:256 MFE of perfect match: -33.70 MFE of this site: -22.70 MFEratio: 0.673590504451039 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-16,263-250 18-19,248-247 21-22,245-244 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,265-264 UP5: Unpaired region at 5' of query 17-17,249-249 SIL: Symmetric internal loop 20-20,246-246 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.679589325949026 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR827-Known-5p-star_Sobic.004G335500.1_256_TPlot.pdf Position Reads Category 1 2 2 2 1 4 140 1 4 247 1 4 250 1 4 256 1 4 <<<<<<<<<< 259 2 2 261 1 4 262 2 2 265 1 4 415 1 4 424 1 4 426 1 4 428 1 4 436 1 4 437 1 4 462 1 4 467 2 2 470 1 4 471 1 4 472 1 4 474 1 4 475 1 4 477 1 4 478 1 4 479 1 4 496 1 4 506 1 4 530 1 4 567 1 4 569 3 2 570 2 2 571 2 2 572 1 4 574 1 4 575 1 4 580 1 4 614 1 4 615 1 4 625 1 4 639 1 4 649 1 4 663 1 4 667 1 4 670 1 4 672 1 4 674 1 4 682 2 2 698 2 2 794 1 4 795 1 4 864 1 4 870 1 4 871 1 4 884 1 4 890 1 4 894 1 4 895 1 4 896 1 4 898 1 4 901 1 4 995 1 4 1005 1 4 1006 1 4 1009 1 4 1012 1 4 1016 6 2 1017 1 4 1018 3 2 1019 2 2 1021 2 2 1022 5 2 1023 1 4 1025 1 4 1026 1 4 1028 3 2 1029 1 4 1030 2 2 1031 1 4 1033 1 4 1034 1 4 1037 1 4 1038 6 2 1039 8 0 1040 3 2 1041 2 2 1042 1 4 1045 2 2 1047 3 2 1048 2 2 1051 1 4 1054 3 2 1055 1 4 1056 1 4 1057 1 4 1063 1 4 1092 1 4 1093 2 2 1097 1 4 1098 1 4 1101 1 4 1102 1 4 1104 1 4 1105 1 4 1106 1 4 1107 1 4 1108 1 4 1111 1 4 1112 1 4 1114 2 2 1117 2 2 1118 5 2 1129 1 4 1131 1 4 1135 1 4 1142 1 4 1143 1 4 1170 1 4 1174 1 4 1187 1 4 1205 2 2 1213 1 4 1303 1 4 1304 1 4 1305 1 4 1316 1 4 1319 1 4 1330 1 4 1348 1 4 1442 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAUGAGGAUGAAGGUCAUGUAUGGU 3' Transcript: Sobic.005G004900.1:807-831 Slice Site:822 |||||| ||||||o|||o| 3' UUACUCCGA----CAGUACGUACUA 5' Query: miR167i-Known-3p-star SiteID: Sobic.005G004900.1:822 MFE of perfect match: -36.50 MFE of this site: -24.06 MFEratio: 0.659178082191781 Allen et al. score: 13 Paired Regions (query5'-query3',transcript3'-transcript5') 1-12,831-820 15-20,813-808 Unpaired Regions (query5'-query3',transcript3'-transcript5') 13-14,819-814 AILt: Asymmetric internal loop with more nts on the transcript side 21-21,807-807 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.586143495019353 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167i-Known-3p-star_Sobic.005G004900.1_822_TPlot.pdf Position Reads Category 822 1 4 <<<<<<<<<< 1029 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGU--GGUGACCACCGGCGAGG 3' Transcript: Sobic.005G050200.1:102-121 Slice Site:112 ||| oo||||||||oo|o|o 3' CCAAUUUACUGGUGGUUGUUUU 5' Query: miR827-Known-5p-star SiteID: Sobic.005G050200.1:112 MFE of perfect match: -33.70 MFE of this site: -26.30 MFEratio: 0.780415430267062 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 2-17,120-105 20-22,104-102 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,121-121 UP5: Unpaired region at 5' of query 18-19,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.02876165579836 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR827-Known-5p-star_Sobic.005G050200.1_112_TPlot.pdf Position Reads Category 104 1 4 108 1 4 112 1 4 <<<<<<<<<< 114 1 4 115 2 0 117 1 4 118 1 4 119 1 4 120 1 4 123 1 4 130 1 4 133 1 4 136 1 4 137 1 4 139 1 4 142 1 4 219 1 4 227 1 4 236 1 4 240 1 4 323 1 4 327 1 4 331 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUGGGCCAUGCUCGGUGCCGCUG 3' Transcript: Sobic.005G087000.1:362-385 Slice Site:375 ||||o|||| | ||oo|o||o || 3' CUACUCGGUUC-AGUUAUGGU-AC 5' Query: miR171e-Known-5p-star SiteID: Sobic.005G087000.1:375 MFE of perfect match: -38.60 MFE of this site: -27.50 MFEratio: 0.712435233160622 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,385-384 3-11,382-374 12-12,372-372 14-22,370-362 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,383-383 BULt: Bulge on transcript side x-x,373-373 BULt: Bulge on transcript side 13-13,371-371 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.10617365021145 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171e-Known-5p-star_Sobic.005G087000.1_375_TPlot.pdf Position Reads Category 8 1 4 24 1 4 78 1 4 81 1 4 90 1 4 91 2 2 94 1 4 95 2 2 101 1 4 102 1 4 103 1 4 115 1 4 126 1 4 129 1 4 131 1 4 132 1 4 133 1 4 134 2 2 135 1 4 138 1 4 140 1 4 145 1 4 146 1 4 149 1 4 151 1 4 159 1 4 161 1 4 164 1 4 169 3 2 171 1 4 173 3 2 178 1 4 191 1 4 242 1 4 252 1 4 254 1 4 294 1 4 297 1 4 330 1 4 369 1 4 373 1 4 374 1 4 375 1 4 <<<<<<<<<< 460 2 2 463 2 2 465 2 2 466 1 4 469 3 2 470 1 4 473 2 2 474 3 2 475 1 4 478 2 2 479 1 4 480 3 2 481 3 2 483 1 4 486 1 4 488 1 4 490 6 0 492 2 2 494 1 4 499 1 4 500 1 4 517 1 4 531 1 4 535 1 4 566 1 4 567 1 4 569 1 4 575 1 4 580 1 4 624 1 4 636 1 4 650 1 4 690 1 4 698 2 2 700 1 4 706 1 4 740 1 4 742 1 4 744 2 2 753 1 4 756 1 4 757 1 4 758 1 4 759 1 4 767 2 2 768 2 2 770 1 4 771 1 4 772 1 4 773 1 4 775 3 2 776 1 4 778 2 2 779 2 2 780 1 4 784 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGGGGGCUUCUUGCAUGGCCUGAAGAAGAAGGACGCA 3' Transcript: Sobic.005G111900.2:135-171 Slice Site:155 ||||||| |o||||| |o||o|| 3' GCCCCCG---------CUGGACU-------CUUGUGU 5' Query: miR398-Known-3p-mature SiteID: Sobic.005G111900.2:155 MFE of perfect match: -45.30 MFE of this site: -29.70 MFEratio: 0.655629139072848 Allen et al. score: 25.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,171-165 8-14,157-151 15-21,141-135 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,164-158 BULt: Bulge on transcript side x-x,150-142 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.882534544505095 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR398-Known-3p-mature_Sobic.005G111900.2_155_TPlot.pdf Position Reads Category 155 1 4 <<<<<<<<<< 496 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGAAGCUGCU-GACGAUGA 3' Transcript: Sobic.005G144201.1:1390-1409 Slice Site:1401 |o||||o||||o |||||| 3' CUACUUUGACGGUCUGCUAGA 5' Query: miR167c-Known-3p-star SiteID: Sobic.005G144201.1:1401 MFE of perfect match: -37.50 MFE of this site: -26.80 MFEratio: 0.714666666666667 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 3-8,1407-1402 10-21,1401-1390 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1409-1408 UP5: Unpaired region at 5' of query 9-9,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.25142876304393 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167c-Known-3p-star_Sobic.005G144201.1_1401_TPlot.pdf Position Reads Category 225 1 4 388 1 4 694 1 4 785 1 4 1269 1 4 1374 1 4 1376 1 4 1401 1 4 <<<<<<<<<< 1403 1 4 1507 1 4 1518 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGUGAUGCUGCAGGGUGGGC 3' Transcript: Sobic.005G224500.1:861-880 Slice Site:871 |||| ||||||o o||o 3' UCACUUCGACGUUGUACUAG 5' Query: miR167k-Known-3p-star SiteID: Sobic.005G224500.1:871 MFE of perfect match: -34.60 MFE of this site: -22.70 MFEratio: 0.65606936416185 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 3-6,878-875 8-14,873-867 16-19,865-862 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,880-879 UP5: Unpaired region at 5' of query 7-7,874-874 SIL: Symmetric internal loop 15-15,866-866 SIL: Symmetric internal loop 20-20,861-861 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.947648048942103 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167k-Known-3p-star_Sobic.005G224500.1_871_TPlot.pdf Position Reads Category 1 1 4 17 1 4 747 1 4 838 1 4 841 1 4 847 1 4 871 1 4 <<<<<<<<<< 885 1 4 890 1 4 1054 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAAUGGAUCCUGGAACUGAGA 3' Transcript: Sobic.006G048700.1:613-634 Slice Site:624 ||||||o| ||||| |o|||| 3' CCUUACUUCGGACCA-GGCUCU 5' Query: miR166k-Known-3p-mature SiteID: Sobic.006G048700.1:624 MFE of perfect match: -42.00 MFE of this site: -27.60 MFEratio: 0.657142857142857 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,634-629 8-12,626-622 14-21,620-613 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,628-627 AILt: Asymmetric internal loop with more nts on the transcript side 13-13,621-621 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.420450780109202 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166k-Known-3p-mature_Sobic.006G048700.1_624_TPlot.pdf Position Reads Category 207 1 4 404 1 4 426 1 4 478 1 4 578 1 4 624 1 4 <<<<<<<<<< 654 1 4 657 1 4 662 1 4 664 1 4 667 1 4 668 1 4 669 1 4 670 1 4 671 1 4 973 1 4 1011 1 4 1116 1 4 1117 2 1 1142 1 4 1143 2 1 --------------------------------------------------- --------------------------------------------------- 5' GGUGGGGGUGGUGGAGCGGGGA 3' Transcript: Sobic.006G049633.1:134-155 Slice Site:146 |||||o|o || |||||o | 3' CCACCUCUUCC-CCUCGUGCAC 5' Query: miR164c-Probable-3p-star SiteID: Sobic.006G049633.1:146 MFE of perfect match: -45.50 MFE of this site: -30.30 MFEratio: 0.665934065934066 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 3-3,153-153 5-10,151-146 11-12,144-143 14-21,141-134 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,155-154 UP5: Unpaired region at 5' of query 4-4,152-152 SIL: Symmetric internal loop x-x,145-145 BULt: Bulge on transcript side 13-13,142-142 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.958455420487763 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR164c-Probable-3p-star_Sobic.006G049633.1_146_TPlot.pdf Position Reads Category 146 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GA-CAAUGCGAUCCCUUUGGAU 3' Transcript: Sobic.006G056000.1:1503-1523 Slice Site:1514 || |||||||||||||||||| 3' CUAGUUACGCUAGGGAAACCUC 5' Query: miR393-Known-5p-mature SiteID: Sobic.006G056000.1:1514 MFE of perfect match: -40.10 MFE of this site: -34.20 MFEratio: 0.85286783042394 Allen et al. score: 2 Paired Regions (query5'-query3',transcript3'-transcript5') 2-19,1522-1505 21-22,1504-1503 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1523-1523 UP5: Unpaired region at 5' of query 20-20,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00671199896800023 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR393-Known-5p-mature_Sobic.006G056000.1_1514_TPlot.pdf Position Reads Category 703 1 4 782 1 4 943 1 4 1180 1 4 1361 1 4 1373 1 4 1416 1 4 1513 2 0 1514 1 4 <<<<<<<<<< 1528 1 4 1587 1 4 1607 1 4 1630 1 4 1685 1 4 1701 1 4 1716 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGAGAUGCUGGCGGCUGAG 3' Transcript: Sobic.006G101600.3:383-402 Slice Site:393 ||o ||||||||o||| 3' UCUAGUACGACCGUCGAAGU 5' Query: miR167b-Known-5p-mature SiteID: Sobic.006G101600.3:393 MFE of perfect match: -37.60 MFE of this site: -24.90 MFEratio: 0.662234042553191 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 4-15,399-388 18-20,385-383 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,402-400 UP5: Unpaired region at 5' of query 16-17,387-386 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.768091825436394 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167b-Known-5p-mature_Sobic.006G101600.3_393_TPlot.pdf Position Reads Category 393 1 4 <<<<<<<<<< 1004 1 4 1147 1 4 1502 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGCUUCUGGCGAGAUGGCUGA 3' Transcript: Sobic.006G121400.2:432-452 Slice Site:443 ||||| |||||||||o| 3' ACGAAGUCCGCUCUACUGUGG 5' Query: miR1432-Known-3p-star SiteID: Sobic.006G121400.2:443 MFE of perfect match: -41.90 MFE of this site: -30.10 MFEratio: 0.718377088305489 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 4-14,449-439 16-20,437-433 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,452-450 UP5: Unpaired region at 5' of query 15-15,438-438 SIL: Symmetric internal loop 21-21,432-432 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.211763238932807 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR1432-Known-3p-star_Sobic.006G121400.2_443_TPlot.pdf Position Reads Category 443 1 4 <<<<<<<<<< 572 1 4 621 1 4 685 2 0 --------------------------------------------------- --------------------------------------------------- 5' GGCCUGCGUGGCCGGCGACGA 3' Transcript: Sobic.006G133700.1:243-263 Slice Site:254 o| ||||o|oo||o|| |o 3' UC-GACGUAUUGGUCGAGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.006G133700.1:254 MFE of perfect match: -39.10 MFE of this site: -25.60 MFEratio: 0.654731457800512 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,262-261 6-18,258-246 19-20,244-243 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,263-263 UP5: Unpaired region at 5' of query 4-5,260-259 SIL: Symmetric internal loop x-x,245-245 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999188198356391 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166j-Probable-5p-star_Sobic.006G133700.1_254_TPlot.pdf Position Reads Category 254 1 4 <<<<<<<<<< 821 1 4 859 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGGGAGAACGGGGAGAAGACGAUG 3' Transcript: Sobic.006G188600.1:1489-1515 Slice Site:1505 |o|||o|| o|||||| ||| || 3' CUACCUCU-----UCCUCUUGUGC-AC 5' Query: miR164a-Known-3p-star SiteID: Sobic.006G188600.1:1505 MFE of perfect match: -39.00 MFE of this site: -26.10 MFEratio: 0.669230769230769 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,1515-1514 3-5,1512-1510 7-13,1508-1502 14-21,1496-1489 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1513-1513 BULt: Bulge on transcript side 6-6,1509-1509 SIL: Symmetric internal loop x-x,1501-1497 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.995396626910946 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR164a-Known-3p-star_Sobic.006G188600.1_1505_TPlot.pdf Position Reads Category 1470 1 4 1505 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UAUCCGGCCGGAGUUCGACAGGCC 3' Transcript: Sobic.006G190000.1:57-80 Slice Site:68 ||||o||o|| |o||| || 3' AGAGGCUGGUCU---GUUGUAAGG 5' Query: miR166d-Known-5p-star SiteID: Sobic.006G190000.1:68 MFE of perfect match: -39.70 MFE of this site: -26.00 MFEratio: 0.654911838790932 Allen et al. score: 14.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,80-79 5-9,76-72 10-19,68-59 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-4,78-77 SIL: Symmetric internal loop x-x,71-69 BULt: Bulge on transcript side 20-21,58-57 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.87033958954305 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166d-Known-5p-star_Sobic.006G190000.1_68_TPlot.pdf Position Reads Category 67 1 4 68 1 4 <<<<<<<<<< 944 2 0 --------------------------------------------------- --------------------------------------------------- 5' CCGGAUUCGUCCGCGCCAAAU 3' Transcript: Sobic.006G241800.1:913-933 Slice Site:924 ||o||| ||||||||| 3' AGCUUAACUUGGCGCGGUUAU 5' Query: miR171i-Probable-5p-star SiteID: Sobic.006G241800.1:924 MFE of perfect match: -36.20 MFE of this site: -23.68 MFEratio: 0.65414364640884 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-11,931-923 15-20,919-914 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,933-932 UP5: Unpaired region at 5' of query 12-14,922-920 SIL: Symmetric internal loop 21-21,913-913 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.82005151935974 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171i-Probable-5p-star_Sobic.006G241800.1_924_TPlot.pdf Position Reads Category 924 1 4 <<<<<<<<<< 1792 1 4 1908 1 4 2043 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGCGGUGAAGAUGGUCGCCGA 3' Transcript: Sobic.006G264900.1:3308-3329 Slice Site:3320 ||||||| o|||||||| 3' GUACCCACUUCGUUCAGCGGCU 5' Query: miR5564b-Known-3p-star SiteID: Sobic.006G264900.1:3320 MFE of perfect match: -44.00 MFE of this site: -30.20 MFEratio: 0.686363636363636 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,3329-3321 12-18,3318-3312 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-11,3320-3319 SIL: Symmetric internal loop 19-22,3311-3308 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.32789649061072 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564b-Known-3p-star_Sobic.006G264900.1_3320_TPlot.pdf Position Reads Category 415 1 4 425 1 4 505 1 4 615 1 4 635 1 4 1074 1 4 1362 1 4 1366 1 4 1390 1 4 1397 1 4 1410 1 4 1413 1 4 1414 1 4 1420 1 4 1433 1 4 1447 1 4 1457 1 4 1459 1 4 1461 1 4 1462 1 4 1465 1 4 1507 1 4 1572 1 4 1578 1 4 1585 1 4 1587 1 4 1589 1 4 1796 1 4 1798 1 4 1830 1 4 1993 1 4 2001 1 4 2056 1 4 2062 1 4 2067 1 4 2068 3 0 2069 1 4 2073 1 4 2074 1 4 2076 1 4 2079 1 4 2080 1 4 2090 1 4 2094 1 4 2098 1 4 2116 1 4 2161 1 4 2246 1 4 2289 1 4 2309 1 4 2334 1 4 2361 1 4 2366 1 4 2371 1 4 2460 1 4 2473 1 4 2484 1 4 2535 1 4 2542 1 4 2546 1 4 2553 1 4 2560 1 4 2563 1 4 2566 1 4 2580 1 4 2656 1 4 2662 1 4 2666 1 4 2709 1 4 2738 1 4 2770 1 4 2773 1 4 2776 1 4 2929 1 4 2983 1 4 3094 1 4 3115 1 4 3182 1 4 3248 1 4 3309 1 4 3312 1 4 3313 1 4 3315 1 4 3317 1 4 3319 1 4 3320 1 4 <<<<<<<<<< 3326 1 4 3327 1 4 3330 1 4 3350 1 4 3446 1 4 3447 1 4 3537 1 4 3675 1 4 3750 1 4 3787 1 4 3802 1 4 3811 1 4 3817 1 4 3825 2 2 3828 1 4 3829 1 4 3830 1 4 3831 1 4 3832 1 4 3849 1 4 3897 1 4 3968 1 4 3974 1 4 4075 1 4 4090 1 4 4098 1 4 4105 1 4 4108 2 2 4109 1 4 4111 1 4 4113 2 2 4114 1 4 4122 1 4 4127 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCAGCCAGAGGAGAGCAGUG 3' Transcript: Sobic.007G021400.1:191-210 Slice Site:201 ||||||||||||| |o 3' GGACGGUCUCCUCUCGACGG 5' Query: miR399b-Probable-5p-star SiteID: Sobic.007G021400.1:201 MFE of perfect match: -45.40 MFE of this site: -30.40 MFEratio: 0.669603524229075 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,209-208 5-17,206-194 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,210-210 UP5: Unpaired region at 5' of query 4-4,207-207 SIL: Symmetric internal loop 18-20,193-191 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.926688279560124 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR399b-Probable-5p-star_Sobic.007G021400.1_201_TPlot.pdf Position Reads Category 201 1 4 <<<<<<<<<< 619 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAGAGUUCCCAUCAG-CUAAA 3' Transcript: Sobic.007G133000.1:1394-1413 Slice Site:1405 |||||o|||| |||o |o||| 3' GUCUCGAGGGAAGUUAGGUUU 5' Query: miR159-Known-3p-mature SiteID: Sobic.007G133000.1:1405 MFE of perfect match: -37.80 MFE of this site: -25.60 MFEratio: 0.677248677248677 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,1413-1409 7-10,1408-1405 12-21,1403-1394 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,x-x BULq: Bulge on query side 11-11,1404-1404 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.458195986736432 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR159-Known-3p-mature_Sobic.007G133000.1_1405_TPlot.pdf Position Reads Category 588 1 4 652 2 0 694 1 4 796 1 4 799 1 4 1069 1 4 1405 1 4 <<<<<<<<<< 1492 1 4 2129 1 4 2130 1 4 2204 1 4 2381 1 4 2560 1 4 2697 1 4 2726 1 4 2813 1 4 3039 1 4 3160 1 4 3411 1 4 4050 1 4 4107 1 4 4136 1 4 4138 1 4 4139 1 4 4140 1 4 4143 1 4 4144 1 4 4146 1 4 4147 1 4 4148 1 4 4149 1 4 4150 1 4 4151 1 4 4266 1 4 4270 1 4 4392 1 4 4411 1 4 4558 1 4 4580 1 4 --------------------------------------------------- --------------------------------------------------- 5' AUUGAAGCAGCAGCAUGAGA 3' Transcript: Sobic.007G164200.2:1923-1942 Slice Site:1933 |||||| |||o||||| 3' UCACUUCGACGUUGUACUAG 5' Query: miR167k-Known-3p-star SiteID: Sobic.007G164200.2:1933 MFE of perfect match: -34.60 MFE of this site: -22.70 MFEratio: 0.65606936416185 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 3-11,1940-1932 13-18,1930-1925 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1942-1941 UP5: Unpaired region at 5' of query 12-12,1931-1931 SIL: Symmetric internal loop 19-20,1924-1923 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.944625949180752 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167k-Known-3p-star_Sobic.007G164200.2_1933_TPlot.pdf Position Reads Category 598 1 4 1363 1 4 1364 1 4 1735 1 4 1758 1 4 1931 1 4 1933 1 4 <<<<<<<<<< 1939 1 4 1966 1 4 1968 1 4 1996 1 4 1999 1 4 2010 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAGUUCAAGAAGUUUGUGGUG 3' Transcript: Sobic.007G197800.1:211-231 Slice Site:222 |||||||||||o o||||| 3' UUCAAGUUCUUUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.007G197800.1:222 MFE of perfect match: -33.40 MFE of this site: -22.60 MFEratio: 0.676646706586826 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 3-8,229-224 10-21,222-211 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,231-230 UP5: Unpaired region at 5' of query 9-9,223-223 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.719966002718164 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.007G197800.1_222_TPlot.pdf Position Reads Category 6 1 4 16 1 4 19 1 4 125 1 4 158 1 4 166 3 0 169 1 4 170 1 4 172 1 4 195 1 4 207 1 4 209 1 4 217 1 4 219 1 4 221 1 4 222 1 4 <<<<<<<<<< 224 1 4 227 1 4 229 1 4 233 1 4 271 1 4 272 1 4 286 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGUUGAGGUG-GCCAGUACUG 3' Transcript: Sobic.008G021300.1:606-625 Slice Site:616 o||||||o| ||||o|||o 3' CUAACUCCGCGCGGUUAUGGA 5' Query: miR171b-Probable-5p-star SiteID: Sobic.008G021300.1:616 MFE of perfect match: -41.00 MFE of this site: -28.10 MFEratio: 0.685365853658537 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 2-10,624-616 12-20,615-607 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,625-625 UP5: Unpaired region at 5' of query 11-11,x-x BULq: Bulge on query side 21-21,606-606 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.550300450720019 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171b-Probable-5p-star_Sobic.008G021300.1_616_TPlot.pdf Position Reads Category 102 1 4 232 1 4 270 1 4 420 1 4 616 1 4 <<<<<<<<<< 627 1 4 670 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAGGAGGAGGAGGAGGAGGUG 3' Transcript: Sobic.008G034300.2:519-540 Slice Site:531 || ||||o||| |||| | ||| 3' CCACCUCUUCC-CCUCGUGCAC 5' Query: miR164c-Probable-3p-star SiteID: Sobic.008G034300.2:531 MFE of perfect match: -45.50 MFE of this site: -31.20 MFEratio: 0.685714285714286 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,540-538 5-5,536-536 7-10,534-531 11-18,529-522 20-21,520-519 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,537-537 SIL: Symmetric internal loop 6-6,535-535 SIL: Symmetric internal loop x-x,530-530 BULt: Bulge on transcript side 19-19,521-521 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.859425961522711 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR164c-Probable-3p-star_Sobic.008G034300.2_531_TPlot.pdf Position Reads Category 147 7 2 148 11 0 149 2 3 150 5 2 151 6 2 152 3 3 153 1 4 154 1 4 155 2 3 156 2 3 531 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAUGAUAGAAAGA--UAGUUGCU 3' Transcript: Sobic.008G054500.1:1135-1155 Slice Site:1148 |||o|||||||o| ||o|||| 3' CUAUUAUCUUUUUUAAUUAACGU 5' Query: miR156g-Probable-3p-star SiteID: Sobic.008G054500.1:1148 MFE of perfect match: -26.30 MFE of this site: -20.40 MFEratio: 0.775665399239544 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-8,1154-1148 11-23,1147-1135 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1155-1155 UP5: Unpaired region at 5' of query 9-10,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0524513577697822 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156g-Probable-3p-star_Sobic.008G054500.1_1148_TPlot.pdf Position Reads Category 1069 1 4 1148 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' AGCUGCCGCAGCCGGAGCCAC 3' Transcript: Sobic.008G082400.1:167-187 Slice Site:178 |||||| |o||o| |||| 3' UCGACGUA-UUGGUCGAGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.008G082400.1:178 MFE of perfect match: -39.10 MFE of this site: -26.10 MFEratio: 0.667519181585678 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,187-184 7-12,181-176 15-20,172-167 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-6,183-182 SIL: Symmetric internal loop 13-14,175-173 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.993919093103434 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166j-Probable-5p-star_Sobic.008G082400.1_178_TPlot.pdf Position Reads Category 13 1 4 178 1 4 <<<<<<<<<< 226 1 4 233 1 4 236 1 4 240 2 2 256 1 4 258 1 4 264 1 4 296 1 4 299 2 2 301 1 4 302 1 4 305 1 4 308 1 4 309 2 2 311 1 4 323 2 2 325 1 4 327 1 4 335 2 2 337 3 2 338 1 4 339 1 4 340 1 4 341 5 0 342 4 2 343 1 4 345 2 2 346 1 4 347 3 2 349 2 2 351 1 4 354 2 2 359 1 4 365 2 2 366 2 2 368 1 4 371 1 4 372 1 4 373 1 4 374 1 4 375 1 4 377 3 2 378 3 2 379 1 4 383 1 4 384 3 2 387 1 4 388 1 4 390 1 4 392 1 4 394 1 4 395 1 4 400 1 4 402 1 4 413 2 2 419 1 4 435 1 4 440 2 2 441 1 4 458 1 4 462 1 4 464 4 2 465 3 2 466 2 2 467 1 4 468 2 2 469 1 4 470 4 2 471 3 2 472 1 4 473 1 4 484 1 4 487 1 4 495 1 4 499 1 4 500 1 4 502 1 4 518 1 4 529 2 2 538 1 4 541 1 4 542 1 4 565 1 4 570 1 4 571 3 2 572 1 4 578 1 4 582 1 4 584 1 4 585 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGUGAGGCUGAUGCGGCGCGGUGG 3' Transcript: Sobic.008G116500.1:1054-1077 Slice Site:1068 ||||oo||| o||o||o||o| 3' CCACUUUGAC-GCGUCGUGCUAGA 5' Query: miR167f-Known-3p-star SiteID: Sobic.008G116500.1:1068 MFE of perfect match: -45.10 MFE of this site: -31.70 MFEratio: 0.702882483370288 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-13,1075-1065 14-22,1063-1055 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1077-1076 UP5: Unpaired region at 5' of query x-x,1064-1064 BULt: Bulge on transcript side 23-23,1054-1054 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.21705388325963 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167f-Known-3p-star_Sobic.008G116500.1_1068_TPlot.pdf Position Reads Category 1068 1 4 <<<<<<<<<< 1080 1 4 1340 1 4 1649 1 4 1654 1 4 1800 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAAGAAGAAAGAGGCG-GCGGC 3' Transcript: Sobic.008G131200.1:543-563 Slice Site:554 |||||||| ||||| | o|o|| 3' CUUCUUCUCUCUCC-CAUGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.008G131200.1:554 MFE of perfect match: -40.10 MFE of this site: -26.10 MFEratio: 0.650872817955112 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,563-559 7-7,558-558 8-12,556-552 14-21,550-543 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,x-x BULq: Bulge on query side x-x,557-557 BULt: Bulge on transcript side 13-13,551-551 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.996452000986147 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR529-Probable-3p-star_Sobic.008G131200.1_554_TPlot.pdf Position Reads Category 9 1 4 123 1 4 126 1 4 135 2 2 136 1 4 139 1 4 280 1 4 286 1 4 497 1 4 528 2 2 544 2 2 545 2 2 547 3 2 548 1 4 549 2 2 550 2 2 551 1 4 552 1 4 554 1 4 <<<<<<<<<< 574 1 4 577 2 2 580 1 4 584 1 4 587 1 4 588 1 4 604 1 4 610 2 2 614 1 4 641 2 2 642 2 2 643 1 4 645 1 4 647 3 2 649 2 2 650 2 2 655 1 4 658 4 0 659 1 4 660 1 4 664 1 4 665 1 4 666 1 4 670 1 4 678 1 4 680 1 4 685 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGUUGCCAGACGACGAUCC 3' Transcript: Sobic.008G133100.1:578-598 Slice Site:589 || o||||||o||o|o|| 3' GGAACUUGGUCUGUUGUUGGG 5' Query: miR166f-Probable-5p-star SiteID: Sobic.008G133100.1:589 MFE of perfect match: -38.90 MFE of this site: -26.88 MFEratio: 0.691002570694087 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-15,598-584 19-20,580-579 Unpaired Regions (query5'-query3',transcript3'-transcript5') 16-18,583-581 SIL: Symmetric internal loop 21-21,578-578 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.640723543145464 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166f-Probable-5p-star_Sobic.008G133100.1_589_TPlot.pdf Position Reads Category 586 2 0 589 1 4 <<<<<<<<<< 825 1 4 975 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAUU-GGCUACAGCAUGAUCA 3' Transcript: Sobic.008G179900.3:153-172 Slice Site:163 ||| oo|||||||||||o| 3' CUACUUUGAUGUCGUACUGGA 5' Query: miR167j-Known-3p-star SiteID: Sobic.008G179900.3:163 MFE of perfect match: -35.90 MFE of this site: -25.70 MFEratio: 0.715877437325905 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-16,171-157 19-21,155-153 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,172-172 UP5: Unpaired region at 5' of query 17-18,156-156 AILq: Asymmetric internal loop with more nts on the query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.392475213968887 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167j-Known-3p-star_Sobic.008G179900.3_163_TPlot.pdf Position Reads Category 151 1 4 158 1 4 160 1 4 161 1 4 163 1 4 <<<<<<<<<< 166 1 4 286 1 4 308 1 4 433 1 4 449 1 4 457 1 4 476 2 0 477 1 4 479 1 4 480 1 4 481 1 4 645 1 4 652 1 4 774 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUUGCCAUGGGAAAGUUCAAGGAAGCCC 3' Transcript: Sobic.009G075800.1:268-295 Slice Site:281 |o||||| o||||| o||||||| 3' GGACGGU--UCUUUC-----UCUUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.009G075800.1:281 MFE of perfect match: -41.40 MFE of this site: -28.60 MFEratio: 0.690821256038647 Allen et al. score: 14 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,295-288 9-14,282-277 15-21,274-268 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,287-283 BULt: Bulge on transcript side x-x,276-275 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.889194375220527 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR399a-Probable-5p-star_Sobic.009G075800.1_281_TPlot.pdf Position Reads Category 93 3 0 231 1 4 281 1 4 <<<<<<<<<< 886 1 4 991 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCUGUGAAGAAAGAGGCUGAGUCU 3' Transcript: Sobic.009G076400.1:469-492 Slice Site:480 ||||o ||||||||| o||o|o 3' GGACGGUUCUUUCUC---UUCGGG 5' Query: miR399a-Probable-5p-star SiteID: Sobic.009G076400.1:480 MFE of perfect match: -41.40 MFE of this site: -27.30 MFEratio: 0.659420289855073 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,492-487 7-15,483-475 17-21,473-469 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,486-484 BULt: Bulge on transcript side 16-16,474-474 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.992607558998518 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR399a-Probable-5p-star_Sobic.009G076400.1_480_TPlot.pdf Position Reads Category 1 2 0 7 1 4 236 1 4 275 1 4 290 1 4 388 1 4 408 1 4 412 1 4 420 1 4 480 1 4 <<<<<<<<<< 481 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGCUGUAUGGCGAGUUCCUG 3' Transcript: Sobic.009G132900.1:1025-1044 Slice Site:1035 |||||o||oo| ||o||| 3' UCGACGUAUUGGUCGAGGUG 5' Query: miR166j-Probable-5p-star SiteID: Sobic.009G132900.1:1035 MFE of perfect match: -39.10 MFE of this site: -27.90 MFEratio: 0.713554987212276 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-8,1042-1037 10-20,1035-1025 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,1044-1043 UP5: Unpaired region at 5' of query 9-9,1036-1036 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.725567003721479 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166j-Probable-5p-star_Sobic.009G132900.1_1035_TPlot.pdf Position Reads Category 6 1 4 212 1 4 226 1 4 230 1 4 231 1 4 233 1 4 234 1 4 236 3 2 239 1 4 243 1 4 249 2 2 268 1 4 272 1 4 274 1 4 275 1 4 276 1 4 278 1 4 298 1 4 336 1 4 354 1 4 417 1 4 422 1 4 426 1 4 433 1 4 651 2 2 652 1 4 654 1 4 655 1 4 661 1 4 662 1 4 663 1 4 667 1 4 669 3 2 670 1 4 672 1 4 676 1 4 677 3 2 678 6 2 679 2 2 680 3 2 681 3 2 682 1 4 683 2 2 684 1 4 685 1 4 688 1 4 789 1 4 800 1 4 804 1 4 865 1 4 907 1 4 949 1 4 953 1 4 974 2 2 980 1 4 982 1 4 987 1 4 990 1 4 999 1 4 1000 2 2 1011 1 4 1016 1 4 1027 2 2 1031 1 4 1032 1 4 1034 1 4 1035 1 4 <<<<<<<<<< 1038 1 4 1040 1 4 1042 1 4 1052 1 4 1058 1 4 1065 1 4 1070 1 4 1079 1 4 1120 1 4 1138 1 4 1142 2 2 1143 1 4 1144 1 4 1149 1 4 1153 1 4 1155 1 4 1156 1 4 1162 1 4 1164 2 2 1167 1 4 1168 1 4 1169 2 2 1171 1 4 1174 3 2 1175 1 4 1177 1 4 1178 2 2 1180 1 4 1184 1 4 1185 1 4 1190 1 4 1193 1 4 1194 2 2 1195 2 2 1196 3 2 1197 3 2 1198 1 4 1199 2 2 1202 3 2 1203 2 2 1204 2 2 1205 3 2 1206 3 2 1213 1 4 1222 1 4 1225 2 2 1232 1 4 1239 1 4 1240 1 4 1242 1 4 1243 1 4 1244 2 2 1247 1 4 1250 2 2 1251 2 2 1268 1 4 1276 1 4 1315 1 4 1361 1 4 1363 2 2 1367 1 4 1368 1 4 1369 1 4 1375 1 4 1380 1 4 1384 1 4 1387 1 4 1399 1 4 1423 1 4 1442 1 4 1443 1 4 1447 1 4 1452 1 4 1453 2 2 1465 1 4 1486 1 4 1493 1 4 1498 1 4 1499 1 4 1515 1 4 1529 2 2 1530 1 4 1531 3 2 1533 3 2 1534 2 2 1535 1 4 1536 2 2 1537 1 4 1539 2 2 1541 2 2 1542 1 4 1543 1 4 1544 3 2 1550 1 4 1579 1 4 1581 1 4 1584 1 4 1588 1 4 1590 1 4 1593 1 4 1596 1 4 1597 1 4 1617 1 4 1628 1 4 1645 1 4 1647 1 4 1654 1 4 1655 2 2 1656 1 4 1662 1 4 1663 1 4 1669 2 2 1677 4 2 1680 1 4 1768 1 4 1775 1 4 1777 2 2 1788 1 4 1790 1 4 1798 1 4 1799 1 4 1807 1 4 1824 1 4 1853 1 4 1854 1 4 1855 1 4 1859 2 2 1860 1 4 1861 1 4 1863 1 4 1864 1 4 1865 3 2 1866 2 2 1868 1 4 1873 2 2 1874 1 4 1875 2 2 1881 1 4 1891 1 4 1895 3 2 1902 2 2 1903 1 4 1921 1 4 1922 1 4 1939 1 4 1954 1 4 1975 1 4 1991 1 4 2010 1 4 2016 1 4 2017 1 4 2032 1 4 2036 1 4 2037 1 4 2038 1 4 2084 1 4 2099 1 4 2100 1 4 2107 2 2 2108 1 4 2109 1 4 2110 3 2 2111 8 0 2112 6 2 2114 3 2 2115 1 4 2116 1 4 2118 1 4 2119 2 2 2120 2 2 2121 1 4 2122 3 2 2123 1 4 2126 1 4 2128 1 4 2129 1 4 2130 2 2 2131 3 2 2133 3 2 2137 1 4 2138 3 2 2140 1 4 2141 1 4 2142 1 4 2143 2 2 2144 3 2 2145 4 2 2146 1 4 2147 1 4 2149 1 4 2151 1 4 2162 1 4 2175 1 4 2179 1 4 2208 1 4 2245 1 4 2255 1 4 2261 2 2 2265 2 2 2277 1 4 2289 2 2 2327 2 2 2328 1 4 2331 1 4 2333 1 4 2334 1 4 2336 2 2 2339 1 4 2346 1 4 2350 1 4 2352 2 2 2361 1 4 2373 1 4 2378 1 4 2385 1 4 2389 2 2 2392 1 4 2395 1 4 2399 1 4 2412 1 4 2415 1 4 2421 1 4 2428 1 4 2434 1 4 2436 2 2 2443 1 4 2444 2 2 2447 3 2 2449 4 2 2458 1 4 2460 1 4 2462 1 4 2468 1 4 2476 1 4 2505 1 4 2506 1 4 2511 1 4 2517 1 4 2519 1 4 2520 1 4 2521 2 2 2522 2 2 2523 4 2 2524 4 2 2525 6 2 2526 1 4 2527 2 2 2529 2 2 2530 1 4 2531 1 4 2532 1 4 2533 2 2 2536 1 4 2537 1 4 2542 4 2 2543 1 4 2545 6 2 2546 2 2 2547 1 4 2548 6 2 2549 1 4 2550 1 4 2554 1 4 2569 1 4 2614 1 4 2631 1 4 2668 2 2 2671 1 4 2672 1 4 2679 1 4 2680 1 4 2707 1 4 2709 1 4 2711 2 2 2712 2 2 2721 1 4 2742 1 4 2765 1 4 2771 1 4 2784 1 4 2785 1 4 2786 1 4 2788 1 4 2789 3 2 2790 3 2 2810 1 4 2811 1 4 2814 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUGUUCAGGAGAACAGGCUGUGGAU 3' Transcript: Sobic.009G132900.3:1001-1025 Slice Site:1016 |||||o|| |o|||||||| 3' UUCAAGUUCU----UUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.009G132900.3:1016 MFE of perfect match: -33.40 MFE of this site: -25.80 MFEratio: 0.772455089820359 Allen et al. score: 12.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-11,1024-1015 12-19,1010-1003 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1025-1025 UP5: Unpaired region at 5' of query x-x,1014-1011 BULt: Bulge on transcript side 20-21,1002-1001 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.112173011748802 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.009G132900.3_1016_TPlot.pdf Position Reads Category 32 1 4 36 1 4 39 2 2 40 1 4 41 1 4 43 2 2 48 1 4 52 1 4 60 1 4 62 1 4 64 1 4 77 1 4 80 1 4 90 1 4 127 1 4 156 1 4 232 1 4 453 3 2 454 1 4 469 3 2 470 4 2 471 5 2 472 1 4 473 3 2 474 1 4 475 2 2 479 2 2 480 1 4 481 3 2 483 2 2 487 1 4 488 1 4 489 2 2 492 1 4 524 1 4 596 1 4 609 1 4 612 1 4 681 1 4 682 1 4 779 2 2 780 1 4 786 1 4 797 1 4 799 2 2 800 1 4 801 1 4 814 1 4 827 1 4 828 1 4 829 1 4 833 1 4 834 1 4 835 1 4 838 1 4 847 1 4 852 2 2 855 1 4 872 1 4 932 1 4 936 1 4 944 1 4 949 1 4 952 1 4 954 1 4 955 2 2 957 1 4 959 1 4 960 1 4 961 1 4 962 1 4 971 2 2 972 2 2 973 1 4 974 1 4 975 1 4 976 2 2 977 2 2 980 1 4 984 3 2 989 1 4 991 2 2 993 1 4 994 2 2 998 2 2 1000 3 2 1003 3 2 1004 1 4 1005 2 2 1006 4 2 1008 3 2 1010 1 4 1012 1 4 1016 1 4 <<<<<<<<<< 1024 1 4 1026 1 4 1034 1 4 1041 1 4 1043 1 4 1044 1 4 1046 2 2 1047 3 2 1048 2 2 1049 2 2 1051 1 4 1069 1 4 1071 2 2 1073 1 4 1080 1 4 1082 1 4 1088 1 4 1089 1 4 1093 1 4 1115 1 4 1153 1 4 1157 1 4 1160 1 4 1163 1 4 1166 1 4 1170 1 4 1176 1 4 1178 1 4 1179 2 2 1187 1 4 1216 1 4 1225 1 4 1248 1 4 1250 1 4 1257 1 4 1258 1 4 1277 1 4 1324 1 4 1326 1 4 1330 1 4 1332 2 2 1333 1 4 1334 4 2 1335 2 2 1336 1 4 1337 3 2 1341 2 2 1342 2 2 1343 1 4 1344 2 2 1346 1 4 1347 1 4 1348 1 4 1349 1 4 1353 1 4 1361 1 4 1373 1 4 1381 1 4 1383 2 2 1384 2 2 1385 1 4 1391 1 4 1393 1 4 1394 1 4 1398 1 4 1403 1 4 1404 1 4 1408 1 4 1410 1 4 1435 1 4 1436 1 4 1450 1 4 1456 2 2 1458 1 4 1459 1 4 1462 1 4 1467 1 4 1468 1 4 1478 1 4 1479 1 4 1480 2 2 1482 1 4 1491 1 4 1504 2 2 1513 1 4 1582 1 4 1583 1 4 1602 1 4 1609 1 4 1623 1 4 1649 1 4 1650 2 2 1651 1 4 1652 1 4 1653 1 4 1654 1 4 1655 1 4 1657 2 2 1658 1 4 1660 1 4 1661 1 4 1663 2 2 1665 1 4 1669 1 4 1671 1 4 1673 1 4 1674 2 2 1676 1 4 1681 1 4 1684 1 4 1703 1 4 1704 2 2 1705 2 2 1706 1 4 1709 1 4 1720 2 2 1726 1 4 1737 1 4 1739 1 4 1757 1 4 1779 1 4 1782 1 4 1811 2 2 1813 1 4 1822 1 4 1831 1 4 1832 1 4 1836 1 4 1838 2 2 1868 1 4 1876 1 4 1878 1 4 1882 1 4 1896 1 4 1900 1 4 1903 1 4 1905 3 2 1908 1 4 1909 3 2 1911 1 4 1912 2 2 1913 4 2 1914 6 0 1916 2 2 1917 1 4 1918 3 2 1919 3 2 1922 2 2 1923 4 2 1924 2 2 1926 1 4 1927 1 4 1930 1 4 1932 3 2 1933 1 4 1934 2 2 1935 4 2 1936 2 2 1940 1 4 1945 2 2 1946 1 4 1947 1 4 1948 1 4 1950 1 4 1951 1 4 1979 1 4 1981 1 4 2050 1 4 2062 1 4 2067 2 2 2070 1 4 2072 1 4 2080 1 4 2081 1 4 2095 1 4 2105 1 4 2111 1 4 2112 1 4 2127 1 4 2131 1 4 2132 1 4 2139 1 4 2141 1 4 2142 1 4 2148 1 4 2149 1 4 2154 1 4 2166 1 4 2172 2 2 2174 1 4 2176 1 4 2180 1 4 2183 1 4 2188 1 4 2190 1 4 2191 2 2 2199 1 4 2220 1 4 2225 2 2 2237 1 4 2238 1 4 2241 1 4 2246 2 2 2249 1 4 2251 5 2 2252 1 4 2253 1 4 2259 1 4 2260 1 4 2267 1 4 2270 2 2 2273 1 4 2312 1 4 2317 1 4 2320 2 2 2321 2 2 2324 5 2 2325 3 2 2326 5 2 2327 5 2 2328 1 4 2329 1 4 2331 1 4 2332 1 4 2334 2 2 2336 1 4 2337 1 4 2338 3 2 2339 1 4 2341 1 4 2342 1 4 2343 1 4 2345 3 2 2346 1 4 2347 2 2 2348 1 4 2349 1 4 2350 2 2 2351 3 2 2352 1 4 2355 1 4 2408 1 4 2412 1 4 2414 1 4 2416 1 4 2424 1 4 2460 1 4 2481 1 4 2495 1 4 2496 1 4 2505 1 4 2506 2 2 2514 1 4 2525 1 4 2553 1 4 2554 1 4 2555 2 2 2559 1 4 2560 1 4 2588 1 4 2589 2 2 2590 1 4 2591 1 4 2592 1 4 2593 1 4 2594 1 4 2610 1 4 2614 2 2 2619 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCUGGAUACAUGCCAGACGGUCA 3' Transcript: Sobic.009G183700.1:1164-1186 Slice Site:1177 ||o| || |||||||||o|| 3' CUACUU-UG-ACGGUCUGCUAGA 5' Query: miR167c-Known-3p-star SiteID: Sobic.009G183700.1:1177 MFE of perfect match: -37.50 MFE of this site: -25.50 MFEratio: 0.68 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-13,1185-1174 14-15,1172-1171 16-19,1169-1166 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1186-1186 UP5: Unpaired region at 5' of query x-x,1173-1173 BULt: Bulge on transcript side x-x,1170-1170 BULt: Bulge on transcript side 20-21,1165-1164 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.516807222457134 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167c-Known-3p-star_Sobic.009G183700.1_1177_TPlot.pdf Position Reads Category 310 2 2 311 2 2 312 1 4 313 3 2 337 1 4 339 2 2 342 2 2 347 1 4 348 1 4 352 1 4 354 2 2 355 2 2 358 1 4 366 1 4 368 1 4 372 1 4 373 1 4 377 1 4 378 1 4 379 1 4 383 1 4 389 1 4 455 1 4 461 2 2 468 1 4 483 1 4 503 1 4 520 1 4 565 1 4 584 1 4 585 1 4 587 1 4 588 1 4 591 1 4 597 1 4 600 1 4 657 2 2 660 2 2 661 1 4 662 1 4 663 1 4 778 1 4 779 1 4 835 1 4 858 1 4 859 3 2 863 2 2 875 1 4 876 1 4 878 1 4 879 1 4 880 1 4 881 1 4 886 1 4 891 1 4 903 2 2 911 1 4 913 1 4 914 1 4 915 1 4 917 1 4 918 4 2 921 1 4 923 1 4 932 1 4 1035 1 4 1038 1 4 1086 1 4 1106 1 4 1108 1 4 1156 1 4 1177 1 4 <<<<<<<<<< 1183 1 4 1189 1 4 1191 1 4 1198 1 4 1212 1 4 1215 2 2 1216 1 4 1217 3 2 1218 1 4 1222 2 2 1224 1 4 1225 1 4 1236 1 4 1239 1 4 1246 1 4 1248 1 4 1253 3 2 1254 5 0 1255 2 2 1257 2 2 1259 1 4 1261 1 4 1263 1 4 1266 1 4 1286 1 4 1289 1 4 1290 2 2 1291 1 4 1293 2 2 1294 2 2 1295 1 4 1308 1 4 1312 1 4 1318 1 4 1321 1 4 1322 1 4 1323 1 4 1333 1 4 1341 1 4 1344 1 4 1346 2 2 1347 1 4 1348 1 4 1350 2 2 1355 1 4 1357 1 4 1359 1 4 1360 1 4 1362 1 4 1364 1 4 1381 1 4 1387 1 4 1389 2 2 1403 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGGUGGCCGGGAGGGAGCUCA 3' Transcript: Sobic.009G202600.1:554-574 Slice Site:565 o|||| | |o||o|||||| 3' CUCACCUGACUUCUCUCGAGA 5' Query: miR319-Probable-5p-star SiteID: Sobic.009G202600.1:565 MFE of perfect match: -40.70 MFE of this site: -27.10 MFEratio: 0.665847665847666 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-12,573-563 14-14,561-561 16-20,559-555 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,574-574 UP5: Unpaired region at 5' of query 13-13,562-562 SIL: Symmetric internal loop 15-15,560-560 SIL: Symmetric internal loop 21-21,554-554 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.480819447910478 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR319-Probable-5p-star_Sobic.009G202600.1_565_TPlot.pdf Position Reads Category 565 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GCCAGCUGUUCGACGAAAUGCC 3' Transcript: Sobic.009G210800.1:347-368 Slice Site:359 | |||||||||||||| ||| 3' AGUUCGACAAGCUGCUUAACGA 5' Query: miR5564d-Probable-5p-mature SiteID: Sobic.009G210800.1:359 MFE of perfect match: -37.80 MFE of this site: -28.50 MFEratio: 0.753968253968254 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-4,367-365 6-19,363-350 21-21,348-348 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,368-368 UP5: Unpaired region at 5' of query 5-5,364-364 SIL: Symmetric internal loop 20-20,349-349 SIL: Symmetric internal loop 22-22,347-347 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.184768899760208 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR5564d-Probable-5p-mature_Sobic.009G210800.1_359_TPlot.pdf Position Reads Category 359 1 4 <<<<<<<<<< 725 1 4 735 1 4 916 1 4 1559 1 4 1773 1 4 --------------------------------------------------- --------------------------------------------------- 5' GA-GAGACUGCGCAGCCUGGUGA 3' Transcript: Sobic.009G242100.1:553-574 Slice Site:565 || ||o|||||o|||| ||o| 3' CUACUUUGACGUGUCGUACUAGA 5' Query: miR167e-Probable-3p-star SiteID: Sobic.009G242100.1:565 MFE of perfect match: -40.20 MFE of this site: -27.70 MFEratio: 0.689054726368159 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-6,572-569 8-20,567-555 22-23,554-553 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,574-573 UP5: Unpaired region at 5' of query 7-7,568-568 SIL: Symmetric internal loop 21-21,x-x BULq: Bulge on query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.323354849055881 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167e-Probable-3p-star_Sobic.009G242100.1_565_TPlot.pdf Position Reads Category 82 1 4 108 1 4 122 1 4 132 1 4 137 1 4 297 1 4 370 1 4 460 1 4 565 1 4 <<<<<<<<<< 644 1 4 742 1 4 988 1 4 1286 1 4 1348 1 4 1660 1 4 1922 1 4 1934 1 4 1937 1 4 2109 1 4 2383 1 4 2657 1 4 2979 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCUUGCGCCACUGCCGACGUUCC 3' Transcript: Sobic.009G252000.1:69-91 Slice Site:82 ||o|||||| | ||||o|||| 3' AGAGCGCGGU--CUGCUGUAAGG 5' Query: miR166c-Probable-5p-star SiteID: Sobic.009G252000.1:82 MFE of perfect match: -42.80 MFE of this site: -30.40 MFEratio: 0.710280373831776 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,91-83 11-11,81-81 12-20,78-70 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-10,82-82 SIL: Symmetric internal loop x-x,80-79 BULt: Bulge on transcript side 21-21,69-69 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.330907303714857 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166c-Probable-5p-star_Sobic.009G252000.1_82_TPlot.pdf Position Reads Category 82 1 4 <<<<<<<<<< 146 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGUACAAGGAGGAGCUGUGGGA 3' Transcript: Sobic.010G005500.1:898-920 Slice Site:911 o||| ||||o o||||||||o| 3' UUCAAGUUCU--UUCGACACCUU 5' Query: miR396-Probable-5p-mature SiteID: Sobic.010G005500.1:911 MFE of perfect match: -33.40 MFE of this site: -25.00 MFEratio: 0.748502994011976 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-11,920-910 12-16,907-903 18-21,901-898 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,909-908 BULt: Bulge on transcript side 17-17,902-902 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.23615090540254 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-5p-mature_Sobic.010G005500.1_911_TPlot.pdf Position Reads Category 180 1 4 190 1 4 383 1 4 500 1 4 597 1 4 667 1 4 669 1 4 705 1 4 707 2 2 708 1 4 710 1 4 714 1 4 716 2 2 717 1 4 718 3 2 719 1 4 720 1 4 722 5 1 723 1 4 724 4 2 726 1 4 727 1 4 733 1 4 762 1 4 768 1 4 770 2 2 776 1 4 781 2 2 786 1 4 822 1 4 830 1 4 850 1 4 855 1 4 863 1 4 889 1 4 899 1 4 907 1 4 911 1 4 <<<<<<<<<< 914 1 4 923 1 4 928 1 4 929 3 2 930 2 2 931 4 2 933 1 4 935 1 4 938 2 2 939 1 4 940 4 2 942 3 2 943 3 2 944 1 4 950 1 4 951 1 4 952 4 2 953 1 4 954 1 4 957 1 4 958 2 2 960 2 2 962 1 4 966 1 4 973 1 4 974 1 4 975 1 4 976 1 4 977 2 2 978 2 2 980 1 4 981 1 4 982 1 4 983 1 4 984 2 2 986 1 4 987 2 2 988 2 2 989 1 4 990 1 4 991 1 4 992 1 4 993 2 2 994 1 4 995 1 4 996 2 2 997 2 2 998 1 4 1001 1 4 1002 1 4 1011 1 4 1015 1 4 1016 2 2 1018 1 4 1019 2 2 1020 3 2 1021 1 4 1022 2 2 1023 1 4 1026 1 4 1027 2 2 1029 1 4 1030 2 2 1032 1 4 1033 1 4 1034 1 4 1037 2 2 1038 2 2 1039 4 2 1040 1 4 1041 1 4 1042 5 1 1043 2 2 1044 5 1 1045 1 4 1046 1 4 1047 1 4 1048 3 2 1049 3 2 1050 1 4 1051 3 2 --------------------------------------------------- --------------------------------------------------- 5' GAUGGAGGAGGAGAGGGGGAA 3' Transcript: Sobic.010G065400.2:774-794 Slice Site:785 |||||||o||||||o o | 3' CUACCUCUUCCUCUUGUGCAC 5' Query: miR164a-Known-3p-star SiteID: Sobic.010G065400.2:785 MFE of perfect match: -39.00 MFE of this site: -29.20 MFEratio: 0.748717948717949 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-3,792-792 5-5,790-790 7-21,788-774 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,794-793 UP5: Unpaired region at 5' of query 4-4,791-791 SIL: Symmetric internal loop 6-6,789-789 SIL: Symmetric internal loop Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.47495914245318 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR164a-Known-3p-star_Sobic.010G065400.2_785_TPlot.pdf Position Reads Category 594 1 4 747 1 4 749 1 4 785 1 4 <<<<<<<<<< 800 1 4 812 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAGGAGAGGGGGAA-GGU 3' Transcript: Sobic.010G065400.3:778-797 Slice Site:789 ||o||o|||||o||| o|o 3' CUUCUUCUCUCUCCCAUGUCG 5' Query: miR529-Probable-3p-star SiteID: Sobic.010G065400.3:789 MFE of perfect match: -40.10 MFE of this site: -28.70 MFEratio: 0.71571072319202 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,797-795 7-21,792-778 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-6,794-793 AILq: Asymmetric internal loop with more nts on the query side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.69639530084693 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR529-Probable-3p-star_Sobic.010G065400.3_789_TPlot.pdf Position Reads Category 789 1 4 <<<<<<<<<< 800 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUUCUCAAUGGCUCGUCUUGACC 3' Transcript: Sobic.010G072300.2:1710-1732 Slice Site:1722 ||||o| |oo||| |||||||| 3' GAAGGG-UGUCGAA-AGAACUGG 5' Query: miR396-Probable-3p-star SiteID: Sobic.010G072300.2:1722 MFE of perfect match: -39.10 MFE of this site: -25.50 MFEratio: 0.652173913043478 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,1732-1725 10-15,1722-1717 16-21,1715-1710 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-9,1724-1723 AILt: Asymmetric internal loop with more nts on the transcript side x-x,1716-1716 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.32940358688703 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR396-Probable-3p-star_Sobic.010G072300.2_1722_TPlot.pdf Position Reads Category 495 1 4 945 1 4 1045 1 4 1076 1 4 1079 1 4 1315 1 4 1321 1 4 1323 1 4 1325 1 4 1645 1 4 1647 2 1 1652 1 4 1716 1 4 1722 1 4 <<<<<<<<<< 2216 1 4 2263 2 1 2271 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGACGGUGCUGGCGGCAACA 3' Transcript: Sobic.010G156400.1:261-280 Slice Site:271 || o|||||||o|| 3' UCUAGUACGACCGUCGAAGU 5' Query: miR167b-Known-5p-mature SiteID: Sobic.010G156400.1:271 MFE of perfect match: -37.60 MFE of this site: -24.70 MFEratio: 0.656914893617021 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 5-15,276-266 18-19,263-262 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-4,280-277 UP5: Unpaired region at 5' of query 16-17,265-264 SIL: Symmetric internal loop 20-20,261-261 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.825227135621353 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR167b-Known-5p-mature_Sobic.010G156400.1_271_TPlot.pdf Position Reads Category 271 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' AGACGCGCCGGACGAUCAUCAC 3' Transcript: Sobic.010G187300.1:776-797 Slice Site:787 ||||||o||||| ||| | 3' AGAGCGCGGUCUGCU-GUAAGG 5' Query: miR166c-Probable-5p-star SiteID: Sobic.010G187300.1:787 MFE of perfect match: -42.80 MFE of this site: -28.10 MFEratio: 0.656542056074766 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-1,797-797 4-6,794-792 7-18,790-779 Unpaired Regions (query5'-query3',transcript3'-transcript5') 2-3,796-795 SIL: Symmetric internal loop x-x,791-791 BULt: Bulge on transcript side 19-21,778-776 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.888695767136849 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR166c-Probable-5p-star_Sobic.010G187300.1_787_TPlot.pdf Position Reads Category 785 1 4 787 1 4 <<<<<<<<<< 794 1 4 796 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCUGCGGGUGGCGCAGGAAGGGAAGCGGAUGGGC 3' Transcript: Sobic.010G193600.1:138-171 Slice Site:158 |||| o|||o|||o|||| ||o|| 3' CGAC--------UGUCUUUCUCUUC----ACUCG 5' Query: miR156a-Known-3p-star SiteID: Sobic.010G193600.1:158 MFE of perfect match: -40.70 MFE of this site: -26.70 MFEratio: 0.656019656019656 Allen et al. score: 19 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,171-167 6-18,162-150 19-22,141-138 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,166-163 BULt: Bulge on transcript side x-x,149-142 BULt: Bulge on transcript side Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.874914087471091 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR156a-Known-3p-star_Sobic.010G193600.1_158_TPlot.pdf Position Reads Category 156 1 4 157 1 4 158 1 4 <<<<<<<<<< 346 1 4 711 1 4 718 1 4 732 1 4 733 1 4 739 1 4 754 1 4 824 1 4 829 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCGAUAACUUGGACUGCGCCAACC 3' Transcript: Sobic.010G273600.1:941-964 Slice Site:955 ||| |||o||o||||||| 3' AGCUU---AACUUGGCGCGGUUAU 5' Query: miR171i-Probable-5p-star SiteID: Sobic.010G273600.1:955 MFE of perfect match: -36.20 MFE of this site: -23.94 MFEratio: 0.661325966850829 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-16,962-949 18-20,944-942 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,964-963 UP5: Unpaired region at 5' of query 17-17,948-945 AILt: Asymmetric internal loop with more nts on the transcript side 21-21,941-941 UP3: Unpaired region at 3' of query Degradome data file: degradome.cleaveLand.result/Control.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.734057828702122 T-Plot file: degradome.cleaveLand.result/Control_dgd_plot/miR171i-Probable-5p-star_Sobic.010G273600.1_955_TPlot.pdf Position Reads Category 7 1 4 277 1 4 285 1 4 578 1 4 581 1 4 582 2 2 583 1 4 599 1 4 600 1 4 604 1 4 934 1 4 936 1 4 938 1 4 944 1 4 945 3 1 946 3 1 949 1 4 955 1 4 <<<<<<<<<< 958 1 4 961 1 4 963 1 4 ---------------------------------------------------