# CleaveLand4 4.5 # Tue Feb 27 23:18:12 CST 2024 # Degradome Density File: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt # Query Alignment file: miRNA.fa_GSTAr.txt # Transcriptome: /public/home/zhenglw/work/sRNA_database/Sbicolor_313_v3.1.cds.fa # P-value cutoff: 1 # Category cutoff: 4 # Output Format: Pretty --------------------------------------------------- 5' GCCAACAUGGCAAGGCAG 3' Transcript: Sobic.001G026200.3:1891-1908 Slice Site:1899 |||oo||||||| 3' CUUUAGUAUUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.001G026200.3:1899 MFE of perfect match: -27.30 MFE of this site: -18.40 MFEratio: 0.673992673992674 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 2-13,1907-1896 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1908-1908 UP5: Unpaired region at 5' of query 14-18,1895-1891 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999809087799299 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.001G026200.3_1899_TPlot.pdf Position Reads Category 131 1 4 136 1 4 461 1 4 1899 1 4 <<<<<<<<<< 2002 1 4 2080 1 4 2114 3 0 2120 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCGCAGCAUCGGCAAGAACG 3' Transcript: Sobic.001G046900.1:537-556 Slice Site:547 ||||||||o ||||| 3' UACGUCGUAGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.001G046900.1:547 MFE of perfect match: -32.70 MFE of this site: -21.70 MFEratio: 0.663608562691131 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 4-8,553-549 10-18,547-539 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,556-554 UP5: Unpaired region at 5' of query 9-9,548-548 SIL: Symmetric internal loop 19-20,538-537 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.977311415118465 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR172b-Probable-3p-mature_Sobic.001G046900.1_547_TPlot.pdf Position Reads Category 216 1 4 219 1 4 232 1 4 233 1 4 275 1 4 277 1 4 294 1 4 355 1 4 394 1 4 431 1 4 537 1 4 539 1 4 541 1 4 544 2 0 545 1 4 547 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGUGGAUAUAACCGAGGGAGAGG 3' Transcript: Sobic.001G099800.1:712-734 Slice Site:724 ||||o o| |||||| |||||| 3' CCACUAGUUUUGGCU-CCUCUCA 5' Query: miR156h-Probable-3p-star SiteID: Sobic.001G099800.1:724 MFE of perfect match: -40.60 MFE of this site: -26.80 MFEratio: 0.660098522167488 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,733-728 8-13,726-721 15-16,719-718 18-22,716-712 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,734-734 UP5: Unpaired region at 5' of query x-x,727-727 BULt: Bulge on transcript side 14-14,720-720 SIL: Symmetric internal loop 17-17,717-717 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.837564656922349 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156h-Probable-3p-star_Sobic.001G099800.1_724_TPlot.pdf Position Reads Category 84 1 4 497 1 4 500 1 4 613 1 4 619 3 2 621 1 4 622 8 0 623 4 2 624 1 4 625 1 4 627 1 4 629 1 4 644 1 4 648 1 4 682 1 4 703 1 4 721 1 4 724 1 4 <<<<<<<<<< 726 1 4 728 1 4 747 1 4 869 1 4 877 1 4 892 1 4 939 1 4 945 1 4 981 1 4 985 1 4 987 2 2 989 1 4 994 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGCGGUCAUCGUCAAGAACA 3' Transcript: Sobic.001G125900.1:329-349 Slice Site:340 ||o| ||||o|||||| 3' UACGUC-GUAGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.001G125900.1:340 MFE of perfect match: -32.70 MFE of this site: -22.40 MFEratio: 0.685015290519878 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 4-14,346-336 15-18,334-331 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,349-347 UP5: Unpaired region at 5' of query x-x,335-335 BULt: Bulge on transcript side 19-20,330-329 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.884606474178939 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR172b-Probable-3p-mature_Sobic.001G125900.1_340_TPlot.pdf Position Reads Category 76 1 4 86 1 4 199 1 4 296 1 4 325 1 4 337 1 4 338 1 4 340 1 4 <<<<<<<<<< 341 1 4 342 1 4 344 1 4 351 1 4 352 2 1 354 1 4 355 2 1 451 1 4 458 1 4 462 1 4 472 1 4 892 1 4 955 1 4 1059 1 4 1063 1 4 1182 1 4 1185 1 4 1193 1 4 1424 1 4 1863 1 4 2184 1 4 2260 1 4 2269 1 4 2271 1 4 2280 1 4 2281 1 4 2294 2 1 2297 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGAGACGCUCCACAUGGGGGGC 3' Transcript: Sobic.001G149500.1:26-48 Slice Site:38 || o|||||| |||||oo| 3' ACCGC--UGAGGUG-ACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.001G149500.1:38 MFE of perfect match: -42.90 MFE of this site: -28.48 MFEratio: 0.663869463869464 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,48-41 9-15,39-33 18-19,28-27 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,40-40 BULt: Bulge on transcript side 16-17,32-29 AILt: Asymmetric internal loop with more nts on the transcript side 20-20,26-26 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 3 Degradome p-value: 0.0323993402128686 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-5p-mature_Sobic.001G149500.1_38_TPlot.pdf Position Reads Category 5 1 4 11 1 4 24 1 4 25 1 4 26 1 4 30 1 4 31 1 4 32 1 4 33 1 4 35 4 3 36 1 4 37 5 3 38 9 3 <<<<<<<<<< 39 8 3 40 13 2 41 5 3 42 6 3 43 3 3 44 9 3 45 12 2 46 4 3 47 7 3 48 7 3 49 9 3 50 9 3 51 8 3 52 31 2 53 66 2 54 35 2 55 69 2 56 36 2 57 47 2 58 88 0 59 25 2 60 9 3 61 6 3 62 4 3 63 4 3 64 12 2 65 7 3 66 6 3 67 7 3 68 2 3 69 1 4 70 3 3 71 12 2 72 8 3 73 17 2 74 14 2 75 12 2 76 15 2 77 15 2 78 9 3 79 16 2 80 6 3 81 3 3 82 4 3 83 5 3 84 4 3 85 4 3 86 18 2 87 4 3 88 19 2 89 13 2 90 22 2 91 27 2 92 17 2 93 11 3 94 7 3 95 5 3 96 10 3 97 20 2 98 16 2 99 13 2 100 21 2 101 18 2 102 18 2 103 11 3 104 30 2 105 7 3 106 19 2 107 46 2 108 28 2 109 45 2 110 23 2 111 22 2 112 25 2 113 6 3 114 4 3 118 2 3 125 2 3 127 2 3 128 2 3 129 1 4 130 2 3 136 2 3 157 3 3 158 1 4 159 2 3 160 4 3 161 1 4 162 1 4 163 2 3 164 5 3 165 2 3 166 2 3 167 2 3 168 1 4 169 7 3 170 1 4 171 3 3 173 9 3 174 6 3 175 5 3 176 4 3 178 2 3 179 3 3 180 2 3 181 6 3 182 9 3 183 8 3 184 3 3 185 3 3 186 5 3 187 8 3 188 7 3 190 16 2 191 5 3 192 15 2 193 6 3 194 25 2 195 14 2 196 52 2 197 18 2 198 15 2 199 9 3 200 7 3 201 6 3 202 23 2 203 19 2 204 14 2 205 14 2 206 10 3 207 5 3 208 22 2 209 31 2 210 19 2 211 35 2 212 27 2 213 23 2 214 41 2 215 27 2 216 19 2 217 18 2 218 19 2 219 23 2 220 17 2 221 8 3 222 6 3 223 3 3 224 1 4 226 3 3 227 1 4 229 3 3 230 3 3 232 1 4 234 1 4 235 1 4 245 1 4 247 1 4 251 1 4 255 1 4 256 1 4 268 1 4 269 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAGCACAAGAAGGCCGAG 3' Transcript: Sobic.001G149500.1:79-99 Slice Site:89 o||o|o||||| oo||o|o 3' UUCUUUGUGUUGG-UUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.001G149500.1:89 MFE of perfect match: -29.60 MFE of this site: -20.20 MFEratio: 0.682432432432432 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,99-93 10-20,89-79 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-9,92-90 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.477930352329816 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.001G149500.1_89_TPlot.pdf Position Reads Category 5 1 4 11 1 4 24 1 4 25 1 4 26 1 4 30 1 4 31 1 4 32 1 4 33 1 4 35 4 3 36 1 4 37 5 3 38 9 3 39 8 3 40 13 2 41 5 3 42 6 3 43 3 3 44 9 3 45 12 2 46 4 3 47 7 3 48 7 3 49 9 3 50 9 3 51 8 3 52 31 2 53 66 2 54 35 2 55 69 2 56 36 2 57 47 2 58 88 0 59 25 2 60 9 3 61 6 3 62 4 3 63 4 3 64 12 2 65 7 3 66 6 3 67 7 3 68 2 3 69 1 4 70 3 3 71 12 2 72 8 3 73 17 2 74 14 2 75 12 2 76 15 2 77 15 2 78 9 3 79 16 2 80 6 3 81 3 3 82 4 3 83 5 3 84 4 3 85 4 3 86 18 2 87 4 3 88 19 2 89 13 2 <<<<<<<<<< 90 22 2 91 27 2 92 17 2 93 11 3 94 7 3 95 5 3 96 10 3 97 20 2 98 16 2 99 13 2 100 21 2 101 18 2 102 18 2 103 11 3 104 30 2 105 7 3 106 19 2 107 46 2 108 28 2 109 45 2 110 23 2 111 22 2 112 25 2 113 6 3 114 4 3 118 2 3 125 2 3 127 2 3 128 2 3 129 1 4 130 2 3 136 2 3 157 3 3 158 1 4 159 2 3 160 4 3 161 1 4 162 1 4 163 2 3 164 5 3 165 2 3 166 2 3 167 2 3 168 1 4 169 7 3 170 1 4 171 3 3 173 9 3 174 6 3 175 5 3 176 4 3 178 2 3 179 3 3 180 2 3 181 6 3 182 9 3 183 8 3 184 3 3 185 3 3 186 5 3 187 8 3 188 7 3 190 16 2 191 5 3 192 15 2 193 6 3 194 25 2 195 14 2 196 52 2 197 18 2 198 15 2 199 9 3 200 7 3 201 6 3 202 23 2 203 19 2 204 14 2 205 14 2 206 10 3 207 5 3 208 22 2 209 31 2 210 19 2 211 35 2 212 27 2 213 23 2 214 41 2 215 27 2 216 19 2 217 18 2 218 19 2 219 23 2 220 17 2 221 8 3 222 6 3 223 3 3 224 1 4 226 3 3 227 1 4 229 3 3 230 3 3 232 1 4 234 1 4 235 1 4 245 1 4 247 1 4 251 1 4 255 1 4 256 1 4 268 1 4 269 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGCGUGCGGGGCGCUCGCGGC 3' Transcript: Sobic.001G176700.1:305-326 Slice Site:315 ||||o|o|o||| || |o ||| 3' ACCGUAUGUCCCUCG-GU-CCG 5' Query: miR160-Probable-5p-mature SiteID: Sobic.001G176700.1:315 MFE of perfect match: -43.80 MFE of this site: -31.90 MFEratio: 0.728310502283105 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,326-324 4-5,322-321 6-7,319-318 9-20,316-305 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,323-323 BULt: Bulge on transcript side x-x,320-320 BULt: Bulge on transcript side 8-8,317-317 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.622214014426887 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR160-Probable-5p-mature_Sobic.001G176700.1_315_TPlot.pdf Position Reads Category 207 1 4 315 1 4 <<<<<<<<<< 933 1 4 967 1 4 968 3 0 1253 1 4 1407 1 4 1484 1 4 1489 1 4 1621 1 4 1698 1 4 1715 1 4 1763 1 4 1927 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGUGGCUCUAGUGGUGGGC 3' Transcript: Sobic.001G222900.1:606-625 Slice Site:616 |||o|o|||o| ||| |oo| 3' ACCGCUGAGGUGACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.001G222900.1:616 MFE of perfect match: -42.90 MFE of this site: -28.40 MFEratio: 0.662004662004662 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,625-622 6-8,620-618 10-20,616-606 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,621-621 SIL: Symmetric internal loop 9-9,617-617 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.992304635136573 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-5p-mature_Sobic.001G222900.1_616_TPlot.pdf Position Reads Category 300 1 4 314 1 4 359 1 4 361 1 4 363 1 4 547 1 4 556 1 4 616 1 4 <<<<<<<<<< 618 1 4 658 1 4 679 1 4 778 1 4 1045 1 4 1070 1 4 1100 1 4 1167 1 4 1204 1 4 1212 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCGCCCACCAAUGGUG-GC 3' Transcript: Sobic.001G227800.1:448-465 Slice Site:457 |||||||| ||||| || 3' UUCGGGUGGUCACCACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.001G227800.1:457 MFE of perfect match: -39.80 MFE of this site: -28.70 MFEratio: 0.721105527638191 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,465-464 4-8,463-459 10-17,457-450 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,x-x BULq: Bulge on query side 9-9,458-458 SIL: Symmetric internal loop 18-19,449-448 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.67010074077047 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-3p-star_Sobic.001G227800.1_457_TPlot.pdf Position Reads Category 197 1 4 198 4 2 199 1 4 200 2 2 201 11 0 202 1 4 213 1 4 267 1 4 317 2 2 320 1 4 363 1 4 382 1 4 398 1 4 445 1 4 457 1 4 <<<<<<<<<< 482 1 4 512 1 4 551 1 4 565 1 4 570 1 4 673 1 4 690 1 4 726 1 4 772 1 4 781 1 4 784 1 4 787 1 4 860 1 4 866 1 4 878 1 4 884 1 4 887 1 4 976 1 4 977 1 4 980 1 4 983 1 4 1005 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGAAUCAUCAGCU-GGCGC 3' Transcript: Sobic.001G243100.2:136-153 Slice Site:145 |o|||||| |o| |||o| 3' CUUUAGUA-UUGUUCCGUG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.001G243100.2:145 MFE of perfect match: -27.30 MFE of this site: -17.80 MFEratio: 0.652014652014652 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,153-149 8-10,147-145 11-18,143-136 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-7,148-148 AILq: Asymmetric internal loop with more nts on the query side x-x,144-144 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999998535379629 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175a-Probable-5p-star_Sobic.001G243100.2_145_TPlot.pdf Position Reads Category 10 1 4 17 1 4 19 1 4 20 1 4 36 1 4 127 1 4 139 1 4 145 1 4 <<<<<<<<<< 148 1 4 160 1 4 220 1 4 288 1 4 302 1 4 385 1 4 387 1 4 393 1 4 406 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGCGGUGCGGGGCGGCAAGGC 3' Transcript: Sobic.001G251300.1:1235-1256 Slice Site:1246 |||| o|o|o||| o|| |||| 3' ACCG-UAUGUCCC-UCGGUCCG 5' Query: miR160-Probable-5p-mature SiteID: Sobic.001G251300.1:1246 MFE of perfect match: -43.80 MFE of this site: -29.10 MFEratio: 0.664383561643836 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,1256-1253 6-8,1251-1249 9-16,1247-1240 17-20,1238-1235 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,1252-1252 SIL: Symmetric internal loop x-x,1248-1248 BULt: Bulge on transcript side x-x,1239-1239 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.99860340136886 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR160-Probable-5p-mature_Sobic.001G251300.1_1246_TPlot.pdf Position Reads Category 1246 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAAAUCACCACAGGGCCC 3' Transcript: Sobic.001G376400.1:339-356 Slice Site:347 ||||||| |||o||| | 3' CUUUAGUAUUGUUCCGUG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.001G376400.1:347 MFE of perfect match: -27.30 MFE of this site: -18.80 MFEratio: 0.688644688644689 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-1,356-356 3-9,354-348 12-18,345-339 Unpaired Regions (query5'-query3',transcript3'-transcript5') 2-2,355-355 SIL: Symmetric internal loop 10-11,347-346 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998134361070615 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175a-Probable-5p-star_Sobic.001G376400.1_347_TPlot.pdf Position Reads Category 347 1 4 <<<<<<<<<< 589 1 4 592 1 4 593 2 1 595 1 4 718 1 4 744 1 4 766 1 4 864 1 4 907 1 4 910 1 4 914 1 4 920 2 1 921 1 4 927 1 4 --------------------------------------------------- --------------------------------------------------- 5' ACGGGUAAAGUAAUUGGUGGAA 3' Transcript: Sobic.001G391400.1:547-568 Slice Site:559 ||||||||o|||| |o o|| 3' UACCCAUUUCGUUAAGCGGUUU 5' Query: miR5564b-Known-3p-star SiteID: Sobic.001G391400.1:559 MFE of perfect match: -36.00 MFE of this site: -24.90 MFEratio: 0.691666666666667 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,568-566 5-6,564-563 8-20,561-549 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,565-565 SIL: Symmetric internal loop 7-7,562-562 SIL: Symmetric internal loop 21-22,548-547 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.0359097006974316 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564b-Known-3p-star_Sobic.001G391400.1_559_TPlot.pdf Position Reads Category 199 1 4 296 1 4 419 1 4 439 1 4 441 1 4 462 1 4 486 2 2 489 2 2 494 1 4 502 1 4 534 1 4 535 1 4 556 4 2 557 2 2 558 1 4 559 4 2 <<<<<<<<<< 561 5 0 565 1 4 574 1 4 575 1 4 616 1 4 785 1 4 788 1 4 1082 1 4 1154 1 4 1155 2 2 1156 1 4 1166 1 4 1170 1 4 1173 3 2 1175 1 4 1177 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGUGGUUACGGCGGAGGAGCAGG 3' Transcript: Sobic.001G394100.1:535-557 Slice Site:547 ||||o|o| oo| |||||| || 3' CCACUAGUUUUGGCUCCUC-UCA 5' Query: miR156h-Probable-3p-star SiteID: Sobic.001G394100.1:547 MFE of perfect match: -40.60 MFE of this site: -26.60 MFEratio: 0.655172413793103 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-3,556-555 4-9,553-548 11-13,546-544 15-22,542-535 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,557-557 UP5: Unpaired region at 5' of query x-x,554-554 BULt: Bulge on transcript side 10-10,547-547 SIL: Symmetric internal loop 14-14,543-543 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.879149378703949 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156h-Probable-3p-star_Sobic.001G394100.1_547_TPlot.pdf Position Reads Category 99 1 4 106 1 4 111 1 4 115 1 4 176 1 4 194 1 4 267 1 4 296 1 4 297 1 4 410 1 4 443 1 4 448 1 4 452 1 4 456 1 4 457 2 1 466 1 4 471 1 4 472 1 4 473 1 4 477 1 4 490 2 1 547 1 4 <<<<<<<<<< 636 1 4 642 1 4 643 1 4 650 1 4 655 1 4 658 1 4 659 1 4 660 1 4 661 1 4 665 1 4 672 1 4 683 1 4 685 1 4 686 1 4 734 1 4 735 1 4 790 1 4 812 1 4 817 1 4 847 2 1 851 1 4 --------------------------------------------------- --------------------------------------------------- 5' UCUCGACACAACCAUCCAAU 3' Transcript: Sobic.001G418700.2:1007-1026 Slice Site:1017 o||||||||| |||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.001G418700.2:1017 MFE of perfect match: -29.60 MFE of this site: -20.20 MFEratio: 0.682432432432432 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,1025-1022 7-16,1020-1011 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,1026-1026 UP5: Unpaired region at 5' of query 6-6,1021-1021 SIL: Symmetric internal loop 17-20,1010-1007 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999991202851899 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.001G418700.2_1017_TPlot.pdf Position Reads Category 491 2 3 492 18 0 493 4 2 494 10 2 495 1 4 792 1 4 817 2 3 822 1 4 1017 1 4 <<<<<<<<<< 1084 1 4 1103 1 4 1151 1 4 1462 1 4 1491 1 4 1545 1 4 1546 1 4 1547 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGCCCGUGGUACGGGGACGCC-GGC 3' Transcript: Sobic.001G431800.1:1176-1200 Slice Site:1191 ||| o|||o|||| ||| ||| 3' ACCG-----UAUGUCCCU-CGGUCCG 5' Query: miR160-Probable-5p-mature SiteID: Sobic.001G431800.1:1191 MFE of perfect match: -43.80 MFE of this site: -28.60 MFEratio: 0.65296803652968 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,1200-1198 5-7,1197-1195 8-16,1193-1185 17-19,1179-1177 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,x-x BULq: Bulge on query side x-x,1194-1194 BULt: Bulge on transcript side x-x,1184-1180 BULt: Bulge on transcript side 20-20,1176-1176 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999884806061309 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR160-Probable-5p-mature_Sobic.001G431800.1_1191_TPlot.pdf Position Reads Category 521 1 4 591 1 4 595 1 4 596 1 4 601 1 4 1009 1 4 1080 1 4 1191 1 4 <<<<<<<<<< 1514 1 4 1550 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGCG-CUCGCGGAGGGGAAC 3' Transcript: Sobic.001G449600.1:2-21 Slice Site:12 ||||| ||| |o ||||||| 3' ACCGCUGAG-GUGACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.001G449600.1:12 MFE of perfect match: -42.90 MFE of this site: -28.00 MFEratio: 0.652680652680653 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,21-15 10-11,12-11 12-14,9-7 16-20,6-2 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-9,14-13 SIL: Symmetric internal loop x-x,10-10 BULt: Bulge on transcript side 15-15,x-x BULq: Bulge on query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 0 Degradome p-value: 0.135201575057247 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-5p-mature_Sobic.001G449600.1_12_TPlot.pdf Position Reads Category 12 2 0 <<<<<<<<<< 13 1 4 272 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGCAGCGUCG-CAAGAAAG 3' Transcript: Sobic.001G457400.4:995-1013 Slice Site:1005 o||||||o||o ||||| 3' UACGUCGUAGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.001G457400.4:1005 MFE of perfect match: -32.70 MFE of this site: -23.70 MFEratio: 0.724770642201835 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 4-8,1010-1006 10-20,1005-995 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,1013-1011 UP5: Unpaired region at 5' of query 9-9,x-x BULq: Bulge on query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.535612600683435 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR172b-Probable-3p-mature_Sobic.001G457400.4_1005_TPlot.pdf Position Reads Category 747 1 4 823 1 4 1005 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GGAAUCAUUUAGCAAAGCAC 3' Transcript: Sobic.001G501200.1:354-373 Slice Site:364 |o||||| ||o||| |||| 3' CUUUAGU--AUUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.001G501200.1:364 MFE of perfect match: -27.30 MFE of this site: -17.80 MFEratio: 0.652014652014652 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,373-370 6-11,368-363 12-18,360-354 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,369-369 SIL: Symmetric internal loop x-x,362-361 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999209031573 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.001G501200.1_364_TPlot.pdf Position Reads Category 84 1 4 200 1 4 250 1 4 345 2 0 346 1 4 357 1 4 364 1 4 <<<<<<<<<< 377 1 4 401 1 4 544 1 4 556 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUGCAUUGCAAUAUCAGGAUUC 3' Transcript: Sobic.002G001000.1:591-612 Slice Site:603 |||| ||| o||||o||||| 3' UACGU--CGUAGUAGUUCUAAG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.002G001000.1:603 MFE of perfect match: -32.70 MFE of this site: -21.60 MFEratio: 0.660550458715596 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-11,612-602 13-15,600-598 16-19,595-592 Unpaired Regions (query5'-query3',transcript3'-transcript5') 12-12,601-601 SIL: Symmetric internal loop x-x,597-596 BULt: Bulge on transcript side 20-20,591-591 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.981991804847007 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR172b-Probable-3p-mature_Sobic.002G001000.1_603_TPlot.pdf Position Reads Category 39 1 4 43 1 4 45 1 4 82 1 4 84 1 4 87 1 4 90 1 4 446 1 4 482 1 4 486 1 4 523 1 4 603 1 4 <<<<<<<<<< 921 1 4 1340 1 4 --------------------------------------------------- --------------------------------------------------- 5' CCGCCCGCCGCCGGCGGCGGUGGUG-GC 3' Transcript: Sobic.002G084800.1:349-375 Slice Site:367 ||||o|| o|||||| || 3' UUCGGGUGG---------UCACCACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.002G084800.1:367 MFE of perfect match: -39.80 MFE of this site: -26.70 MFEratio: 0.670854271356784 Allen et al. score: 23.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,375-374 4-10,373-367 11-17,357-351 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,x-x BULq: Bulge on query side x-x,366-358 BULt: Bulge on transcript side 18-19,350-349 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.988372177762574 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-3p-star_Sobic.002G084800.1_367_TPlot.pdf Position Reads Category 367 1 4 <<<<<<<<<< 687 1 4 689 2 1 694 1 4 696 2 1 710 1 4 712 1 4 715 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGCUCUCUCUCUUCUGUCA 3' Transcript: Sobic.002G257900.2:989-1008 Slice Site:999 |||||||||||||||||||| 3' CACGAGAGAGAGAAGACAGU 5' Query: miR156h-Probable-5p-mature SiteID: Sobic.002G257900.2:999 MFE of perfect match: -37.40 MFE of this site: -38.80 MFEratio: 1 Allen et al. score: 0 Paired Regions (query5'-query3',transcript3'-transcript5') 1-20,1008-989 Unpaired Regions (query5'-query3',transcript3'-transcript5') NA Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00614199340168997 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156h-Probable-5p-mature_Sobic.002G257900.2_999_TPlot.pdf Position Reads Category 999 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GAGCAACACAAUCAAGCAAA 3' Transcript: Sobic.002G413400.2:306-325 Slice Site:316 o|| |||||||o||| |||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.002G413400.2:316 MFE of perfect match: -29.60 MFE of this site: -20.00 MFEratio: 0.675675675675676 Allen et al. score: 4.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,325-322 6-16,320-310 18-20,308-306 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,321-321 SIL: Symmetric internal loop 17-17,309-309 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.99999906010875 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.002G413400.2_316_TPlot.pdf Position Reads Category 124 2 2 216 1 4 227 1 4 260 1 4 267 1 4 279 1 4 287 1 4 298 1 4 311 1 4 313 1 4 314 3 2 315 1 4 316 1 4 <<<<<<<<<< 318 5 0 319 4 2 322 1 4 323 1 4 325 1 4 326 2 2 359 1 4 391 1 4 394 2 2 395 1 4 398 1 4 399 1 4 400 3 2 402 1 4 406 3 2 410 1 4 509 1 4 618 1 4 621 1 4 650 1 4 680 1 4 702 1 4 752 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGAGAGCUCGACAGAGGGAGCAGCGGGA 3' Transcript: Sobic.003G037900.1:68-95 Slice Site:86 |||| ||| ||||||oo||| ||||o| 3' UCUC-CGA-CUGUCUUUCUCUUCGCUCG 5' Query: miR156i-Known-3p-star SiteID: Sobic.003G037900.1:86 MFE of perfect match: -51.60 MFE of this site: -36.50 MFEratio: 0.707364341085271 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,94-89 9-19,87-77 20-22,75-73 23-26,71-68 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,95-95 UP5: Unpaired region at 5' of query 8-8,88-88 SIL: Symmetric internal loop x-x,76-76 BULt: Bulge on transcript side x-x,72-72 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.285213119802855 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156i-Known-3p-star_Sobic.003G037900.1_86_TPlot.pdf Position Reads Category 23 1 4 44 2 1 46 1 4 54 1 4 56 1 4 58 1 4 64 1 4 65 1 4 77 1 4 86 1 4 <<<<<<<<<< 88 1 4 101 1 4 112 1 4 320 1 4 397 1 4 425 1 4 429 2 1 430 1 4 431 1 4 432 1 4 433 2 1 468 1 4 495 2 1 496 1 4 497 2 1 --------------------------------------------------- --------------------------------------------------- 5' GCAAUCAUAGGGAGGUCAC 3' Transcript: Sobic.003G093400.1:1220-1238 Slice Site:1228 |||||||o o||| ||| 3' CUUUAGUAUUGUUCC-GUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.003G093400.1:1228 MFE of perfect match: -27.30 MFE of this site: -18.20 MFEratio: 0.666666666666667 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,1238-1236 4-7,1234-1231 9-16,1229-1222 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1235-1235 BULt: Bulge on transcript side 8-8,1230-1230 SIL: Symmetric internal loop 17-18,1221-1220 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999959457979396 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.003G093400.1_1228_TPlot.pdf Position Reads Category 1210 1 4 1228 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' ACCAUUGAUGGUGAAGAUGAAG 3' Transcript: Sobic.003G163200.1:2551-2572 Slice Site:2563 ||||o|||||o|||||| 3' CACACACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.003G163200.1:2563 MFE of perfect match: -33.70 MFE of this site: -24.00 MFEratio: 0.712166172106825 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-17,2572-2556 Unpaired Regions (query5'-query3',transcript3'-transcript5') 18-22,2555-2551 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.201383206385136 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-3p-star_Sobic.003G163200.1_2563_TPlot.pdf Position Reads Category 63 1 4 66 1 4 74 1 4 103 1 4 112 1 4 204 1 4 285 1 4 325 1 4 347 1 4 395 1 4 420 1 4 439 1 4 459 2 2 462 1 4 531 1 4 581 1 4 708 1 4 710 1 4 724 1 4 727 1 4 902 1 4 907 1 4 959 1 4 973 1 4 975 1 4 1266 1 4 1713 1 4 1717 1 4 1718 1 4 1720 1 4 1734 1 4 2137 1 4 2144 1 4 2147 1 4 2149 2 2 2151 1 4 2214 1 4 2217 1 4 2221 1 4 2245 1 4 2246 2 2 2248 1 4 2251 3 1 2252 3 1 2253 2 2 2256 1 4 2257 1 4 2258 1 4 2387 1 4 2482 1 4 2527 1 4 2560 1 4 2563 1 4 <<<<<<<<<< 2565 1 4 2566 1 4 2580 1 4 2590 1 4 2603 1 4 2618 1 4 2621 1 4 2704 1 4 2709 1 4 2732 1 4 2756 1 4 2770 1 4 2772 1 4 2773 1 4 2801 1 4 2802 1 4 2818 1 4 2820 1 4 2826 1 4 2975 1 4 3134 1 4 3140 1 4 3185 2 2 3196 1 4 3199 1 4 3289 1 4 3292 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGGGUACCAGGGAGGCUAGGC 3' Transcript: Sobic.003G196800.1:244-265 Slice Site:255 || o|| |||||| ||o|||| 3' ACCGUAU-GUCCCU-CGGUCCG 5' Query: miR160-Probable-5p-mature SiteID: Sobic.003G196800.1:255 MFE of perfect match: -43.80 MFE of this site: -31.00 MFEratio: 0.707762557077626 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,265-259 8-13,257-252 14-16,250-248 18-19,246-245 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,258-258 BULt: Bulge on transcript side x-x,251-251 BULt: Bulge on transcript side 17-17,247-247 SIL: Symmetric internal loop 20-20,244-244 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.836056569328642 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR160-Probable-5p-mature_Sobic.003G196800.1_255_TPlot.pdf Position Reads Category 115 1 4 189 1 4 198 1 4 200 1 4 201 1 4 202 1 4 206 1 4 207 1 4 209 1 4 214 1 4 218 1 4 220 1 4 255 1 4 <<<<<<<<<< 326 1 4 344 2 0 346 1 4 352 1 4 367 1 4 375 1 4 390 1 4 391 1 4 392 1 4 427 1 4 494 1 4 503 1 4 511 1 4 555 1 4 --------------------------------------------------- --------------------------------------------------- 5' UCGAGACACUGCCGAGACCAGA 3' Transcript: Sobic.003G198400.1:1637-1658 Slice Site:1647 ||o|||| o|| o||||o| 3' UUCUUUGUGUUGG--UUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.003G198400.1:1647 MFE of perfect match: -29.60 MFE of this site: -20.60 MFEratio: 0.695945945945946 Allen et al. score: 11.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,1658-1652 8-10,1649-1647 12-18,1645-1639 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1651-1650 BULt: Bulge on transcript side 11-11,1646-1646 SIL: Symmetric internal loop 19-20,1638-1637 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999832772764367 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.003G198400.1_1647_TPlot.pdf Position Reads Category 1376 1 4 1446 1 4 1448 1 4 1482 1 4 1503 1 4 1647 1 4 <<<<<<<<<< 1650 1 4 1862 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCCGUGGGCCAGUCAGCGAUUGC 3' Transcript: Sobic.003G218600.2:197-219 Slice Site:209 ||| o|o|||||o||o| ||| | 3' CGGAGCUCGGUCGGUUG-UAAGG 5' Query: miR166-Known-5p-star SiteID: Sobic.003G218600.2:209 MFE of perfect match: -46.60 MFE of this site: -31.80 MFEratio: 0.682403433476395 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-1,219-219 3-5,217-215 6-18,213-201 20-22,199-197 Unpaired Regions (query5'-query3',transcript3'-transcript5') 2-2,218-218 SIL: Symmetric internal loop x-x,214-214 BULt: Bulge on transcript side 19-19,200-200 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.651291709063624 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR166-Known-5p-star_Sobic.003G218600.2_209_TPlot.pdf Position Reads Category 209 1 4 <<<<<<<<<< 346 1 4 409 1 4 441 1 4 457 1 4 461 1 4 472 1 4 478 1 4 563 1 4 572 1 4 594 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAGGGAUAC-ACCAACCCGA 3' Transcript: Sobic.003G259400.1:372-390 Slice Site:381 |||oo|o|| ||||||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.003G259400.1:381 MFE of perfect match: -29.60 MFE of this site: -20.00 MFEratio: 0.675675675675676 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 4-10,387-381 12-20,380-372 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,390-388 UP5: Unpaired region at 5' of query 11-11,x-x BULq: Bulge on query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.99999842784576 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.003G259400.1_381_TPlot.pdf Position Reads Category 90 1 4 122 1 4 125 1 4 126 1 4 127 1 4 132 1 4 159 1 4 339 1 4 381 1 4 <<<<<<<<<< 587 1 4 660 1 4 790 1 4 1056 1 4 1058 1 4 1078 1 4 1258 1 4 1360 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAAAUCAUGAAAGUAGGCAG 3' Transcript: Sobic.003G264200.1:326-345 Slice Site:334 ||||||||o| ||||| 3' CUUUAGUAUUGU--UCCGUG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.003G264200.1:334 MFE of perfect match: -27.30 MFE of this site: -18.18 MFEratio: 0.665934065934066 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 2-6,344-340 9-18,335-326 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,345-345 UP5: Unpaired region at 5' of query 7-8,339-336 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999974380610402 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175a-Probable-5p-star_Sobic.003G264200.1_334_TPlot.pdf Position Reads Category 69 1 4 222 1 4 236 1 4 334 1 4 <<<<<<<<<< 422 1 4 427 1 4 428 1 4 432 1 4 456 1 4 583 1 4 807 1 4 812 1 4 817 1 4 838 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUCAGGUUAAAGAGCUUGUUGGAAG 3' Transcript: Sobic.003G304700.1:296-320 Slice Site:310 |||o| |o|||o|| |||||| 3' AAGUUC----UUUCGGAC-ACCUUC 5' Query: miR396-Probable-5p-mature SiteID: Sobic.003G304700.1:310 MFE of perfect match: -34.10 MFE of this site: -22.30 MFEratio: 0.653958944281525 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,320-315 7-14,313-306 15-19,301-297 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,314-314 BULt: Bulge on transcript side x-x,305-302 BULt: Bulge on transcript side 20-20,296-296 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.996534775733709 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-5p-mature_Sobic.003G304700.1_310_TPlot.pdf Position Reads Category 299 1 4 308 1 4 310 1 4 <<<<<<<<<< 332 1 4 347 1 4 349 1 4 407 1 4 412 1 4 453 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAAC-C-ACCGACCAGA 3' Transcript: Sobic.003G305700.1:371-388 Slice Site:379 o||o||| | |||o||||o| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.003G305700.1:379 MFE of perfect match: -29.60 MFE of this site: -21.20 MFEratio: 0.716216216216216 Allen et al. score: 6 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,388-379 12-12,378-378 14-20,377-371 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,x-x BULq: Bulge on query side 13-13,x-x BULq: Bulge on query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.238740759304224 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.003G305700.1_379_TPlot.pdf Position Reads Category 14 1 4 105 1 4 164 1 4 167 1 4 171 1 4 174 2 2 177 1 4 178 1 4 181 1 4 199 1 4 203 1 4 204 1 4 213 1 4 216 1 4 220 1 4 223 1 4 237 1 4 241 1 4 242 2 2 246 1 4 249 1 4 257 1 4 265 1 4 266 1 4 268 2 2 280 1 4 285 1 4 288 1 4 319 1 4 350 1 4 359 1 4 375 2 2 378 2 2 379 2 2 <<<<<<<<<< 380 1 4 381 2 2 382 1 4 384 1 4 385 4 1 386 3 2 388 4 1 389 4 1 390 3 2 391 4 1 392 3 2 393 2 2 394 1 4 395 1 4 396 1 4 413 1 4 453 1 4 458 1 4 460 1 4 463 1 4 465 2 2 466 2 2 468 1 4 473 1 4 481 1 4 488 1 4 489 1 4 496 1 4 502 1 4 506 1 4 511 2 2 536 1 4 --------------------------------------------------- --------------------------------------------------- 5' CUGCCCGGCACCA-GCACGC 3' Transcript: Sobic.003G354000.1:361-379 Slice Site:371 ||| |||||| |||||| 3' UACGAACCGUGGCACGUGCG 5' Query: miR160-Probable-3p-star SiteID: Sobic.003G354000.1:371 MFE of perfect match: -41.60 MFE of this site: -27.10 MFEratio: 0.651442307692308 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,379-374 9-14,372-367 17-19,364-362 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-8,373-373 AILq: Asymmetric internal loop with more nts on the query side 15-16,366-365 SIL: Symmetric internal loop 20-20,361-361 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.99998918624596 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR160-Probable-3p-star_Sobic.003G354000.1_371_TPlot.pdf Position Reads Category 101 1 4 371 1 4 <<<<<<<<<< 444 1 4 447 1 4 463 1 4 770 1 4 1201 2 0 --------------------------------------------------- --------------------------------------------------- 5' GAGAUCAUCACGGGGAAGGGCGC 3' Transcript: Sobic.003G370000.1:646-668 Slice Site:654 ||o||||| ||o o|||o| 3' CUUUAGUAUUGU-----UCCGUG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.003G370000.1:654 MFE of perfect match: -27.30 MFE of this site: -18.80 MFEratio: 0.688644688644689 Allen et al. score: 15.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,668-663 7-9,657-655 11-18,653-646 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,662-658 BULt: Bulge on transcript side 10-10,654-654 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.287356597918002 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175a-Probable-5p-star_Sobic.003G370000.1_654_TPlot.pdf Position Reads Category 134 1 4 141 1 4 148 1 4 178 1 4 197 1 4 262 1 4 265 1 4 283 1 4 284 4 1 285 1 4 391 1 4 410 1 4 504 1 4 637 4 1 639 1 4 640 1 4 652 1 4 653 1 4 654 2 2 <<<<<<<<<< 655 1 4 671 1 4 672 1 4 682 1 4 698 1 4 722 1 4 736 1 4 741 2 2 742 1 4 746 1 4 748 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGCGGCUCCA--GGGGAUG 3' Transcript: Sobic.003G382900.1:134-151 Slice Site:144 ||||o||||| ||||| 3' ACCGCUGAGGUGACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.003G382900.1:144 MFE of perfect match: -42.90 MFE of this site: -29.70 MFEratio: 0.692307692307692 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-7,149-145 10-19,144-135 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,151-150 UP5: Unpaired region at 5' of query 8-9,x-x BULq: Bulge on query side 20-20,134-134 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.884606474178939 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-5p-mature_Sobic.003G382900.1_144_TPlot.pdf Position Reads Category 130 1 4 133 1 4 143 1 4 144 1 4 <<<<<<<<<< 627 1 4 629 1 4 1172 1 4 1464 1 4 1470 1 4 1542 1 4 1544 2 0 1545 1 4 1546 1 4 1564 1 4 1565 1 4 1606 1 4 1675 1 4 1692 1 4 1933 1 4 1936 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGCUCUCUCUCUUCUGUCA 3' Transcript: Sobic.003G406600.1:857-876 Slice Site:867 |||||||||||||||||||| 3' CACGAGAGAGAGAAGACAGU 5' Query: miR156h-Probable-5p-mature SiteID: Sobic.003G406600.1:867 MFE of perfect match: -37.40 MFE of this site: -39.00 MFEratio: 1 Allen et al. score: 0 Paired Regions (query5'-query3',transcript3'-transcript5') 1-20,876-857 Unpaired Regions (query5'-query3',transcript3'-transcript5') NA Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 3 Degradome p-value: 0.000339268316915886 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156h-Probable-5p-mature_Sobic.003G406600.1_867_TPlot.pdf Position Reads Category 867 2 3 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CGAAUCAUUGCAAGGCUA 3' Transcript: Sobic.003G412400.3:184-201 Slice Site:192 o|||||| o|||||| 3' CUUUAGUAUUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.003G412400.3:192 MFE of perfect match: -27.30 MFE of this site: -18.50 MFEratio: 0.677655677655678 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 3-9,199-193 11-17,191-185 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,201-200 UP5: Unpaired region at 5' of query 10-10,192-192 SIL: Symmetric internal loop 18-18,184-184 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999515985662913 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.003G412400.3_192_TPlot.pdf Position Reads Category 129 1 4 189 1 4 192 1 4 <<<<<<<<<< 197 1 4 220 1 4 286 1 4 434 1 4 708 1 4 --------------------------------------------------- --------------------------------------------------- 5' GCCGAGGGUGGUGAAGAUGAGG 3' Transcript: Sobic.004G006300.2:151-172 Slice Site:163 |o|o|||||o||||o| 3' CACACACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.004G006300.2:163 MFE of perfect match: -33.70 MFE of this site: -22.50 MFEratio: 0.667655786350148 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-16,172-157 Unpaired Regions (query5'-query3',transcript3'-transcript5') 17-22,156-151 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.541299610779524 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-3p-star_Sobic.004G006300.2_163_TPlot.pdf Position Reads Category 54 1 4 59 2 2 60 1 4 61 1 4 80 1 4 81 1 4 83 1 4 85 1 4 86 3 2 87 2 2 89 2 2 91 1 4 93 1 4 95 1 4 96 1 4 100 5 2 102 2 2 103 3 2 110 1 4 111 1 4 113 1 4 117 1 4 122 1 4 146 1 4 149 1 4 153 1 4 163 1 4 <<<<<<<<<< 187 1 4 198 1 4 207 1 4 208 1 4 239 1 4 241 1 4 242 2 2 243 3 2 253 1 4 254 1 4 256 2 2 257 1 4 258 2 2 260 1 4 264 1 4 266 1 4 267 1 4 268 4 2 271 1 4 273 1 4 275 1 4 277 2 2 278 1 4 279 1 4 280 1 4 281 5 2 282 1 4 283 2 2 288 1 4 307 1 4 309 1 4 317 1 4 318 2 2 357 1 4 358 1 4 368 1 4 370 1 4 371 1 4 375 1 4 376 2 2 378 3 2 379 1 4 381 2 2 382 1 4 383 3 2 386 2 2 387 8 0 388 5 2 389 4 2 390 2 2 391 1 4 397 1 4 398 1 4 401 1 4 403 1 4 405 1 4 410 1 4 414 1 4 416 1 4 421 3 2 422 2 2 427 1 4 428 1 4 460 1 4 468 1 4 469 1 4 471 2 2 472 1 4 473 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGGCGACUUCACCAGGGGCAAC 3' Transcript: Sobic.004G018400.1:213-234 Slice Site:223 |||||||o||| |||| ||| 3' ACCGCUGAGGUGA-CCCC-UUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.004G018400.1:223 MFE of perfect match: -42.90 MFE of this site: -31.00 MFEratio: 0.722610722610723 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,234-232 4-7,230-227 9-19,224-214 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,231-231 BULt: Bulge on transcript side 8-8,226-225 AILt: Asymmetric internal loop with more nts on the transcript side 20-20,213-213 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.568706893786056 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-5p-mature_Sobic.004G018400.1_223_TPlot.pdf Position Reads Category 21 1 4 128 1 4 195 1 4 197 1 4 199 1 4 200 1 4 208 1 4 209 1 4 220 1 4 223 1 4 <<<<<<<<<< 226 1 4 385 1 4 388 1 4 390 1 4 391 2 2 399 2 2 403 2 2 405 5 0 412 1 4 416 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGGUGCUGUCGCCGGAGGAGA 3' Transcript: Sobic.004G075800.1:2054-2074 Slice Site:2064 |||o||o|| ||||| ||| 3' ACCGCGGCAACGGCC-CCUGG 5' Query: miR8175a-Probable-3p-mature SiteID: Sobic.004G075800.1:2064 MFE of perfect match: -47.80 MFE of this site: -31.10 MFEratio: 0.650627615062762 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 3-5,2072-2070 6-10,2068-2064 12-20,2062-2054 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-2,2074-2073 UP5: Unpaired region at 5' of query x-x,2069-2069 BULt: Bulge on transcript side 11-11,2063-2063 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999998683299 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175a-Probable-3p-mature_Sobic.004G075800.1_2064_TPlot.pdf Position Reads Category 1060 1 4 1258 1 4 1312 1 4 1584 1 4 1590 1 4 1646 1 4 2064 1 4 <<<<<<<<<< 2217 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGAGGCACAAUUAACGCCA 3' Transcript: Sobic.004G084500.2:1352-1371 Slice Site:1362 |o||oo|||||oo||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.004G084500.2:1362 MFE of perfect match: -29.60 MFE of this site: -19.70 MFEratio: 0.66554054054054 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 5-20,1367-1352 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-4,1371-1368 UP5: Unpaired region at 5' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999978344203 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.004G084500.2_1362_TPlot.pdf Position Reads Category 61 1 4 535 1 4 759 1 4 1194 1 4 1319 1 4 1362 1 4 <<<<<<<<<< 1366 1 4 1367 1 4 1368 2 0 1371 1 4 1374 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGAGGCGAUGGACGGGGAGAGGGGCAAGGC 3' Transcript: Sobic.004G230200.1:1299-1328 Slice Site:1318 ||||| |||o|oo||||oo|| o|| 3' UCUCCGA---CUGUCUUUCUCUUCGC-UCG 5' Query: miR156i-Known-3p-star SiteID: Sobic.004G230200.1:1318 MFE of perfect match: -51.60 MFE of this site: -34.14 MFEratio: 0.661627906976744 Allen et al. score: 13.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,1328-1326 5-19,1323-1309 21-25,1304-1300 Unpaired Regions (query5'-query3',transcript3'-transcript5') 4-4,1325-1324 AILt: Asymmetric internal loop with more nts on the transcript side 20-20,1308-1305 AILt: Asymmetric internal loop with more nts on the transcript side 26-26,1299-1299 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.813986256532327 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156i-Known-3p-star_Sobic.004G230200.1_1318_TPlot.pdf Position Reads Category 231 1 4 232 1 4 488 1 4 1151 1 4 1258 1 4 1318 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' ACAAAACACAACC-ACCAAA 3' Transcript: Sobic.004G236200.1:1256-1274 Slice Site:1266 |||||||||| |||||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.004G236200.1:1266 MFE of perfect match: -29.60 MFE of this site: -20.90 MFEratio: 0.706081081081081 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,1274-1269 8-17,1268-1259 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,x-x BULq: Bulge on query side 18-20,1258-1256 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998714860676628 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.004G236200.1_1266_TPlot.pdf Position Reads Category 311 1 4 322 1 4 492 1 4 506 1 4 521 1 4 724 1 4 765 1 4 945 1 4 1244 1 4 1262 1 4 1266 1 4 <<<<<<<<<< 1268 1 4 1272 1 4 1445 1 4 1782 1 4 1787 1 4 1790 1 4 1791 1 4 1870 1 4 1872 1 4 1877 1 4 1951 1 4 1954 1 4 2232 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAGAAGCACGAG-GACCAGG 3' Transcript: Sobic.004G286600.1:103-121 Slice Site:113 |||||o|||o| o||||o 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.004G286600.1:113 MFE of perfect match: -29.60 MFE of this site: -19.90 MFEratio: 0.672297297297297 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-7,120-115 10-20,113-103 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,121-121 UP5: Unpaired region at 5' of query 8-9,114-114 AILq: Asymmetric internal loop with more nts on the query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999605715544 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.004G286600.1_113_TPlot.pdf Position Reads Category 38 1 4 60 1 4 67 2 2 68 1 4 72 1 4 73 1 4 76 1 4 83 1 4 85 1 4 92 1 4 95 2 2 96 4 2 97 1 4 98 1 4 99 2 2 100 6 2 101 4 2 102 2 2 103 7 2 104 9 2 105 7 2 106 19 0 107 6 2 108 2 2 109 4 2 110 7 2 111 3 2 112 5 2 113 1 4 <<<<<<<<<< 114 2 2 115 1 4 116 1 4 117 1 4 118 2 2 119 1 4 121 1 4 125 2 2 126 1 4 127 4 2 128 1 4 130 2 2 131 2 2 133 2 2 134 1 4 135 1 4 150 1 4 153 1 4 154 1 4 156 1 4 157 2 2 163 1 4 258 1 4 259 1 4 261 1 4 262 3 2 264 1 4 265 2 2 268 2 2 271 2 2 272 1 4 273 3 2 274 1 4 276 1 4 277 1 4 279 1 4 284 2 2 285 3 2 286 1 4 291 2 2 292 1 4 295 1 4 298 1 4 299 2 2 301 4 2 302 1 4 304 4 2 305 2 2 306 1 4 307 2 2 309 1 4 310 1 4 319 5 2 320 2 2 322 5 2 323 3 2 324 1 4 325 1 4 326 1 4 327 2 2 329 2 2 330 3 2 331 3 2 333 1 4 335 1 4 341 1 4 343 1 4 344 1 4 346 1 4 349 1 4 454 1 4 456 1 4 472 1 4 507 1 4 512 1 4 548 1 4 553 1 4 575 1 4 577 1 4 579 1 4 588 1 4 591 1 4 593 1 4 596 1 4 608 1 4 610 1 4 611 1 4 613 1 4 614 1 4 615 3 2 617 1 4 619 1 4 636 1 4 717 1 4 722 1 4 724 1 4 725 1 4 729 1 4 738 1 4 740 1 4 748 4 2 755 1 4 769 1 4 774 1 4 784 1 4 785 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAAGUGGUUACAAGGGAC 3' Transcript: Sobic.004G358400.1:2956-2973 Slice Site:2964 |||o| o| |||||| || 3' CUUUAGUAUUGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.004G358400.1:2964 MFE of perfect match: -27.30 MFE of this site: -18.00 MFEratio: 0.659340659340659 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,2973-2972 4-9,2970-2965 11-12,2963-2962 14-18,2960-2956 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,2971-2971 SIL: Symmetric internal loop 10-10,2964-2964 SIL: Symmetric internal loop 13-13,2961-2961 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999993692513851 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.004G358400.1_2964_TPlot.pdf Position Reads Category 740 1 4 827 1 4 858 1 4 860 1 4 863 1 4 867 1 4 934 1 4 1033 1 4 1386 1 4 1503 1 4 1508 1 4 1518 1 4 1602 1 4 2235 1 4 2361 1 4 2431 1 4 2442 1 4 2458 1 4 2785 1 4 2878 1 4 2959 1 4 2964 1 4 <<<<<<<<<< 3132 1 4 3330 1 4 3500 1 4 3711 1 4 3802 1 4 3917 1 4 3949 1 4 4021 1 4 4194 1 4 4266 1 4 4345 1 4 4565 1 4 4712 1 4 4731 1 4 4844 1 4 4862 1 4 4866 1 4 5125 1 4 5132 1 4 5133 1 4 5141 1 4 5142 2 2 5144 1 4 5146 1 4 5147 1 4 5148 3 0 5157 1 4 5165 1 4 5197 1 4 5341 2 2 5620 1 4 5832 1 4 5833 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAACUUGGCCAACCUCU 3' Transcript: Sobic.005G101200.1:634-653 Slice Site:644 o||o||| oo|||||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.005G101200.1:644 MFE of perfect match: -29.60 MFE of this site: -20.20 MFEratio: 0.682432432432432 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 4-11,650-643 14-20,640-634 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,653-651 UP5: Unpaired region at 5' of query 12-13,642-641 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999988212119721 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.005G101200.1_644_TPlot.pdf Position Reads Category 644 1 4 <<<<<<<<<< 853 1 4 928 1 4 933 1 4 1006 1 4 1751 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGUCGACAACGAGGACGC 3' Transcript: Sobic.005G142900.1:529-548 Slice Site:538 ||oo||o |||o||| |o| 3' CUUUAGUA-UUGUUCC-GUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.005G142900.1:538 MFE of perfect match: -27.30 MFE of this site: -18.10 MFEratio: 0.663003663003663 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-3,548-546 4-10,544-538 12-18,535-529 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,545-545 BULt: Bulge on transcript side 11-11,537-536 AILt: Asymmetric internal loop with more nts on the transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999977489769895 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.005G142900.1_538_TPlot.pdf Position Reads Category 400 1 4 525 1 4 527 1 4 538 1 4 <<<<<<<<<< 671 1 4 729 1 4 769 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGAUGAUGAUGAAGAGGCAC 3' Transcript: Sobic.005G211200.1:415-435 Slice Site:423 ||o|| ||o|o o|||||| 3' CUUUAGUAUUG---UUCCGUG 5' Query: miR8175a-Probable-5p-star SiteID: Sobic.005G211200.1:423 MFE of perfect match: -27.30 MFE of this site: -19.20 MFEratio: 0.703296703296703 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,435-429 8-12,425-421 14-18,419-415 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,428-426 BULt: Bulge on transcript side 13-13,420-420 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.985925148558575 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175a-Probable-5p-star_Sobic.005G211200.1_423_TPlot.pdf Position Reads Category 406 1 4 423 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UGGCUGGCGGAGCUGCUGGAGAGGAUAGAGU 3' Transcript: Sobic.006G064100.1:506-536 Slice Site:525 ||||||o|o||| o||||o| |||o 3' ACCGACUGUCUC-----UCUCUUCA--CUCG 5' Query: miR156c-Known-3p-star SiteID: Sobic.006G064100.1:525 MFE of perfect match: -48.30 MFE of this site: -32.00 MFEratio: 0.662525879917184 Allen et al. score: 19.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,536-533 6-12,529-523 13-24,517-506 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-5,532-530 AILt: Asymmetric internal loop with more nts on the transcript side x-x,522-518 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.585637226316681 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156c-Known-3p-star_Sobic.006G064100.1_525_TPlot.pdf Position Reads Category 183 1 4 257 1 4 335 1 4 489 1 4 500 1 4 505 1 4 518 1 4 525 1 4 <<<<<<<<<< 528 1 4 531 1 4 539 2 2 543 1 4 552 1 4 553 2 2 555 2 2 556 2 2 557 2 2 558 1 4 559 2 2 560 4 0 561 2 2 562 1 4 570 1 4 582 1 4 591 1 4 635 1 4 643 1 4 645 1 4 648 1 4 651 1 4 854 1 4 871 1 4 958 1 4 1063 1 4 1086 1 4 1088 2 2 1089 1 4 1122 1 4 1209 1 4 1395 1 4 1411 1 4 1416 1 4 1450 1 4 1456 1 4 1475 1 4 1522 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGAAACGCU-CCAAUCAAC 3' Transcript: Sobic.006G083300.2:2176-2194 Slice Site:2186 o||||||o| ||||o||| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.006G083300.2:2186 MFE of perfect match: -29.60 MFE of this site: -20.70 MFEratio: 0.699324324324324 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 2-9,2193-2186 12-20,2184-2176 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,2194-2194 UP5: Unpaired region at 5' of query 10-11,2185-2185 AILq: Asymmetric internal loop with more nts on the query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999549091787667 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.006G083300.2_2186_TPlot.pdf Position Reads Category 29 1 4 908 1 4 1126 1 4 1170 1 4 1771 1 4 2039 1 4 2186 1 4 <<<<<<<<<< 2756 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGGGCACCGCUCAGG-UGGGUGGUG 3' Transcript: Sobic.006G102300.1:1209-1233 Slice Site:1225 ||||o ||||||| |o|o|o|o| 3' CACCU----CGAGUCCUAUCUAUCGC 5' Query: miR390-Probable-3p-star SiteID: Sobic.006G102300.1:1225 MFE of perfect match: -43.00 MFE of this site: -29.30 MFEratio: 0.681395348837209 Allen et al. score: 10.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,1233-1225 11-17,1224-1218 18-22,1213-1209 Unpaired Regions (query5'-query3',transcript3'-transcript5') 10-10,x-x BULq: Bulge on query side x-x,1217-1214 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.434410260615446 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR390-Probable-3p-star_Sobic.006G102300.1_1225_TPlot.pdf Position Reads Category 1225 1 4 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' UCCCAGCAAGCAUCGGUAACCGCU 3' Transcript: Sobic.006G109300.1:722-745 Slice Site:735 |||||o| o||| || |||||| 3' AGGGUUG--UGUAAACA-UGGCGA 5' Query: miR5565-Probable-5p-star SiteID: Sobic.006G109300.1:735 MFE of perfect match: -37.40 MFE of this site: -25.50 MFEratio: 0.681818181818182 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,745-740 7-8,738-737 11-14,734-731 15-21,728-722 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,739-739 BULt: Bulge on transcript side 9-10,736-735 SIL: Symmetric internal loop x-x,730-729 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.487503416447557 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5565-Probable-5p-star_Sobic.006G109300.1_735_TPlot.pdf Position Reads Category 504 1 4 535 1 4 675 1 4 689 1 4 733 1 4 735 1 4 <<<<<<<<<< 793 1 4 934 1 4 935 1 4 941 1 4 948 1 4 957 1 4 958 1 4 960 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUCAAGAAGGAUAGGCCUCUGGAGG 3' Transcript: Sobic.006G119200.1:2104-2128 Slice Site:2119 ||||||| o|||| ||||o| 3' AAGUUCUU-----UCGGACACCUUC 5' Query: miR396-Probable-5p-mature SiteID: Sobic.006G119200.1:2119 MFE of perfect match: -34.10 MFE of this site: -22.60 MFEratio: 0.662756598240469 Allen et al. score: 15 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,2128-2123 8-12,2121-2117 13-19,2111-2105 Unpaired Regions (query5'-query3',transcript3'-transcript5') 7-7,2122-2122 SIL: Symmetric internal loop x-x,2116-2112 BULt: Bulge on transcript side 20-20,2104-2104 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.991507417713098 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-5p-mature_Sobic.006G119200.1_2119_TPlot.pdf Position Reads Category 521 1 4 537 1 4 541 1 4 549 1 4 550 1 4 617 1 4 679 1 4 717 1 4 722 1 4 889 1 4 891 1 4 893 1 4 895 1 4 896 1 4 913 1 4 975 1 4 1288 1 4 1399 1 4 1560 1 4 1981 1 4 2069 1 4 2097 1 4 2100 1 4 2119 1 4 <<<<<<<<<< 2138 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGGAACACCAACUAUACAGA 3' Transcript: Sobic.006G126300.1:580-600 Slice Site:591 o||o|||| ||||o| ||o| 3' UUCUUUGU-GUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.006G126300.1:591 MFE of perfect match: -29.60 MFE of this site: -19.40 MFEratio: 0.655405405405405 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-4,600-597 7-12,594-589 13-20,587-580 Unpaired Regions (query5'-query3',transcript3'-transcript5') 5-6,596-595 SIL: Symmetric internal loop x-x,588-588 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999999373285 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.006G126300.1_591_TPlot.pdf Position Reads Category 305 1 4 591 1 4 <<<<<<<<<< 593 1 4 637 1 4 701 1 4 703 1 4 704 3 1 708 1 4 710 1 4 711 1 4 714 1 4 715 1 4 717 3 1 718 1 4 731 1 4 737 1 4 796 1 4 999 1 4 1041 1 4 1048 2 2 1051 1 4 1052 1 4 1054 1 4 1156 1 4 1164 2 2 1211 1 4 1229 1 4 1380 1 4 1456 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGUUGCUCACAUUGGGGGAC 3' Transcript: Sobic.006G182000.2:40-60 Slice Site:51 ||o o||| ||o|||||o|| 3' ACCGCUGAG-GUGACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.006G182000.2:51 MFE of perfect match: -42.90 MFE of this site: -29.90 MFEratio: 0.696969696969697 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-11,60-50 12-15,48-45 17-19,43-41 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,49-49 BULt: Bulge on transcript side 16-16,44-44 SIL: Symmetric internal loop 20-20,40-40 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.835550768428349 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-5p-mature_Sobic.006G182000.2_51_TPlot.pdf Position Reads Category 46 1 4 51 1 4 <<<<<<<<<< 284 1 4 368 1 4 377 1 4 379 1 4 381 1 4 384 1 4 409 1 4 863 1 4 1647 1 4 2232 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAAAUCAUAGCCACGAGGCAC 3' Transcript: Sobic.006G184500.1:521-541 Slice Site:529 |||||||| ||o|||||| 3' CUUUAGUAU---UGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.006G184500.1:529 MFE of perfect match: -27.30 MFE of this site: -21.10 MFEratio: 0.772893772893773 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-9,541-533 10-17,529-522 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,532-530 BULt: Bulge on transcript side 18-18,521-521 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 0 Degradome p-value: 0.0190317967898912 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.006G184500.1_529_TPlot.pdf Position Reads Category 514 1 4 524 1 4 529 2 0 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' GCAUUGCUUGAUGAUGUCAC 3' Transcript: Sobic.006G201300.1:3367-3386 Slice Site:3377 ||||||||||o||| 3' CACUUAGAACUACUACGGUG 5' Query: miR172b-Probable-5p-star SiteID: Sobic.006G201300.1:3377 MFE of perfect match: -34.30 MFE of this site: -23.20 MFEratio: 0.676384839650146 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-14,3386-3373 Unpaired Regions (query5'-query3',transcript3'-transcript5') 15-20,3372-3367 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.635924136786574 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR172b-Probable-5p-star_Sobic.006G201300.1_3377_TPlot.pdf Position Reads Category 563 1 4 569 1 4 605 1 4 1215 1 4 2192 1 4 2542 1 4 3161 1 4 3377 1 4 <<<<<<<<<< 3572 1 4 3639 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGUGAUGAUAGUGAGGAUGAAG 3' Transcript: Sobic.006G209700.1:684-706 Slice Site:697 ||| |||||||||oo|||||| 3' CACAC-ACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.006G209700.1:697 MFE of perfect match: -33.70 MFE of this site: -27.90 MFEratio: 0.827893175074184 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-17,706-690 18-20,688-686 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,689-689 BULt: Bulge on transcript side 21-22,685-684 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00919882905665648 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-3p-star_Sobic.006G209700.1_697_TPlot.pdf Position Reads Category 109 1 4 641 1 4 666 1 4 669 1 4 670 1 4 671 1 4 672 1 4 683 2 0 694 1 4 697 1 4 <<<<<<<<<< 702 1 4 785 1 4 --------------------------------------------------- --------------------------------------------------- 5' GAGUGAUGAUAGUGAGGAUGAAG 3' Transcript: Sobic.006G209700.2:684-706 Slice Site:697 ||| |||||||||oo|||||| 3' CACAC-ACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.006G209700.2:697 MFE of perfect match: -33.70 MFE of this site: -27.90 MFEratio: 0.827893175074184 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-17,706-690 18-20,688-686 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,689-689 BULt: Bulge on transcript side 21-22,685-684 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.00614199340168997 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-3p-star_Sobic.006G209700.2_697_TPlot.pdf Position Reads Category 121 1 4 647 1 4 654 1 4 656 1 4 658 3 1 661 1 4 662 1 4 663 1 4 665 1 4 669 3 1 685 1 4 695 1 4 697 1 4 <<<<<<<<<< 774 1 4 784 1 4 845 1 4 858 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGAAGCUCUACAGGGGAAC 3' Transcript: Sobic.007G078300.3:430-449 Slice Site:440 || o|||o|| ||||||| 3' ACCGCUGAGGUGACCCCUUG 5' Query: miR5072-Probable-5p-mature SiteID: Sobic.007G078300.3:440 MFE of perfect match: -42.90 MFE of this site: -28.10 MFEratio: 0.655011655011655 Allen et al. score: 6.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,449-443 9-15,441-435 18-19,432-431 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-8,442-442 SIL: Symmetric internal loop 16-17,434-433 SIL: Symmetric internal loop 20-20,430-430 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.997991205521261 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-5p-mature_Sobic.007G078300.3_440_TPlot.pdf Position Reads Category 42 1 4 440 1 4 <<<<<<<<<< 826 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAGACCCACAACCAGAACCAAA 3' Transcript: Sobic.007G164750.1:251-272 Slice Site:261 ||| |||||||| |||||| 3' UUCUUUGUGUUGGU--UGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.007G164750.1:261 MFE of perfect match: -29.60 MFE of this site: -19.60 MFEratio: 0.662162162162162 Allen et al. score: 7 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,272-267 7-14,264-257 17-19,254-252 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,266-265 BULt: Bulge on transcript side 15-16,256-255 SIL: Symmetric internal loop 20-20,251-251 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.639757105121665 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.007G164750.1_261_TPlot.pdf Position Reads Category 18 1 4 19 1 4 24 2 3 29 4 2 30 3 2 31 1 4 32 1 4 34 1 4 35 6 2 36 5 2 37 2 3 38 4 2 39 6 2 40 3 2 41 3 2 42 2 3 47 1 4 52 1 4 53 3 2 54 1 4 59 3 2 61 1 4 63 1 4 66 5 2 67 1 4 68 1 4 69 1 4 70 1 4 71 2 3 72 2 3 76 2 3 77 1 4 79 1 4 83 1 4 84 1 4 87 1 4 89 1 4 90 3 2 91 2 3 92 1 4 93 1 4 94 1 4 95 2 3 96 2 3 99 4 2 100 1 4 101 2 3 102 2 3 107 1 4 108 2 3 109 2 3 113 1 4 114 1 4 116 2 3 118 2 3 119 4 2 120 1 4 121 1 4 122 1 4 123 2 3 129 2 3 130 1 4 131 1 4 135 1 4 136 1 4 137 1 4 138 1 4 143 1 4 147 1 4 148 2 3 150 1 4 151 7 2 152 2 3 154 1 4 155 1 4 163 1 4 174 1 4 185 2 3 186 2 3 187 1 4 188 3 2 189 3 2 190 1 4 191 5 2 192 4 2 196 2 3 197 2 3 198 2 3 199 1 4 201 1 4 202 2 3 203 2 3 207 1 4 209 4 2 210 2 3 211 2 3 213 1 4 214 4 2 215 7 2 216 4 2 217 1 4 218 1 4 219 7 2 220 2 3 221 3 2 222 6 2 224 4 2 225 1 4 226 3 2 227 6 2 228 6 2 229 1 4 230 1 4 231 4 2 232 3 2 233 7 2 234 3 2 235 1 4 237 4 2 238 3 2 239 4 2 240 1 4 242 2 3 243 2 3 244 6 2 245 3 2 246 8 2 247 3 2 248 6 2 249 3 2 250 3 2 251 15 0 252 4 2 253 1 4 254 6 2 255 5 2 256 2 3 257 5 2 258 4 2 259 6 2 260 4 2 261 3 2 <<<<<<<<<< 263 6 2 264 4 2 269 4 2 270 3 2 271 1 4 273 1 4 274 1 4 275 1 4 276 2 3 278 1 4 279 3 2 280 2 3 281 4 2 282 7 2 283 4 2 284 5 2 285 4 2 286 4 2 287 14 2 288 8 2 289 3 2 290 2 3 291 4 2 292 3 2 293 6 2 294 4 2 295 1 4 296 4 2 297 6 2 298 2 3 299 6 2 300 1 4 303 1 4 305 3 2 306 1 4 308 1 4 311 6 2 312 1 4 313 1 4 315 2 3 316 2 3 317 2 3 318 2 3 322 1 4 323 2 3 328 1 4 336 1 4 347 1 4 348 1 4 350 1 4 351 1 4 359 2 3 361 1 4 363 2 3 364 2 3 367 1 4 375 1 4 383 1 4 385 2 3 387 1 4 392 1 4 396 1 4 398 2 3 408 1 4 410 5 2 411 5 2 415 2 3 416 1 4 419 1 4 427 1 4 443 1 4 445 1 4 446 2 3 447 3 2 448 1 4 451 9 2 452 2 3 453 3 2 454 1 4 455 1 4 458 2 3 460 2 3 470 1 4 473 1 4 474 1 4 503 4 2 504 2 3 508 1 4 512 1 4 513 1 4 521 1 4 526 1 4 545 1 4 548 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGC-CUCUC-CACUGUCAGC 3' Transcript: Sobic.008G010800.1:1217-1235 Slice Site:1226 |||| | ||| ||||||||o| 3' CACGAGUGAGAGUGACAGUUG 5' Query: miR156f-Probable-5p-mature SiteID: Sobic.008G010800.1:1226 MFE of perfect match: -39.70 MFE of this site: -27.90 MFEratio: 0.702770780856423 Allen et al. score: 5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,1235-1226 12-14,1225-1223 16-16,1221-1221 18-21,1220-1217 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,x-x BULq: Bulge on query side 15-15,1222-1222 SIL: Symmetric internal loop 17-17,x-x BULq: Bulge on query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.327921534217351 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-5p-mature_Sobic.008G010800.1_1226_TPlot.pdf Position Reads Category 155 1 4 188 1 4 234 2 2 235 3 0 236 1 4 237 1 4 264 1 4 266 1 4 271 1 4 276 1 4 282 1 4 322 1 4 340 1 4 765 1 4 856 1 4 1086 1 4 1171 1 4 1180 1 4 1199 1 4 1208 1 4 1226 1 4 <<<<<<<<<< 1238 1 4 1250 1 4 1414 1 4 1416 1 4 1445 1 4 1501 1 4 1503 1 4 1511 1 4 1578 1 4 1682 1 4 1683 1 4 1716 1 4 1739 1 4 1947 1 4 1965 1 4 1995 1 4 --------------------------------------------------- --------------------------------------------------- 5' AAGCCCACCCAUGGUGGAG 3' Transcript: Sobic.008G160700.2:136-154 Slice Site:145 ||||||||| ||||| 3' UUCGGGUGGUCACCACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.008G160700.2:145 MFE of perfect match: -39.80 MFE of this site: -26.10 MFEratio: 0.655778894472362 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 4-8,151-147 11-19,144-136 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,154-152 UP5: Unpaired region at 5' of query 9-10,146-145 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.998550809203174 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-3p-star_Sobic.008G160700.2_145_TPlot.pdf Position Reads Category 145 1 4 <<<<<<<<<< 148 1 4 149 1 4 337 1 4 558 1 4 1113 1 4 1121 1 4 1130 1 4 1225 1 4 1590 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGGCGGCGGGUACGGCGGGGGCC 3' Transcript: Sobic.008G185900.1:282-304 Slice Site:295 |||| || | |||||o|| 3' ACCGCGGCAA---CGGCCCCUGG 5' Query: miR8175a-Probable-3p-mature SiteID: Sobic.008G185900.1:295 MFE of perfect match: -47.80 MFE of this site: -31.42 MFEratio: 0.657322175732218 Allen et al. score: 15 Paired Regions (query5'-query3',transcript3'-transcript5') 1-8,304-297 10-10,295-295 13-14,289-288 16-19,286-283 Unpaired Regions (query5'-query3',transcript3'-transcript5') 9-9,296-296 SIL: Symmetric internal loop 11-12,294-290 AILt: Asymmetric internal loop with more nts on the transcript side 15-15,287-287 SIL: Symmetric internal loop 20-20,282-282 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999968562243 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175a-Probable-3p-mature_Sobic.008G185900.1_295_TPlot.pdf Position Reads Category 112 1 4 165 1 4 169 1 4 170 4 0 171 1 4 173 1 4 199 1 4 209 1 4 295 1 4 <<<<<<<<<< 305 1 4 320 1 4 324 2 2 325 1 4 410 1 4 451 1 4 458 1 4 460 1 4 467 1 4 468 1 4 --------------------------------------------------- --------------------------------------------------- 5' AGGCACAGCCACCGUGUGUGUGUGC 3' Transcript: Sobic.008G192300.1:108-132 Slice Site:121 |o|| |||||o ||| |||||| 3' UUCG----GGUGGU-CAC-CACACG 5' Query: miR5072-Probable-3p-star SiteID: Sobic.008G192300.1:121 MFE of perfect match: -39.80 MFE of this site: -26.30 MFEratio: 0.660804020100503 Allen et al. score: 9.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-6,132-127 7-9,125-123 10-15,121-116 16-19,111-108 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,126-126 BULt: Bulge on transcript side x-x,122-122 BULt: Bulge on transcript side x-x,115-112 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 3 Degradome p-value: 0.0398808598562955 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5072-Probable-3p-star_Sobic.008G192300.1_121_TPlot.pdf Position Reads Category 121 2 3 <<<<<<<<<< --------------------------------------------------- --------------------------------------------------- 5' CGGGGUACCGCCGUUCGCCGGA 3' Transcript: Sobic.009G131100.1:38-59 Slice Site:50 ||||| || o||||||oo| 3' UACCCAUUUCGUUAAGCGGUUU 5' Query: miR5564b-Known-3p-star SiteID: Sobic.009G131100.1:50 MFE of perfect match: -36.00 MFE of this site: -25.00 MFEratio: 0.694444444444444 Allen et al. score: 9 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,59-50 12-13,48-47 16-20,44-40 Unpaired Regions (query5'-query3',transcript3'-transcript5') 11-11,49-49 SIL: Symmetric internal loop 14-15,46-45 SIL: Symmetric internal loop 21-22,39-38 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.476332306535079 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564b-Known-3p-star_Sobic.009G131100.1_50_TPlot.pdf Position Reads Category 50 1 4 <<<<<<<<<< 153 1 4 213 1 4 216 1 4 328 1 4 329 1 4 397 1 4 417 1 4 420 1 4 421 1 4 432 1 4 434 1 4 473 1 4 537 1 4 541 1 4 542 1 4 543 1 4 545 1 4 559 2 1 576 1 4 700 1 4 702 1 4 731 1 4 754 1 4 755 1 4 756 2 1 766 1 4 772 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUG-GUGGUGGUGGGGAUGCAA 3' Transcript: Sobic.009G182600.1:4415-4435 Slice Site:4426 ||| |||o|o|||ooo||| 3' CACACACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.009G182600.1:4426 MFE of perfect match: -33.70 MFE of this site: -22.80 MFEratio: 0.676557863501484 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 4-18,4432-4418 20-22,4417-4415 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-3,4435-4433 UP5: Unpaired region at 5' of query 19-19,x-x BULq: Bulge on query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.476332306535079 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-3p-star_Sobic.009G182600.1_4426_TPlot.pdf Position Reads Category 78 1 4 79 1 4 122 1 4 130 2 2 141 1 4 143 1 4 146 3 1 147 1 4 148 1 4 150 1 4 151 1 4 152 2 2 153 1 4 154 1 4 160 1 4 165 1 4 167 2 2 169 3 1 170 1 4 171 1 4 172 1 4 177 1 4 179 1 4 184 1 4 186 1 4 188 1 4 192 1 4 197 1 4 198 1 4 199 1 4 217 1 4 218 1 4 219 1 4 220 2 2 221 1 4 223 3 1 224 1 4 226 1 4 228 1 4 229 1 4 231 1 4 241 1 4 242 1 4 244 1 4 245 1 4 249 1 4 368 1 4 391 1 4 393 1 4 415 1 4 469 1 4 481 1 4 488 1 4 501 1 4 514 2 2 516 1 4 518 2 2 521 1 4 522 1 4 524 2 2 527 1 4 531 1 4 534 1 4 535 1 4 546 1 4 568 1 4 570 1 4 571 1 4 579 2 2 580 2 2 582 1 4 583 1 4 585 2 2 590 1 4 601 1 4 604 1 4 713 1 4 748 1 4 831 1 4 895 1 4 898 2 2 930 1 4 1097 1 4 1131 1 4 1230 1 4 1238 1 4 1282 1 4 1283 1 4 1486 1 4 1766 1 4 1817 1 4 1881 1 4 1882 2 2 2111 1 4 2198 1 4 2211 1 4 2359 1 4 2474 1 4 2483 1 4 2503 1 4 2796 1 4 3054 1 4 3120 1 4 3168 1 4 3243 1 4 3284 1 4 3577 1 4 3713 1 4 3778 1 4 3896 1 4 3901 1 4 3918 1 4 3919 2 2 3937 1 4 3991 1 4 4026 1 4 4028 1 4 4066 1 4 4069 1 4 4070 1 4 4073 1 4 4075 1 4 4082 1 4 4083 1 4 4085 1 4 4087 1 4 4089 1 4 4093 1 4 4135 1 4 4227 1 4 4297 1 4 4327 1 4 4330 1 4 4375 1 4 4387 1 4 4398 2 2 4426 1 4 <<<<<<<<<< 4435 1 4 4437 2 2 4544 1 4 4559 1 4 4560 1 4 4565 1 4 4572 1 4 4573 2 2 4574 2 2 4576 3 1 4577 1 4 4578 1 4 4579 2 2 4580 1 4 4581 1 4 4582 3 1 4587 1 4 4596 1 4 4614 1 4 4615 1 4 4621 1 4 4637 1 4 4669 1 4 4670 1 4 4692 1 4 4729 1 4 4736 1 4 4753 1 4 4765 1 4 4843 1 4 4857 1 4 4865 1 4 4868 1 4 4872 1 4 4873 1 4 4878 1 4 4883 1 4 4892 1 4 4899 1 4 4905 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAGCUCGACAGCCAGCCGGA 3' Transcript: Sobic.009G201500.1:1219-1238 Slice Site:1229 |||o|||o||oo| 3' UUCUUUGUGUUGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.009G201500.1:1229 MFE of perfect match: -29.60 MFE of this site: -19.30 MFEratio: 0.652027027027027 Allen et al. score: 11 Paired Regions (query5'-query3',transcript3'-transcript5') 1-13,1238-1226 Unpaired Regions (query5'-query3',transcript3'-transcript5') 14-20,1225-1219 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999999999965151 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.009G201500.1_1229_TPlot.pdf Position Reads Category 624 1 4 958 1 4 989 1 4 1185 1 4 1186 1 4 1229 1 4 <<<<<<<<<< 1236 1 4 1240 1 4 1241 1 4 1288 1 4 1290 1 4 1305 1 4 1306 1 4 1322 1 4 1328 1 4 1330 1 4 1331 1 4 1345 1 4 1351 1 4 1352 1 4 1354 1 4 1358 1 4 1360 1 4 1361 1 4 1363 1 4 1365 1 4 1369 1 4 1370 1 4 1379 1 4 1385 1 4 1386 1 4 1388 1 4 1392 2 1 1393 1 4 1593 1 4 1594 1 4 1603 1 4 1641 1 4 1907 1 4 1963 1 4 1968 1 4 1981 1 4 1987 1 4 2024 1 4 2114 1 4 2209 1 4 2214 1 4 2422 1 4 2427 1 4 2429 2 1 2430 1 4 2432 1 4 2434 1 4 2440 1 4 2445 1 4 2446 1 4 2453 1 4 2462 1 4 2477 1 4 2530 1 4 2531 1 4 2533 1 4 2543 1 4 2547 1 4 2549 1 4 2576 1 4 2581 1 4 2595 1 4 2635 1 4 2655 1 4 2656 1 4 2681 1 4 2697 1 4 --------------------------------------------------- --------------------------------------------------- 5' GGGGUCGUGUAUAAGGCGU 3' Transcript: Sobic.009G219100.1:430-448 Slice Site:438 |ooo||o|o |o|||||o 3' CUUUAGUAU-UGUUCCGUG 5' Query: miR8175g-Probable-5p-star SiteID: Sobic.009G219100.1:438 MFE of perfect match: -27.30 MFE of this site: -18.20 MFEratio: 0.666666666666667 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 2-9,447-440 10-18,438-430 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,448-448 UP5: Unpaired region at 5' of query x-x,439-439 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999966403210075 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR8175g-Probable-5p-star_Sobic.009G219100.1_438_TPlot.pdf Position Reads Category 438 1 4 <<<<<<<<<< 451 1 4 490 1 4 497 1 4 507 1 4 509 1 4 510 3 0 514 1 4 520 1 4 522 1 4 565 1 4 644 1 4 647 1 4 657 1 4 662 1 4 664 1 4 667 1 4 681 1 4 726 1 4 783 1 4 884 1 4 889 1 4 902 1 4 1038 2 2 1092 1 4 1130 1 4 1157 2 2 1235 1 4 1254 1 4 1268 1 4 1395 1 4 1397 1 4 1439 1 4 --------------------------------------------------- --------------------------------------------------- 5' CGGCG-GCCGCUGGUGCUGCAGC 3' Transcript: Sobic.009G226400.1:205-226 Slice Site:217 |||| o|| ||o|||||| || 3' ACCGCUUGGA-ACUACGACGACG 5' Query: miR172a-Probable-5p-star SiteID: Sobic.009G226400.1:217 MFE of perfect match: -44.70 MFE of this site: -29.70 MFEratio: 0.664429530201342 Allen et al. score: 8.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,226-225 4-12,223-215 14-16,212-210 18-21,209-206 Unpaired Regions (query5'-query3',transcript3'-transcript5') 3-3,224-224 SIL: Symmetric internal loop 13-13,214-213 AILt: Asymmetric internal loop with more nts on the transcript side 17-17,x-x BULq: Bulge on query side 22-22,205-205 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.914412178719775 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR172a-Probable-5p-star_Sobic.009G226400.1_217_TPlot.pdf Position Reads Category 217 1 4 <<<<<<<<<< 319 1 4 356 1 4 360 1 4 361 1 4 369 1 4 623 1 4 630 1 4 631 1 4 632 2 2 633 4 0 660 1 4 923 1 4 924 1 4 925 1 4 974 1 4 1008 1 4 1009 1 4 1010 1 4 1114 1 4 1130 1 4 1131 1 4 1146 1 4 1150 1 4 1321 1 4 1420 1 4 1540 1 4 1588 1 4 1595 1 4 1607 1 4 1716 1 4 --------------------------------------------------- --------------------------------------------------- 5' CAGCUGAUCCUCUUCUGUCAUC 3' Transcript: Sobic.009G231300.1:434-455 Slice Site:446 ||| |o |||||||||||o| 3' CACGAGUGAGAGAAGACAGUGG 5' Query: miR156g-Known-5p-mature SiteID: Sobic.009G231300.1:446 MFE of perfect match: -43.20 MFE of this site: -28.90 MFEratio: 0.668981481481481 Allen et al. score: 5.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-13,455-443 15-16,441-440 18-20,438-436 Unpaired Regions (query5'-query3',transcript3'-transcript5') 14-14,442-442 SIL: Symmetric internal loop 17-17,439-439 SIL: Symmetric internal loop 21-22,435-434 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 2 Degradome p-value: 0.0210525112297995 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156g-Known-5p-mature_Sobic.009G231300.1_446_TPlot.pdf Position Reads Category 67 2 2 69 2 2 78 1 4 81 1 4 141 2 2 142 1 4 144 1 4 208 1 4 209 1 4 215 1 4 221 1 4 237 1 4 239 1 4 243 1 4 246 1 4 252 1 4 255 1 4 258 1 4 260 1 4 262 1 4 289 1 4 302 1 4 312 1 4 314 1 4 315 1 4 385 2 2 386 2 2 387 1 4 390 1 4 393 1 4 403 1 4 409 1 4 411 1 4 412 1 4 438 1 4 445 3 1 446 2 2 <<<<<<<<<< 448 1 4 449 1 4 452 1 4 456 1 4 458 1 4 459 2 2 473 1 4 483 1 4 497 2 2 498 1 4 499 1 4 503 3 1 504 1 4 505 1 4 510 1 4 512 1 4 570 1 4 583 1 4 591 1 4 592 1 4 634 2 2 636 1 4 638 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUGAAGCACAUCAUCGACCAGG 3' Transcript: Sobic.010G092900.1:1861-1882 Slice Site:1873 |||o|||| |o|o||||oo 3' UUCUUUGUGU--UGGUUGGUUU 5' Query: miR5564a-Probable-5p-star SiteID: Sobic.010G092900.1:1873 MFE of perfect match: -29.60 MFE of this site: -20.50 MFEratio: 0.692567567567568 Allen et al. score: 10 Paired Regions (query5'-query3',transcript3'-transcript5') 1-10,1882-1873 11-18,1870-1863 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,1872-1871 BULt: Bulge on transcript side 19-20,1862-1861 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.999927430323627 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR5564a-Probable-5p-star_Sobic.010G092900.1_1873_TPlot.pdf Position Reads Category 110 1 4 112 1 4 546 1 4 676 1 4 678 1 4 694 1 4 704 1 4 1381 1 4 1383 1 4 1391 1 4 1576 1 4 1616 1 4 1722 1 4 1868 1 4 1869 1 4 1870 5 1 1873 1 4 <<<<<<<<<< 1875 2 2 1879 1 4 1880 1 4 1881 1 4 1890 1 4 1937 1 4 1975 1 4 1989 2 2 1990 1 4 1993 5 1 1996 1 4 2003 1 4 2008 1 4 2014 1 4 --------------------------------------------------- --------------------------------------------------- 5' UUGUGUGGUAUUGAGAUUGAGG 3' Transcript: Sobic.010G105200.2:9748-9769 Slice Site:9760 ||||||o|| |||o| |||o| 3' CACACACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.010G105200.2:9760 MFE of perfect match: -33.70 MFE of this site: -22.00 MFEratio: 0.652818991097923 Allen et al. score: 7.5 Paired Regions (query5'-query3',transcript3'-transcript5') 1-5,9769-9765 7-11,9763-9759 13-21,9757-9749 Unpaired Regions (query5'-query3',transcript3'-transcript5') 6-6,9764-9764 SIL: Symmetric internal loop 12-12,9758-9758 SIL: Symmetric internal loop 22-22,9748-9748 UP3: Unpaired region at 3' of query Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.668061979639646 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-3p-star_Sobic.010G105200.2_9760_TPlot.pdf Position Reads Category 116 1 4 127 1 4 128 1 4 152 1 4 210 1 4 585 1 4 626 1 4 757 1 4 905 1 4 918 1 4 985 1 4 1085 1 4 1915 1 4 2205 1 4 2243 1 4 2482 1 4 2519 1 4 2548 1 4 2561 1 4 2565 1 4 2574 1 4 2836 1 4 2838 1 4 2840 1 4 2841 1 4 2842 2 1 2843 1 4 2844 1 4 2847 1 4 2888 1 4 3387 1 4 3661 1 4 4162 1 4 4661 1 4 4741 1 4 4810 1 4 4811 1 4 4813 1 4 4821 1 4 4852 1 4 5811 1 4 5845 1 4 5882 1 4 6141 1 4 6146 1 4 6285 1 4 6378 1 4 6475 1 4 6523 1 4 6780 1 4 6837 1 4 7499 1 4 7550 1 4 7557 1 4 7617 1 4 7658 1 4 7664 1 4 7998 1 4 8563 1 4 8585 1 4 8720 1 4 8820 1 4 8912 1 4 9080 1 4 9216 1 4 9263 1 4 9265 2 1 9266 1 4 9369 1 4 9599 1 4 9601 1 4 9707 1 4 9733 1 4 9737 1 4 9760 1 4 <<<<<<<<<< 9778 1 4 9881 1 4 9883 1 4 9884 1 4 9886 1 4 9891 1 4 10386 1 4 10705 1 4 10791 1 4 10840 1 4 10924 1 4 10989 1 4 11108 1 4 11110 1 4 11307 1 4 11568 1 4 11570 1 4 11992 1 4 12000 1 4 --------------------------------------------------- --------------------------------------------------- 5' GUG-GUGGUGGUGGUGGUGGAG 3' Transcript: Sobic.010G194801.1:317-337 Slice Site:328 ||| |||o|o|||o oo||o|| 3' CACACACUAUCACUUUUACUUC 5' Query: miR156f-Probable-3p-star SiteID: Sobic.010G194801.1:328 MFE of perfect match: -33.70 MFE of this site: -25.50 MFEratio: 0.756676557863501 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-7,337-331 9-18,329-320 20-22,319-317 Unpaired Regions (query5'-query3',transcript3'-transcript5') 8-8,330-330 SIL: Symmetric internal loop 19-19,x-x BULq: Bulge on query side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.0854595030747962 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR156f-Probable-3p-star_Sobic.010G194801.1_328_TPlot.pdf Position Reads Category 328 1 4 <<<<<<<<<< 402 1 4 --------------------------------------------------- --------------------------------------------------- 5' UGCUCCAAGGAGGUGACUUCA 3' Transcript: Sobic.010G258000.1:344-364 Slice Site:355 |||||||||||||o |oo| 3' ACGAGGUUCCUCCGACGGGGC 5' Query: miR396-Probable-3p-star SiteID: Sobic.010G258000.1:355 MFE of perfect match: -48.20 MFE of this site: -33.10 MFEratio: 0.686721991701245 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 2-5,363-360 8-21,357-344 Unpaired Regions (query5'-query3',transcript3'-transcript5') 1-1,364-364 UP5: Unpaired region at 5' of query 6-7,359-358 SIL: Symmetric internal loop Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.886370186135581 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR396-Probable-3p-star_Sobic.010G258000.1_355_TPlot.pdf Position Reads Category 269 1 4 272 2 2 355 1 4 <<<<<<<<<< 501 1 4 504 1 4 505 1 4 511 1 4 515 1 4 519 2 2 520 1 4 521 1 4 522 3 0 523 2 2 524 1 4 525 1 4 526 1 4 528 1 4 532 1 4 533 2 2 539 1 4 540 1 4 542 1 4 544 2 2 547 1 4 549 1 4 553 1 4 556 1 4 600 1 4 --------------------------------------------------- --------------------------------------------------- 5' AUGCAGCAUCAUUCAGCAGAUCUC 3' Transcript: Sobic.010G278600.1:595-618 Slice Site:605 ||||||||||| ||| |||| || 3' UACGUCGUAGU-AGU--UCUA-AG 5' Query: miR172b-Probable-3p-mature SiteID: Sobic.010G278600.1:605 MFE of perfect match: -32.70 MFE of this site: -22.10 MFEratio: 0.675840978593272 Allen et al. score: 8 Paired Regions (query5'-query3',transcript3'-transcript5') 1-2,618-617 3-6,615-612 7-9,609-607 10-20,605-595 Unpaired Regions (query5'-query3',transcript3'-transcript5') x-x,616-616 BULt: Bulge on transcript side x-x,611-610 BULt: Bulge on transcript side x-x,606-606 BULt: Bulge on transcript side Degradome data file: Drought.degradome_1.fastq.trimmed.mc.fa_dd.txt Degardome Category: 4 Degradome p-value: 0.939385705485529 T-Plot file: degradome.cleaveLand.result/Drought_dgd_plot/miR172b-Probable-3p-mature_Sobic.010G278600.1_605_TPlot.pdf Position Reads Category 170 1 4 455 1 4 553 1 4 605 1 4 <<<<<<<<<< 612 1 4 613 1 4 618 1 4 625 1 4 629 2 0 631 1 4 842 1 4 886 1 4 901 1 4 904 1 4 921 1 4 1012 1 4 1088 1 4 1164 1 4 1191 1 4 1196 1 4 1199 1 4 1552 1 4 1565 1 4 2026 1 4 ---------------------------------------------------